From 322d5eea927f27bb72df0c4515a9939ec03241be Mon Sep 17 00:00:00 2001 From: Joon-Klaps Date: Tue, 30 Jul 2024 09:58:11 +0000 Subject: [PATCH 1/4] update fastp module --- CHANGELOG.md | 1 + modules.json | 2 +- modules/nf-core/fastp/main.nf | 21 +- modules/nf-core/fastp/meta.yml | 6 +- modules/nf-core/fastp/tests/main.nf.test | 823 ++++------ modules/nf-core/fastp/tests/main.nf.test.snap | 1361 ++++++++++++++--- subworkflows/local/fastq_trim_fastp_fastqc.nf | 10 +- workflows/illumina.nf | 1 + 8 files changed, 1545 insertions(+), 680 deletions(-) diff --git a/CHANGELOG.md b/CHANGELOG.md index 8b2c1bf3..7d8714aa 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -53,6 +53,7 @@ Note, since the pipeline is now using Nextflow DSL2, each process will be run wi | ---------- | ----------- | ----------- | | `freyja` | | 1.5.0 | | `multiqc` | 1.14 | 1.19 | +| `fastp` | 0.23.2 | 0.23.4 | > **NB:** Dependency has been **updated** if both old and new version information is present. > diff --git a/modules.json b/modules.json index 02ef0a88..25cf625c 100644 --- a/modules.json +++ b/modules.json @@ -107,7 +107,7 @@ }, "fastp": { "branch": "master", - "git_sha": "95cf5fe0194c7bf5cb0e3027a2eb7e7c89385080", + "git_sha": "1ceaa8ba4d0fd886dbca0e545815d905b7407de7", "installed_by": ["modules"] }, "fastqc": { diff --git a/modules/nf-core/fastp/main.nf b/modules/nf-core/fastp/main.nf index 4fc19b74..e1b9f565 100644 --- a/modules/nf-core/fastp/main.nf +++ b/modules/nf-core/fastp/main.nf @@ -10,6 +10,7 @@ process FASTP { input: tuple val(meta), path(reads) path adapter_fasta + val discard_trimmed_pass val save_trimmed_fail val save_merged @@ -18,9 +19,9 @@ process FASTP { tuple val(meta), path('*.json') , emit: json tuple val(meta), path('*.html') , emit: html tuple val(meta), path('*.log') , emit: log - path "versions.yml" , emit: versions tuple val(meta), path('*.fail.fastq.gz') , optional:true, emit: reads_fail tuple val(meta), path('*.merged.fastq.gz'), optional:true, emit: reads_merged + path "versions.yml" , emit: versions when: task.ext.when == null || task.ext.when @@ -30,6 +31,8 @@ process FASTP { def prefix = task.ext.prefix ?: "${meta.id}" def adapter_list = adapter_fasta ? "--adapter_fasta ${adapter_fasta}" : "" def fail_fastq = save_trimmed_fail && meta.single_end ? "--failed_out ${prefix}.fail.fastq.gz" : save_trimmed_fail && !meta.single_end ? "--failed_out ${prefix}.paired.fail.fastq.gz --unpaired1 ${prefix}_1.fail.fastq.gz --unpaired2 ${prefix}_2.fail.fastq.gz" : '' + def out_fq1 = discard_trimmed_pass ?: ( meta.single_end ? "--out1 ${prefix}.fastp.fastq.gz" : "--out1 ${prefix}_1.fastp.fastq.gz" ) + def out_fq2 = discard_trimmed_pass ?: "--out2 ${prefix}_2.fastp.fastq.gz" // Added soft-links to original fastqs for consistent naming in MultiQC // Use single ended for interleaved. Add --interleaved_in in config. if ( task.ext.args?.contains('--interleaved_in') ) { @@ -59,7 +62,7 @@ process FASTP { fastp \\ --in1 ${prefix}.fastq.gz \\ - --out1 ${prefix}.fastp.fastq.gz \\ + $out_fq1 \\ --thread $task.cpus \\ --json ${prefix}.fastp.json \\ --html ${prefix}.fastp.html \\ @@ -81,8 +84,8 @@ process FASTP { fastp \\ --in1 ${prefix}_1.fastq.gz \\ --in2 ${prefix}_2.fastq.gz \\ - --out1 ${prefix}_1.fastp.fastq.gz \\ - --out2 ${prefix}_2.fastp.fastq.gz \\ + $out_fq1 \\ + $out_fq2 \\ --json ${prefix}.fastp.json \\ --html ${prefix}.fastp.html \\ $adapter_list \\ @@ -103,14 +106,16 @@ process FASTP { stub: def prefix = task.ext.prefix ?: "${meta.id}" def is_single_output = task.ext.args?.contains('--interleaved_in') || meta.single_end - def touch_reads = is_single_output ? "${prefix}.fastp.fastq.gz" : "${prefix}_1.fastp.fastq.gz ${prefix}_2.fastp.fastq.gz" - def touch_merged = (!is_single_output && save_merged) ? "touch ${prefix}.merged.fastq.gz" : "" + def touch_reads = (discard_trimmed_pass) ? "" : (is_single_output) ? "echo '' | gzip > ${prefix}.fastp.fastq.gz" : "echo '' | gzip > ${prefix}_1.fastp.fastq.gz ; echo '' | gzip > ${prefix}_2.fastp.fastq.gz" + def touch_merged = (!is_single_output && save_merged) ? "echo '' | gzip > ${prefix}.merged.fastq.gz" : "" + def touch_fail_fastq = (!save_trimmed_fail) ? "" : meta.single_end ? "echo '' | gzip > ${prefix}.fail.fastq.gz" : "echo '' | gzip > ${prefix}.paired.fail.fastq.gz ; echo '' | gzip > ${prefix}_1.fail.fastq.gz ; echo '' | gzip > ${prefix}_2.fail.fastq.gz" """ - touch $touch_reads + $touch_reads + $touch_fail_fastq + $touch_merged touch "${prefix}.fastp.json" touch "${prefix}.fastp.html" touch "${prefix}.fastp.log" - $touch_merged cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/fastp/meta.yml b/modules/nf-core/fastp/meta.yml index c22a16ab..8dfecc18 100644 --- a/modules/nf-core/fastp/meta.yml +++ b/modules/nf-core/fastp/meta.yml @@ -27,12 +27,16 @@ input: type: file description: File in FASTA format containing possible adapters to remove. pattern: "*.{fasta,fna,fas,fa}" + - discard_trimmed_pass: + type: boolean + description: Specify true to not write any reads that pass trimming thresholds. | + This can be used to use fastp for the output report only. - save_trimmed_fail: type: boolean description: Specify true to save files that failed to pass trimming thresholds ending in `*.fail.fastq.gz` - save_merged: type: boolean - description: Specify true to save all merged reads to the a file ending in `*.merged.fastq.gz` + description: Specify true to save all merged reads to a file ending in `*.merged.fastq.gz` output: - meta: type: map diff --git a/modules/nf-core/fastp/tests/main.nf.test b/modules/nf-core/fastp/tests/main.nf.test index 6f1f4897..30dbb8aa 100644 --- a/modules/nf-core/fastp/tests/main.nf.test +++ b/modules/nf-core/fastp/tests/main.nf.test @@ -10,221 +10,290 @@ nextflow_process { test("test_fastp_single_end") { when { - params { - outdir = "$outputDir" - } + process { """ - adapter_fasta = [] - save_trimmed_fail = false - save_merged = false - input[0] = Channel.of([ [ id:'test', single_end:true ], [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] ]) - input[1] = adapter_fasta - input[2] = save_trimmed_fail - input[3] = save_merged + input[1] = [] + input[2] = false + input[3] = false + input[4] = false """ } } then { - def html_text = [ "Q20 bases:12.922000 K (92.984097%)", - "single end (151 cycles)" ] - def log_text = [ "Q20 bases: 12922(92.9841%)", - "reads passed filter: 99" ] - def read_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", - "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", - "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE - { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) } - } - }, - { html_text.each { html_part -> - { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } - } - }, - { assert snapshot(process.out.json).match("test_fastp_single_end_json") }, - { log_text.each { log_part -> - { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } - } - }, - { - assert snapshot( - ( - [process.out.reads[0][0].toString()] + // meta - process.out.reads.collect { file(it[1]).getName() } + - process.out.json.collect { file(it[1]).getName() } + - process.out.html.collect { file(it[1]).getName() } + - process.out.log.collect { file(it[1]).getName() } + - process.out.reads_fail.collect { file(it[1]).getName() } + - process.out.reads_merged.collect { file(it[1]).getName() } - ).sort() - ).match("test_fastp_single_end-_match") - }, - { assert snapshot(process.out.versions).match("versions_single_end") } + { assert path(process.out.html.get(0).get(1)).getText().contains("single end (151 cycles)") }, + { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 99") }, + { assert snapshot( + process.out.json, + process.out.reads, + process.out.reads_fail, + process.out.reads_merged, + process.out.versions).match() } ) } } - test("test_fastp_single_end-stub") { - - options '-stub' + test("test_fastp_paired_end") { when { - params { - outdir = "$outputDir" - } + process { """ adapter_fasta = [] + save_trimmed_pass = true save_trimmed_fail = false save_merged = false input[0] = Channel.of([ - [ id:'test', single_end:true ], - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] ]) - input[1] = adapter_fasta - input[2] = save_trimmed_fail - input[3] = save_merged + input[1] = [] + input[2] = false + input[3] = false + input[4] = false """ } } then { + assertAll( + { assert process.success }, + { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") }, + { assert path(process.out.log.get(0).get(1)).getText().contains("Q30 bases: 12281(88.3716%)") }, + { assert snapshot( + process.out.json, + process.out.reads, + process.out.reads_fail, + process.out.reads_merged, + process.out.versions).match() } + ) + } + } + test("fastp test_fastp_interleaved") { + + config './nextflow.interleaved.config' + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ] + ]) + input[1] = [] + input[2] = false + input[3] = false + input[4] = false + """ + } + } + + then { assertAll( { assert process.success }, - { - assert snapshot( - ( - [process.out.reads[0][0].toString()] + // meta - process.out.reads.collect { file(it[1]).getName() } + - process.out.json.collect { file(it[1]).getName() } + - process.out.html.collect { file(it[1]).getName() } + - process.out.log.collect { file(it[1]).getName() } + - process.out.reads_fail.collect { file(it[1]).getName() } + - process.out.reads_merged.collect { file(it[1]).getName() } - ).sort() - ).match("test_fastp_single_end-for_stub_match") - }, - { assert snapshot(process.out.versions).match("versions_single_end_stub") } + { assert path(process.out.html.get(0).get(1)).getText().contains("paired end (151 cycles + 151 cycles)") }, + { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 162") }, + { assert process.out.reads_fail == [] }, + { assert process.out.reads_merged == [] }, + { assert snapshot( + process.out.reads, + process.out.json, + process.out.versions).match() } ) } } - test("test_fastp_paired_end") { + test("test_fastp_single_end_trim_fail") { when { - params { - outdir = "$outputDir" + + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + ]) + input[1] = [] + input[2] = false + input[3] = true + input[4] = false + """ } + } + + then { + assertAll( + { assert process.success }, + { assert path(process.out.html.get(0).get(1)).getText().contains("single end (151 cycles)") }, + { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 99") }, + { assert snapshot( + process.out.json, + process.out.reads, + process.out.reads_fail, + process.out.reads_merged, + process.out.versions).match() } + ) + } + } + + test("test_fastp_paired_end_trim_fail") { + + config './nextflow.save_failed.config' + when { process { """ - adapter_fasta = [] - save_trimmed_fail = false - save_merged = false + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] + ]) + input[1] = [] + input[2] = false + input[3] = true + input[4] = false + """ + } + } + then { + assertAll( + { assert process.success }, + { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") }, + { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 162") }, + { assert snapshot( + process.out.reads, + process.out.reads_fail, + process.out.reads_merged, + process.out.json, + process.out.versions).match() } + ) + } + } + + test("test_fastp_paired_end_merged") { + + when { + process { + """ input[0] = Channel.of([ [ id:'test', single_end:false ], // meta map [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] ]) - input[1] = adapter_fasta - input[2] = save_trimmed_fail - input[3] = save_merged + input[1] = [] + input[2] = false + input[3] = false + input[4] = true """ } } then { - def html_text = [ "Q20 bases:25.719000 K (93.033098%)", - "The input has little adapter percentage (~0.000000%), probably it's trimmed before."] - def log_text = [ "No adapter detected for read1", - "Q30 bases: 12281(88.3716%)"] - def json_text = ['"passed_filter_reads": 198'] - def read1_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", - "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", - "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE - { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } - } - }, - { read2_lines.each { read2_line -> - { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } - } - }, - { html_text.each { html_part -> - { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } - } - }, - { json_text.each { json_part -> - { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } - } - }, - { log_text.each { log_part -> - { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } - } - }, - { - assert snapshot( - ( - [process.out.reads[0][0].toString()] + // meta - process.out.reads.collect { it[1].collect { item -> file(item).getName() } } + - process.out.json.collect { file(it[1]).getName() } + - process.out.html.collect { file(it[1]).getName() } + - process.out.log.collect { file(it[1]).getName() } + - process.out.reads_fail.collect { file(it[1]).getName() } + - process.out.reads_merged.collect { file(it[1]).getName() } - ).sort() - ).match("test_fastp_paired_end_match") - }, - { assert snapshot(process.out.versions).match("versions_paired_end") } + { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") }, + { assert path(process.out.log.get(0).get(1)).getText().contains("total reads: 75") }, + { assert snapshot( + process.out.json, + process.out.reads, + process.out.reads_fail, + process.out.reads_merged, + process.out.versions).match() }, ) } } - test("test_fastp_paired_end-stub") { - - options '-stub' + test("test_fastp_paired_end_merged_adapterlist") { when { - params { - outdir = "$outputDir" + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + input[1] = Channel.of([ file(params.modules_testdata_base_path + 'delete_me/fastp/adapters.fasta', checkIfExists: true) ]) + input[2] = false + input[3] = false + input[4] = true + """ } + } + + then { + assertAll( + { assert process.success }, + { assert path(process.out.html.get(0).get(1)).getText().contains("
") }, + { assert path(process.out.log.get(0).get(1)).getText().contains("total bases: 13683") }, + { assert snapshot( + process.out.json, + process.out.reads, + process.out.reads_fail, + process.out.reads_merged, + process.out.versions).match() } + ) + } + } + + test("test_fastp_single_end_qc_only") { + + when { process { """ - adapter_fasta = [] - save_trimmed_fail = false - save_merged = false + input[0] = Channel.of([ + [ id:'test', single_end:true ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + ]) + input[1] = [] + input[2] = true + input[3] = false + input[4] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert path(process.out.html.get(0).get(1)).getText().contains("single end (151 cycles)") }, + { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 99") }, + { assert snapshot( + process.out.json, + process.out.reads, + process.out.reads, + process.out.reads_fail, + process.out.reads_fail, + process.out.reads_merged, + process.out.reads_merged, + process.out.versions).match() } + ) + } + } + test("test_fastp_paired_end_qc_only") { + + when { + process { + """ input[0] = Channel.of([ [ id:'test', single_end:false ], // meta map [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] ]) - input[1] = adapter_fasta - input[2] = save_trimmed_fail - input[3] = save_merged + input[1] = [] + input[2] = true + input[3] = false + input[4] = false """ } } @@ -232,114 +301,99 @@ nextflow_process { then { assertAll( { assert process.success }, - { - assert snapshot( - ( - [process.out.reads[0][0].toString()] + // meta - process.out.reads.collect { it[1].collect { item -> file(item).getName() } } + - process.out.json.collect { file(it[1]).getName() } + - process.out.html.collect { file(it[1]).getName() } + - process.out.log.collect { file(it[1]).getName() } + - process.out.reads_fail.collect { file(it[1]).getName() } + - process.out.reads_merged.collect { file(it[1]).getName() } - ).sort() - ).match("test_fastp_paired_end-for_stub_match") - }, - { assert snapshot(process.out.versions).match("versions_paired_end-stub") } + { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") }, + { assert path(process.out.log.get(0).get(1)).getText().contains("Q30 bases: 12281(88.3716%)") }, + { assert snapshot( + process.out.json, + process.out.reads, + process.out.reads, + process.out.reads_fail, + process.out.reads_fail, + process.out.reads_merged, + process.out.reads_merged, + process.out.versions).match() } ) } } - test("fastp test_fastp_interleaved") { + test("test_fastp_single_end - stub") { + + options "-stub" - config './nextflow.interleaved.config' when { - params { - outdir = "$outputDir" + + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + ]) + input[1] = [] + input[2] = false + input[3] = false + input[4] = false + """ } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_fastp_paired_end - stub") { + + options "-stub" + + when { + process { """ adapter_fasta = [] + save_trimmed_pass = true save_trimmed_fail = false save_merged = false input[0] = Channel.of([ - [ id:'test', single_end:true ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ] + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] ]) - input[1] = adapter_fasta - input[2] = save_trimmed_fail - input[3] = save_merged + input[1] = [] + input[2] = false + input[3] = false + input[4] = false """ } } then { - def html_text = [ "Q20 bases:25.719000 K (93.033098%)", - "paired end (151 cycles + 151 cycles)"] - def log_text = [ "Q20 bases: 12922(92.9841%)", - "reads passed filter: 162"] - def read_lines = [ "@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", - "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", - "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE - { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) } - } - }, - { html_text.each { html_part -> - { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } - } - }, - { assert snapshot(process.out.json).match("fastp test_fastp_interleaved_json") }, - { log_text.each { log_part -> - { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } - } - }, - { - assert snapshot( - ( - [process.out.reads[0][0].toString()] + // meta - process.out.reads.collect { file(it[1]).getName() } + - process.out.json.collect { file(it[1]).getName() } + - process.out.html.collect { file(it[1]).getName() } + - process.out.log.collect { file(it[1]).getName() } + - process.out.reads_fail.collect { file(it[1]).getName() } + - process.out.reads_merged.collect { file(it[1]).getName() } - ).sort() - ).match("test_fastp_interleaved-_match") - }, - { assert snapshot(process.out.versions).match("versions_interleaved") } + { assert snapshot(process.out).match() } ) } } - test("fastp test_fastp_interleaved-stub") { + test("fastp - stub test_fastp_interleaved") { - options '-stub' + options "-stub" config './nextflow.interleaved.config' when { - params { - outdir = "$outputDir" - } process { """ - adapter_fasta = [] - save_trimmed_fail = false - save_merged = false - input[0] = Channel.of([ [ id:'test', single_end:true ], // meta map [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ] ]) - input[1] = adapter_fasta - input[2] = save_trimmed_fail - input[3] = save_merged + input[1] = [] + input[2] = false + input[3] = false + input[4] = false """ } } @@ -347,277 +401,112 @@ nextflow_process { then { assertAll( { assert process.success }, - { - assert snapshot( - ( - [process.out.reads[0][0].toString()] + // meta - process.out.reads.collect { file(it[1]).getName() } + - process.out.json.collect { file(it[1]).getName() } + - process.out.html.collect { file(it[1]).getName() } + - process.out.log.collect { file(it[1]).getName() } + - process.out.reads_fail.collect { file(it[1]).getName() } + - process.out.reads_merged.collect { file(it[1]).getName() } - ).sort() - ).match("test_fastp_interleaved-for_stub_match") - }, - { assert snapshot(process.out.versions).match("versions_interleaved-stub") } + { assert snapshot(process.out).match() } ) } } - test("test_fastp_single_end_trim_fail") { + test("test_fastp_single_end_trim_fail - stub") { + + options "-stub" when { - params { - outdir = "$outputDir" - } + process { """ - adapter_fasta = [] - save_trimmed_fail = true - save_merged = false - input[0] = Channel.of([ [ id:'test', single_end:true ], // meta map [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] ]) - input[1] = adapter_fasta - input[2] = save_trimmed_fail - input[3] = save_merged + input[1] = [] + input[2] = false + input[3] = true + input[4] = false """ } } then { - def html_text = [ "Q20 bases:12.922000 K (92.984097%)", - "single end (151 cycles)"] - def log_text = [ "Q20 bases: 12922(92.9841%)", - "reads passed filter: 99" ] - def read_lines = [ "@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", - "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", - "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE - { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) } - } - }, - { failed_read_lines.each { failed_read_line -> - { assert path(process.out.reads_fail.get(0).get(1)).linesGzip.contains(failed_read_line) } - } - }, - { html_text.each { html_part -> - { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } - } - }, - { assert snapshot(process.out.json).match("test_fastp_single_end_trim_fail_json") }, - { log_text.each { log_part -> - { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } - } - }, - { assert snapshot(process.out.versions).match("versions_single_end_trim_fail") } + { assert snapshot(process.out).match() } ) } } - test("test_fastp_paired_end_trim_fail") { + test("test_fastp_paired_end_trim_fail - stub") { + + options "-stub" config './nextflow.save_failed.config' when { - params { - outdir = "$outputDir" - } process { """ - adapter_fasta = [] - save_trimmed_fail = true - save_merged = false - input[0] = Channel.of([ [ id:'test', single_end:false ], // meta map [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] ]) - input[1] = adapter_fasta - input[2] = save_trimmed_fail - input[3] = save_merged + input[1] = [] + input[2] = false + input[3] = true + input[4] = false """ } } then { - def html_text = [ "Q20 bases:25.719000 K (93.033098%)", - "The input has little adapter percentage (~0.000000%), probably it's trimmed before."] - def log_text = [ "No adapter detected for read1", - "Q30 bases: 12281(88.3716%)"] - def json_text = ['"passed_filter_reads": 162'] - def read1_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", - "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", - "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE - { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } - } - }, - { read2_lines.each { read2_line -> - { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } - } - }, - { failed_read2_lines.each { failed_read2_line -> - { assert path(process.out.reads_fail.get(0).get(1).get(2)).linesGzip.contains(failed_read2_line) } - } - }, - { html_text.each { html_part -> - { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } - } - }, - { json_text.each { json_part -> - { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } - } - }, - { log_text.each { log_part -> - { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } - } - }, - { assert snapshot(process.out.versions).match("versions_paired_end_trim_fail") } + { assert snapshot(process.out).match() } ) } } - test("test_fastp_paired_end_merged") { + test("test_fastp_paired_end_merged - stub") { + + options "-stub" when { - params { - outdir = "$outputDir" - } process { """ - adapter_fasta = [] - save_trimmed_fail = false - save_merged = true input[0] = Channel.of([ [ id:'test', single_end:false ], // meta map [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] ]) - input[1] = adapter_fasta - input[2] = save_trimmed_fail - input[3] = save_merged + input[1] = [] + input[2] = false + input[3] = false + input[4] = true """ } } then { - def html_text = [ "
"] - def log_text = [ "Merged and filtered:", - "total reads: 75", - "total bases: 13683"] - def json_text = ['"merged_and_filtered": {', '"total_reads": 75', '"total_bases": 13683'] - def read1_lines = [ "@ERR5069949.1066259 NS500628:121:HK3MMAFX2:1:11312:18369:8333/1", - "CCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTC", - "AAAAAEAEEAEEEEEEEEEEEEEEEEAEEEEAEEEEEEEEAEEEEEEEEEEEEEEEEE/EAEEEEEE/6EEEEEEEEEEAEEAEEE/EE/AEEAEEEEEAEEEA/EEAAEAE - { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } - } - }, - { read2_lines.each { read2_line -> - { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } - } - }, - { read_merged_lines.each { read_merged_line -> - { assert path(process.out.reads_merged.get(0).get(1)).linesGzip.contains(read_merged_line) } - } - }, - { html_text.each { html_part -> - { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } - } - }, - { json_text.each { json_part -> - { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } - } - }, - { log_text.each { log_part -> - { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } - } - }, - { - assert snapshot( - ( - [process.out.reads[0][0].toString()] + // meta - process.out.reads.collect { it[1].collect { item -> file(item).getName() } } + - process.out.json.collect { file(it[1]).getName() } + - process.out.html.collect { file(it[1]).getName() } + - process.out.log.collect { file(it[1]).getName() } + - process.out.reads_fail.collect { file(it[1]).getName() } + - process.out.reads_merged.collect { file(it[1]).getName() } - ).sort() - ).match("test_fastp_paired_end_merged_match") - }, - { assert snapshot(process.out.versions).match("versions_paired_end_merged") } + { assert snapshot(process.out).match() } ) } } - test("test_fastp_paired_end_merged-stub") { + test("test_fastp_paired_end_merged_adapterlist - stub") { - options '-stub' + options "-stub" when { - params { - outdir = "$outputDir" - } process { """ - adapter_fasta = [] - save_trimmed_fail = false - save_merged = true - input[0] = Channel.of([ [ id:'test', single_end:false ], // meta map [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] ]) - input[1] = adapter_fasta - input[2] = save_trimmed_fail - input[3] = save_merged + input[1] = Channel.of([ file(params.modules_testdata_base_path + 'delete_me/fastp/adapters.fasta', checkIfExists: true) ]) + input[2] = false + input[3] = false + input[4] = true """ } } @@ -625,101 +514,63 @@ nextflow_process { then { assertAll( { assert process.success }, - { - assert snapshot( - ( - [process.out.reads[0][0].toString()] + // meta - process.out.reads.collect { it[1].collect { item -> file(item).getName() } } + - process.out.json.collect { file(it[1]).getName() } + - process.out.html.collect { file(it[1]).getName() } + - process.out.log.collect { file(it[1]).getName() } + - process.out.reads_fail.collect { file(it[1]).getName() } + - process.out.reads_merged.collect { file(it[1]).getName() } - ).sort() - ).match("test_fastp_paired_end_merged-for_stub_match") - }, - { assert snapshot(process.out.versions).match("versions_paired_end_merged_stub") } + { assert snapshot(process.out).match() } ) } } - test("test_fastp_paired_end_merged_adapterlist") { + test("test_fastp_single_end_qc_only - stub") { + + options "-stub" when { - params { - outdir = "$outputDir" - } process { """ - adapter_fasta = Channel.of([ file(params.modules_testdata_base_path + 'delete_me/fastp/adapters.fasta', checkIfExists: true) ]) - save_trimmed_fail = false - save_merged = true + input[0] = Channel.of([ + [ id:'test', single_end:true ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + ]) + input[1] = [] + input[2] = true + input[3] = false + input[4] = false + """ + } + } + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_fastp_paired_end_qc_only - stub") { + + options "-stub" + + when { + process { + """ input[0] = Channel.of([ [ id:'test', single_end:false ], // meta map [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] ]) - input[1] = adapter_fasta - input[2] = save_trimmed_fail - input[3] = save_merged + input[1] = [] + input[2] = true + input[3] = false + input[4] = false """ } } then { - def html_text = [ "
"] - def log_text = [ "Merged and filtered:", - "total reads: 75", - "total bases: 13683"] - def json_text = ['"merged_and_filtered": {', '"total_reads": 75', '"total_bases": 13683',"--adapter_fasta"] - def read1_lines = ["@ERR5069949.1066259 NS500628:121:HK3MMAFX2:1:11312:18369:8333/1", - "CCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTC", - "AAAAAEAEEAEEEEEEEEEEEEEEEEAEEEEAEEEEEEEEAEEEEEEEEEEEEEEEEE/EAEEEEEE/6EEEEEEEEEEAEEAEEE/EE/AEEAEEEEEAEEEA/EEAAEAE - { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } - } - }, - { read2_lines.each { read2_line -> - { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } - } - }, - { read_merged_lines.each { read_merged_line -> - { assert path(process.out.reads_merged.get(0).get(1)).linesGzip.contains(read_merged_line) } - } - }, - { html_text.each { html_part -> - { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } - } - }, - { json_text.each { json_part -> - { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } - } - }, - { log_text.each { log_part -> - { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } - } - }, - { assert snapshot(process.out.versions).match("versions_paired_end_merged_adapterlist") } + { assert snapshot(process.out).match() } ) } } -} +} \ No newline at end of file diff --git a/modules/nf-core/fastp/tests/main.nf.test.snap b/modules/nf-core/fastp/tests/main.nf.test.snap index 3e876288..54be7e45 100644 --- a/modules/nf-core/fastp/tests/main.nf.test.snap +++ b/modules/nf-core/fastp/tests/main.nf.test.snap @@ -1,55 +1,178 @@ { - "fastp test_fastp_interleaved_json": { + "test_fastp_single_end_qc_only - stub": { "content": [ - [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.json:md5,b24e0624df5cc0b11cd5ba21b726fb22" + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + + ], + "5": [ + + ], + "6": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ], + "html": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "json": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + + ], + "reads_fail": [ + + ], + "reads_merged": [ + + ], + "versions": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" ] - ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-03-18T16:19:15.063001" + "timestamp": "2024-07-05T14:31:10.841098" }, - "test_fastp_paired_end_merged-for_stub_match": { + "test_fastp_paired_end": { "content": [ [ [ - "test_1.fastp.fastq.gz", - "test_2.fastp.fastq.gz" - ], - "test.fastp.html", - "test.fastp.json", - "test.fastp.log", - "test.merged.fastq.gz", - "{id=test, single_end=false}" + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7", + "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39" + ] + ] + ], + [ + + ], + [ + + ], + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-01-17T18:10:13.467574" + "timestamp": "2024-07-05T13:43:28.665779" }, - "versions_interleaved": { + "test_fastp_paired_end_merged_adapterlist": { "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,5914ca3f21ce162123a824e33e8564f6" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672", + "test_2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba" + ] + ] + ], + [ + + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5" + ] + ], [ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-01T11:56:24.615634793" + "timestamp": "2024-07-05T13:44:18.210375" }, - "test_fastp_single_end_json": { + "test_fastp_single_end_qc_only": { "content": [ [ [ @@ -57,274 +180,1152 @@ "id": "test", "single_end": true }, - "test.fastp.json:md5,c852d7a6dba5819e4ac8d9673bedcacc" + "test.fastp.json:md5,5cc5f01e449309e0e689ed6f51a2294a" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-03-18T16:18:43.526412" - }, - "versions_paired_end": { - "content": [ + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], [ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-01T11:55:42.333545689" + "timestamp": "2024-07-05T13:44:27.380974" }, - "test_fastp_paired_end_match": { + "test_fastp_paired_end_trim_fail": { "content": [ [ [ - "test_1.fastp.fastq.gz", - "test_2.fastp.fastq.gz" - ], - "test.fastp.html", - "test.fastp.json", - "test.fastp.log", - "{id=test, single_end=false}" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-02-01T12:03:06.431833729" - }, - "test_fastp_interleaved-_match": { - "content": [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,6ff32a64c5188b9a9192be1398c262c7", + "test_2.fastp.fastq.gz:md5,db0cb7c9977e94ac2b4b446ebd017a8a" + ] + ] + ], [ - "test.fastp.fastq.gz", - "test.fastp.html", - "test.fastp.json", - "test.fastp.log", - "{id=test, single_end=true}" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-03-18T16:19:15.111894" - }, - "test_fastp_paired_end_merged_match": { - "content": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.paired.fail.fastq.gz:md5,409b687c734cedd7a1fec14d316e1366", + "test_1.fail.fastq.gz:md5,4f273cf3159c13f79e8ffae12f5661f6", + "test_2.fail.fastq.gz:md5,f97b9edefb5649aab661fbc9e71fc995" + ] + ] + ], + [ + + ], [ [ - "test_1.fastp.fastq.gz", - "test_2.fastp.fastq.gz" - ], - "test.fastp.html", - "test.fastp.json", - "test.fastp.log", - "test.merged.fastq.gz", - "{id=test, single_end=false}" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-02-01T12:08:44.496251446" - }, - "versions_single_end_stub": { - "content": [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,4c3268ddb50ea5b33125984776aa3519" + ] + ], [ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-01T11:55:27.354051299" + "timestamp": "2024-07-05T13:43:58.749589" }, - "versions_interleaved-stub": { + "fastp - stub test_fastp_interleaved": { "content": [ - [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" - ] + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + + ], + "5": [ + + ], + "6": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ], + "html": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "json": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "reads_fail": [ + + ], + "reads_merged": [ + + ], + "versions": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-01T11:56:46.535528418" + "timestamp": "2024-07-05T13:50:00.270029" }, - "versions_single_end_trim_fail": { + "test_fastp_single_end - stub": { "content": [ - [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" - ] + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + + ], + "5": [ + + ], + "6": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ], + "html": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "json": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "reads_fail": [ + + ], + "reads_merged": [ + + ], + "versions": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-01T11:59:03.724591407" + "timestamp": "2024-07-05T13:49:42.502789" }, - "test_fastp_paired_end-for_stub_match": { + "test_fastp_paired_end_merged_adapterlist - stub": { "content": [ - [ - [ - "test_1.fastp.fastq.gz", - "test_2.fastp.fastq.gz" + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] ], - "test.fastp.html", - "test.fastp.json", - "test.fastp.log", - "{id=test, single_end=false}" - ] + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "6": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "json": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "reads_fail": [ + + ], + "reads_merged": [ + [ + { + "id": "test", + "single_end": false + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "versions": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-01-17T18:07:15.398827" + "timestamp": "2024-07-05T13:54:53.458252" }, - "versions_paired_end-stub": { + "test_fastp_paired_end_merged - stub": { "content": [ - [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" - ] + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "6": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "json": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "reads_fail": [ + + ], + "reads_merged": [ + [ + { + "id": "test", + "single_end": false + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "versions": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-01T11:56:06.50017282" + "timestamp": "2024-07-05T13:50:27.689379" }, - "versions_single_end": { + "test_fastp_paired_end_merged": { "content": [ [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-02-01T11:55:07.67921647" - }, - "versions_paired_end_merged_stub": { - "content": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,b712fd68ed0322f4bec49ff2a5237fcc" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672", + "test_2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba" + ] + ] + ], + [ + + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5" + ] + ], [ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-01T11:59:47.350653154" + "timestamp": "2024-07-05T13:44:08.68476" }, - "test_fastp_interleaved-for_stub_match": { + "test_fastp_paired_end - stub": { "content": [ - [ - "test.fastp.fastq.gz", - "test.fastp.html", - "test.fastp.json", - "test.fastp.log", - "{id=test, single_end=true}" - ] + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + + ], + "5": [ + + ], + "6": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "json": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "reads_fail": [ + + ], + "reads_merged": [ + + ], + "versions": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-01-17T18:08:06.127974" + "timestamp": "2024-07-05T13:49:51.679221" }, - "versions_paired_end_trim_fail": { + "test_fastp_single_end": { "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,c852d7a6dba5819e4ac8d9673bedcacc" + ] + ], + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7" + ] + ], + [ + + ], + [ + + ], [ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-01T11:59:18.140484878" + "timestamp": "2024-07-05T13:43:18.834322" }, - "test_fastp_single_end-for_stub_match": { + "test_fastp_single_end_trim_fail - stub": { "content": [ - [ - "test.fastp.fastq.gz", - "test.fastp.html", - "test.fastp.json", - "test.fastp.log", - "{id=test, single_end=true}" - ] + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "5": [ + + ], + "6": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ], + "html": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "json": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "reads_fail": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "reads_merged": [ + + ], + "versions": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-01-17T18:06:00.244202" + "timestamp": "2024-07-05T14:05:36.898142" }, - "test_fastp_single_end-_match": { + "test_fastp_paired_end_trim_fail - stub": { "content": [ - [ - "test.fastp.fastq.gz", - "test.fastp.html", - "test.fastp.json", - "test.fastp.log", - "{id=test, single_end=true}" - ] + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.paired.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_1.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "5": [ + + ], + "6": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "json": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "reads_fail": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.paired.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_1.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "reads_merged": [ + + ], + "versions": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-03-18T16:18:43.580336" + "timestamp": "2024-07-05T14:05:49.212847" }, - "versions_paired_end_merged_adapterlist": { + "fastp test_fastp_interleaved": { "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.fastq.gz:md5,217d62dc13a23e92513a1bd8e1bcea39" + ] + ], + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,b24e0624df5cc0b11cd5ba21b726fb22" + ] + ], [ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-01T12:05:37.845370554" + "timestamp": "2024-07-05T13:43:38.910832" }, - "versions_paired_end_merged": { + "test_fastp_single_end_trim_fail": { "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,9a7ee180f000e8d00c7fb67f06293eb5" + ] + ], + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7" + ] + ], + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fail.fastq.gz:md5,3e4aaadb66a5b8fc9b881bf39c227abd" + ] + ], + [ + + ], [ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-01T11:59:32.860543858" + "timestamp": "2024-07-05T13:43:48.22378" }, - "test_fastp_single_end_trim_fail_json": { + "test_fastp_paired_end_qc_only": { "content": [ [ [ { "id": "test", - "single_end": true + "single_end": false }, - "test.fastp.json:md5,9a7ee180f000e8d00c7fb67f06293eb5" + "test.fastp.json:md5,623064a45912dac6f2b64e3f2e9901df" ] + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-05T13:44:36.334938" + }, + "test_fastp_paired_end_qc_only - stub": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + + ], + "5": [ + + ], + "6": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "json": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + + ], + "reads_fail": [ + + ], + "reads_merged": [ + + ], + "versions": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" }, - "timestamp": "2024-01-17T18:08:41.942317" + "timestamp": "2024-07-05T14:31:27.096468" } } \ No newline at end of file diff --git a/subworkflows/local/fastq_trim_fastp_fastqc.nf b/subworkflows/local/fastq_trim_fastp_fastqc.nf index 101741c8..cdfcc871 100644 --- a/subworkflows/local/fastq_trim_fastp_fastqc.nf +++ b/subworkflows/local/fastq_trim_fastp_fastqc.nf @@ -18,10 +18,11 @@ def getFastpReadsAfterFiltering(json_file) { workflow FASTQ_TRIM_FASTP_FASTQC { take: - reads // channel: [ val(meta), [ reads ] ] - adapter_fasta // file: adapter.fasta - save_trimmed_fail // value: boolean - save_merged // value: boolean + reads // channel: [ val(meta), [ reads ] ] + adapter_fasta // file: adapter.fasta + discard_trimmed_pass // value: boolean + save_trimmed_fail // value: boolean + save_merged // value: boolean main: @@ -50,6 +51,7 @@ workflow FASTQ_TRIM_FASTP_FASTQC { FASTP ( reads, adapter_fasta, + discard_trimmed_pass, save_trimmed_fail, save_merged ) diff --git a/workflows/illumina.nf b/workflows/illumina.nf index 78bf9d14..393e78bd 100644 --- a/workflows/illumina.nf +++ b/workflows/illumina.nf @@ -204,6 +204,7 @@ workflow ILLUMINA { FASTQ_TRIM_FASTP_FASTQC ( ch_cat_fastq, [], + false, params.save_trimmed_fail, false ) From f67d6015d3e00aeadd2716c7fc51b9023ffd5491 Mon Sep 17 00:00:00 2001 From: Joon-Klaps Date: Tue, 30 Jul 2024 10:03:46 +0000 Subject: [PATCH 2/4] update changelog to include PR --- CHANGELOG.md | 1 + 1 file changed, 1 insertion(+) diff --git a/CHANGELOG.md b/CHANGELOG.md index 7d8714aa..8c05c8c5 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -26,6 +26,7 @@ Thank you to everyone else that has contributed by reporting bugs, enhancements - [[PR #401](https://github.com/nf-core/viralrecon/pull/401)] - Added option to add a custom annotation - [[PR #417](https://github.com/nf-core/viralrecon/pull/417)] - Allow skipping of Freyja bootstrapping module & freyja module update - [[PR #434](https://github.com/nf-core/viralrecon/pull/434)] - Add blast result filtering through `min_contig_length` and `min_perc_contig_aligned`. +- [[PR #438](https://github.com/nf-core/viralrecon/pull/438)] - Update fastp container to 0.23.4 ### Parameters From a905f6e1eeb16859a0cbead549c1ebfc165cbc3d Mon Sep 17 00:00:00 2001 From: Joon-Klaps Date: Tue, 30 Jul 2024 09:58:11 +0000 Subject: [PATCH 3/4] update fastp module --- CHANGELOG.md | 3 +- modules.json | 2 +- modules/nf-core/fastp/main.nf | 21 +- modules/nf-core/fastp/meta.yml | 6 +- modules/nf-core/fastp/tests/main.nf.test | 823 ++++------ modules/nf-core/fastp/tests/main.nf.test.snap | 1361 ++++++++++++++--- subworkflows/local/fastq_trim_fastp_fastqc.nf | 10 +- workflows/illumina.nf | 1 + 8 files changed, 1546 insertions(+), 681 deletions(-) diff --git a/CHANGELOG.md b/CHANGELOG.md index 07d99191..6769e1eb 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -53,9 +53,10 @@ Note, since the pipeline is now using Nextflow DSL2, each process will be run wi | Dependency | Old version | New version | | ---------- | ----------- | ----------- | +| `cutadapt` | | 4.6 | +| `fastp` | 0.23.2 | 0.23.4 | | `freyja` | | 1.5.0 | | `multiqc` | 1.14 | 1.19 | -| `cutadapt` | | 4.6 | > **NB:** Dependency has been **updated** if both old and new version information is present. > diff --git a/modules.json b/modules.json index 518ab010..8567e1d4 100644 --- a/modules.json +++ b/modules.json @@ -112,7 +112,7 @@ }, "fastp": { "branch": "master", - "git_sha": "95cf5fe0194c7bf5cb0e3027a2eb7e7c89385080", + "git_sha": "1ceaa8ba4d0fd886dbca0e545815d905b7407de7", "installed_by": ["modules"] }, "fastqc": { diff --git a/modules/nf-core/fastp/main.nf b/modules/nf-core/fastp/main.nf index 4fc19b74..e1b9f565 100644 --- a/modules/nf-core/fastp/main.nf +++ b/modules/nf-core/fastp/main.nf @@ -10,6 +10,7 @@ process FASTP { input: tuple val(meta), path(reads) path adapter_fasta + val discard_trimmed_pass val save_trimmed_fail val save_merged @@ -18,9 +19,9 @@ process FASTP { tuple val(meta), path('*.json') , emit: json tuple val(meta), path('*.html') , emit: html tuple val(meta), path('*.log') , emit: log - path "versions.yml" , emit: versions tuple val(meta), path('*.fail.fastq.gz') , optional:true, emit: reads_fail tuple val(meta), path('*.merged.fastq.gz'), optional:true, emit: reads_merged + path "versions.yml" , emit: versions when: task.ext.when == null || task.ext.when @@ -30,6 +31,8 @@ process FASTP { def prefix = task.ext.prefix ?: "${meta.id}" def adapter_list = adapter_fasta ? "--adapter_fasta ${adapter_fasta}" : "" def fail_fastq = save_trimmed_fail && meta.single_end ? "--failed_out ${prefix}.fail.fastq.gz" : save_trimmed_fail && !meta.single_end ? "--failed_out ${prefix}.paired.fail.fastq.gz --unpaired1 ${prefix}_1.fail.fastq.gz --unpaired2 ${prefix}_2.fail.fastq.gz" : '' + def out_fq1 = discard_trimmed_pass ?: ( meta.single_end ? "--out1 ${prefix}.fastp.fastq.gz" : "--out1 ${prefix}_1.fastp.fastq.gz" ) + def out_fq2 = discard_trimmed_pass ?: "--out2 ${prefix}_2.fastp.fastq.gz" // Added soft-links to original fastqs for consistent naming in MultiQC // Use single ended for interleaved. Add --interleaved_in in config. if ( task.ext.args?.contains('--interleaved_in') ) { @@ -59,7 +62,7 @@ process FASTP { fastp \\ --in1 ${prefix}.fastq.gz \\ - --out1 ${prefix}.fastp.fastq.gz \\ + $out_fq1 \\ --thread $task.cpus \\ --json ${prefix}.fastp.json \\ --html ${prefix}.fastp.html \\ @@ -81,8 +84,8 @@ process FASTP { fastp \\ --in1 ${prefix}_1.fastq.gz \\ --in2 ${prefix}_2.fastq.gz \\ - --out1 ${prefix}_1.fastp.fastq.gz \\ - --out2 ${prefix}_2.fastp.fastq.gz \\ + $out_fq1 \\ + $out_fq2 \\ --json ${prefix}.fastp.json \\ --html ${prefix}.fastp.html \\ $adapter_list \\ @@ -103,14 +106,16 @@ process FASTP { stub: def prefix = task.ext.prefix ?: "${meta.id}" def is_single_output = task.ext.args?.contains('--interleaved_in') || meta.single_end - def touch_reads = is_single_output ? "${prefix}.fastp.fastq.gz" : "${prefix}_1.fastp.fastq.gz ${prefix}_2.fastp.fastq.gz" - def touch_merged = (!is_single_output && save_merged) ? "touch ${prefix}.merged.fastq.gz" : "" + def touch_reads = (discard_trimmed_pass) ? "" : (is_single_output) ? "echo '' | gzip > ${prefix}.fastp.fastq.gz" : "echo '' | gzip > ${prefix}_1.fastp.fastq.gz ; echo '' | gzip > ${prefix}_2.fastp.fastq.gz" + def touch_merged = (!is_single_output && save_merged) ? "echo '' | gzip > ${prefix}.merged.fastq.gz" : "" + def touch_fail_fastq = (!save_trimmed_fail) ? "" : meta.single_end ? "echo '' | gzip > ${prefix}.fail.fastq.gz" : "echo '' | gzip > ${prefix}.paired.fail.fastq.gz ; echo '' | gzip > ${prefix}_1.fail.fastq.gz ; echo '' | gzip > ${prefix}_2.fail.fastq.gz" """ - touch $touch_reads + $touch_reads + $touch_fail_fastq + $touch_merged touch "${prefix}.fastp.json" touch "${prefix}.fastp.html" touch "${prefix}.fastp.log" - $touch_merged cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/fastp/meta.yml b/modules/nf-core/fastp/meta.yml index c22a16ab..8dfecc18 100644 --- a/modules/nf-core/fastp/meta.yml +++ b/modules/nf-core/fastp/meta.yml @@ -27,12 +27,16 @@ input: type: file description: File in FASTA format containing possible adapters to remove. pattern: "*.{fasta,fna,fas,fa}" + - discard_trimmed_pass: + type: boolean + description: Specify true to not write any reads that pass trimming thresholds. | + This can be used to use fastp for the output report only. - save_trimmed_fail: type: boolean description: Specify true to save files that failed to pass trimming thresholds ending in `*.fail.fastq.gz` - save_merged: type: boolean - description: Specify true to save all merged reads to the a file ending in `*.merged.fastq.gz` + description: Specify true to save all merged reads to a file ending in `*.merged.fastq.gz` output: - meta: type: map diff --git a/modules/nf-core/fastp/tests/main.nf.test b/modules/nf-core/fastp/tests/main.nf.test index 6f1f4897..30dbb8aa 100644 --- a/modules/nf-core/fastp/tests/main.nf.test +++ b/modules/nf-core/fastp/tests/main.nf.test @@ -10,221 +10,290 @@ nextflow_process { test("test_fastp_single_end") { when { - params { - outdir = "$outputDir" - } + process { """ - adapter_fasta = [] - save_trimmed_fail = false - save_merged = false - input[0] = Channel.of([ [ id:'test', single_end:true ], [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] ]) - input[1] = adapter_fasta - input[2] = save_trimmed_fail - input[3] = save_merged + input[1] = [] + input[2] = false + input[3] = false + input[4] = false """ } } then { - def html_text = [ "Q20 bases:12.922000 K (92.984097%)", - "single end (151 cycles)" ] - def log_text = [ "Q20 bases: 12922(92.9841%)", - "reads passed filter: 99" ] - def read_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", - "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", - "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE - { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) } - } - }, - { html_text.each { html_part -> - { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } - } - }, - { assert snapshot(process.out.json).match("test_fastp_single_end_json") }, - { log_text.each { log_part -> - { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } - } - }, - { - assert snapshot( - ( - [process.out.reads[0][0].toString()] + // meta - process.out.reads.collect { file(it[1]).getName() } + - process.out.json.collect { file(it[1]).getName() } + - process.out.html.collect { file(it[1]).getName() } + - process.out.log.collect { file(it[1]).getName() } + - process.out.reads_fail.collect { file(it[1]).getName() } + - process.out.reads_merged.collect { file(it[1]).getName() } - ).sort() - ).match("test_fastp_single_end-_match") - }, - { assert snapshot(process.out.versions).match("versions_single_end") } + { assert path(process.out.html.get(0).get(1)).getText().contains("single end (151 cycles)") }, + { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 99") }, + { assert snapshot( + process.out.json, + process.out.reads, + process.out.reads_fail, + process.out.reads_merged, + process.out.versions).match() } ) } } - test("test_fastp_single_end-stub") { - - options '-stub' + test("test_fastp_paired_end") { when { - params { - outdir = "$outputDir" - } + process { """ adapter_fasta = [] + save_trimmed_pass = true save_trimmed_fail = false save_merged = false input[0] = Channel.of([ - [ id:'test', single_end:true ], - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] ]) - input[1] = adapter_fasta - input[2] = save_trimmed_fail - input[3] = save_merged + input[1] = [] + input[2] = false + input[3] = false + input[4] = false """ } } then { + assertAll( + { assert process.success }, + { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") }, + { assert path(process.out.log.get(0).get(1)).getText().contains("Q30 bases: 12281(88.3716%)") }, + { assert snapshot( + process.out.json, + process.out.reads, + process.out.reads_fail, + process.out.reads_merged, + process.out.versions).match() } + ) + } + } + test("fastp test_fastp_interleaved") { + + config './nextflow.interleaved.config' + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ] + ]) + input[1] = [] + input[2] = false + input[3] = false + input[4] = false + """ + } + } + + then { assertAll( { assert process.success }, - { - assert snapshot( - ( - [process.out.reads[0][0].toString()] + // meta - process.out.reads.collect { file(it[1]).getName() } + - process.out.json.collect { file(it[1]).getName() } + - process.out.html.collect { file(it[1]).getName() } + - process.out.log.collect { file(it[1]).getName() } + - process.out.reads_fail.collect { file(it[1]).getName() } + - process.out.reads_merged.collect { file(it[1]).getName() } - ).sort() - ).match("test_fastp_single_end-for_stub_match") - }, - { assert snapshot(process.out.versions).match("versions_single_end_stub") } + { assert path(process.out.html.get(0).get(1)).getText().contains("paired end (151 cycles + 151 cycles)") }, + { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 162") }, + { assert process.out.reads_fail == [] }, + { assert process.out.reads_merged == [] }, + { assert snapshot( + process.out.reads, + process.out.json, + process.out.versions).match() } ) } } - test("test_fastp_paired_end") { + test("test_fastp_single_end_trim_fail") { when { - params { - outdir = "$outputDir" + + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + ]) + input[1] = [] + input[2] = false + input[3] = true + input[4] = false + """ } + } + + then { + assertAll( + { assert process.success }, + { assert path(process.out.html.get(0).get(1)).getText().contains("single end (151 cycles)") }, + { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 99") }, + { assert snapshot( + process.out.json, + process.out.reads, + process.out.reads_fail, + process.out.reads_merged, + process.out.versions).match() } + ) + } + } + + test("test_fastp_paired_end_trim_fail") { + + config './nextflow.save_failed.config' + when { process { """ - adapter_fasta = [] - save_trimmed_fail = false - save_merged = false + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] + ]) + input[1] = [] + input[2] = false + input[3] = true + input[4] = false + """ + } + } + then { + assertAll( + { assert process.success }, + { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") }, + { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 162") }, + { assert snapshot( + process.out.reads, + process.out.reads_fail, + process.out.reads_merged, + process.out.json, + process.out.versions).match() } + ) + } + } + + test("test_fastp_paired_end_merged") { + + when { + process { + """ input[0] = Channel.of([ [ id:'test', single_end:false ], // meta map [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] ]) - input[1] = adapter_fasta - input[2] = save_trimmed_fail - input[3] = save_merged + input[1] = [] + input[2] = false + input[3] = false + input[4] = true """ } } then { - def html_text = [ "Q20 bases:25.719000 K (93.033098%)", - "The input has little adapter percentage (~0.000000%), probably it's trimmed before."] - def log_text = [ "No adapter detected for read1", - "Q30 bases: 12281(88.3716%)"] - def json_text = ['"passed_filter_reads": 198'] - def read1_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", - "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", - "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE - { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } - } - }, - { read2_lines.each { read2_line -> - { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } - } - }, - { html_text.each { html_part -> - { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } - } - }, - { json_text.each { json_part -> - { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } - } - }, - { log_text.each { log_part -> - { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } - } - }, - { - assert snapshot( - ( - [process.out.reads[0][0].toString()] + // meta - process.out.reads.collect { it[1].collect { item -> file(item).getName() } } + - process.out.json.collect { file(it[1]).getName() } + - process.out.html.collect { file(it[1]).getName() } + - process.out.log.collect { file(it[1]).getName() } + - process.out.reads_fail.collect { file(it[1]).getName() } + - process.out.reads_merged.collect { file(it[1]).getName() } - ).sort() - ).match("test_fastp_paired_end_match") - }, - { assert snapshot(process.out.versions).match("versions_paired_end") } + { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") }, + { assert path(process.out.log.get(0).get(1)).getText().contains("total reads: 75") }, + { assert snapshot( + process.out.json, + process.out.reads, + process.out.reads_fail, + process.out.reads_merged, + process.out.versions).match() }, ) } } - test("test_fastp_paired_end-stub") { - - options '-stub' + test("test_fastp_paired_end_merged_adapterlist") { when { - params { - outdir = "$outputDir" + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + input[1] = Channel.of([ file(params.modules_testdata_base_path + 'delete_me/fastp/adapters.fasta', checkIfExists: true) ]) + input[2] = false + input[3] = false + input[4] = true + """ } + } + + then { + assertAll( + { assert process.success }, + { assert path(process.out.html.get(0).get(1)).getText().contains("
") }, + { assert path(process.out.log.get(0).get(1)).getText().contains("total bases: 13683") }, + { assert snapshot( + process.out.json, + process.out.reads, + process.out.reads_fail, + process.out.reads_merged, + process.out.versions).match() } + ) + } + } + + test("test_fastp_single_end_qc_only") { + + when { process { """ - adapter_fasta = [] - save_trimmed_fail = false - save_merged = false + input[0] = Channel.of([ + [ id:'test', single_end:true ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + ]) + input[1] = [] + input[2] = true + input[3] = false + input[4] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert path(process.out.html.get(0).get(1)).getText().contains("single end (151 cycles)") }, + { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 99") }, + { assert snapshot( + process.out.json, + process.out.reads, + process.out.reads, + process.out.reads_fail, + process.out.reads_fail, + process.out.reads_merged, + process.out.reads_merged, + process.out.versions).match() } + ) + } + } + test("test_fastp_paired_end_qc_only") { + + when { + process { + """ input[0] = Channel.of([ [ id:'test', single_end:false ], // meta map [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] ]) - input[1] = adapter_fasta - input[2] = save_trimmed_fail - input[3] = save_merged + input[1] = [] + input[2] = true + input[3] = false + input[4] = false """ } } @@ -232,114 +301,99 @@ nextflow_process { then { assertAll( { assert process.success }, - { - assert snapshot( - ( - [process.out.reads[0][0].toString()] + // meta - process.out.reads.collect { it[1].collect { item -> file(item).getName() } } + - process.out.json.collect { file(it[1]).getName() } + - process.out.html.collect { file(it[1]).getName() } + - process.out.log.collect { file(it[1]).getName() } + - process.out.reads_fail.collect { file(it[1]).getName() } + - process.out.reads_merged.collect { file(it[1]).getName() } - ).sort() - ).match("test_fastp_paired_end-for_stub_match") - }, - { assert snapshot(process.out.versions).match("versions_paired_end-stub") } + { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") }, + { assert path(process.out.log.get(0).get(1)).getText().contains("Q30 bases: 12281(88.3716%)") }, + { assert snapshot( + process.out.json, + process.out.reads, + process.out.reads, + process.out.reads_fail, + process.out.reads_fail, + process.out.reads_merged, + process.out.reads_merged, + process.out.versions).match() } ) } } - test("fastp test_fastp_interleaved") { + test("test_fastp_single_end - stub") { + + options "-stub" - config './nextflow.interleaved.config' when { - params { - outdir = "$outputDir" + + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + ]) + input[1] = [] + input[2] = false + input[3] = false + input[4] = false + """ } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_fastp_paired_end - stub") { + + options "-stub" + + when { + process { """ adapter_fasta = [] + save_trimmed_pass = true save_trimmed_fail = false save_merged = false input[0] = Channel.of([ - [ id:'test', single_end:true ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ] + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] ]) - input[1] = adapter_fasta - input[2] = save_trimmed_fail - input[3] = save_merged + input[1] = [] + input[2] = false + input[3] = false + input[4] = false """ } } then { - def html_text = [ "Q20 bases:25.719000 K (93.033098%)", - "paired end (151 cycles + 151 cycles)"] - def log_text = [ "Q20 bases: 12922(92.9841%)", - "reads passed filter: 162"] - def read_lines = [ "@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", - "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", - "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE - { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) } - } - }, - { html_text.each { html_part -> - { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } - } - }, - { assert snapshot(process.out.json).match("fastp test_fastp_interleaved_json") }, - { log_text.each { log_part -> - { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } - } - }, - { - assert snapshot( - ( - [process.out.reads[0][0].toString()] + // meta - process.out.reads.collect { file(it[1]).getName() } + - process.out.json.collect { file(it[1]).getName() } + - process.out.html.collect { file(it[1]).getName() } + - process.out.log.collect { file(it[1]).getName() } + - process.out.reads_fail.collect { file(it[1]).getName() } + - process.out.reads_merged.collect { file(it[1]).getName() } - ).sort() - ).match("test_fastp_interleaved-_match") - }, - { assert snapshot(process.out.versions).match("versions_interleaved") } + { assert snapshot(process.out).match() } ) } } - test("fastp test_fastp_interleaved-stub") { + test("fastp - stub test_fastp_interleaved") { - options '-stub' + options "-stub" config './nextflow.interleaved.config' when { - params { - outdir = "$outputDir" - } process { """ - adapter_fasta = [] - save_trimmed_fail = false - save_merged = false - input[0] = Channel.of([ [ id:'test', single_end:true ], // meta map [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ] ]) - input[1] = adapter_fasta - input[2] = save_trimmed_fail - input[3] = save_merged + input[1] = [] + input[2] = false + input[3] = false + input[4] = false """ } } @@ -347,277 +401,112 @@ nextflow_process { then { assertAll( { assert process.success }, - { - assert snapshot( - ( - [process.out.reads[0][0].toString()] + // meta - process.out.reads.collect { file(it[1]).getName() } + - process.out.json.collect { file(it[1]).getName() } + - process.out.html.collect { file(it[1]).getName() } + - process.out.log.collect { file(it[1]).getName() } + - process.out.reads_fail.collect { file(it[1]).getName() } + - process.out.reads_merged.collect { file(it[1]).getName() } - ).sort() - ).match("test_fastp_interleaved-for_stub_match") - }, - { assert snapshot(process.out.versions).match("versions_interleaved-stub") } + { assert snapshot(process.out).match() } ) } } - test("test_fastp_single_end_trim_fail") { + test("test_fastp_single_end_trim_fail - stub") { + + options "-stub" when { - params { - outdir = "$outputDir" - } + process { """ - adapter_fasta = [] - save_trimmed_fail = true - save_merged = false - input[0] = Channel.of([ [ id:'test', single_end:true ], // meta map [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] ]) - input[1] = adapter_fasta - input[2] = save_trimmed_fail - input[3] = save_merged + input[1] = [] + input[2] = false + input[3] = true + input[4] = false """ } } then { - def html_text = [ "Q20 bases:12.922000 K (92.984097%)", - "single end (151 cycles)"] - def log_text = [ "Q20 bases: 12922(92.9841%)", - "reads passed filter: 99" ] - def read_lines = [ "@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", - "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", - "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE - { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) } - } - }, - { failed_read_lines.each { failed_read_line -> - { assert path(process.out.reads_fail.get(0).get(1)).linesGzip.contains(failed_read_line) } - } - }, - { html_text.each { html_part -> - { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } - } - }, - { assert snapshot(process.out.json).match("test_fastp_single_end_trim_fail_json") }, - { log_text.each { log_part -> - { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } - } - }, - { assert snapshot(process.out.versions).match("versions_single_end_trim_fail") } + { assert snapshot(process.out).match() } ) } } - test("test_fastp_paired_end_trim_fail") { + test("test_fastp_paired_end_trim_fail - stub") { + + options "-stub" config './nextflow.save_failed.config' when { - params { - outdir = "$outputDir" - } process { """ - adapter_fasta = [] - save_trimmed_fail = true - save_merged = false - input[0] = Channel.of([ [ id:'test', single_end:false ], // meta map [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] ]) - input[1] = adapter_fasta - input[2] = save_trimmed_fail - input[3] = save_merged + input[1] = [] + input[2] = false + input[3] = true + input[4] = false """ } } then { - def html_text = [ "Q20 bases:25.719000 K (93.033098%)", - "The input has little adapter percentage (~0.000000%), probably it's trimmed before."] - def log_text = [ "No adapter detected for read1", - "Q30 bases: 12281(88.3716%)"] - def json_text = ['"passed_filter_reads": 162'] - def read1_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", - "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", - "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE - { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } - } - }, - { read2_lines.each { read2_line -> - { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } - } - }, - { failed_read2_lines.each { failed_read2_line -> - { assert path(process.out.reads_fail.get(0).get(1).get(2)).linesGzip.contains(failed_read2_line) } - } - }, - { html_text.each { html_part -> - { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } - } - }, - { json_text.each { json_part -> - { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } - } - }, - { log_text.each { log_part -> - { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } - } - }, - { assert snapshot(process.out.versions).match("versions_paired_end_trim_fail") } + { assert snapshot(process.out).match() } ) } } - test("test_fastp_paired_end_merged") { + test("test_fastp_paired_end_merged - stub") { + + options "-stub" when { - params { - outdir = "$outputDir" - } process { """ - adapter_fasta = [] - save_trimmed_fail = false - save_merged = true input[0] = Channel.of([ [ id:'test', single_end:false ], // meta map [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] ]) - input[1] = adapter_fasta - input[2] = save_trimmed_fail - input[3] = save_merged + input[1] = [] + input[2] = false + input[3] = false + input[4] = true """ } } then { - def html_text = [ "
"] - def log_text = [ "Merged and filtered:", - "total reads: 75", - "total bases: 13683"] - def json_text = ['"merged_and_filtered": {', '"total_reads": 75', '"total_bases": 13683'] - def read1_lines = [ "@ERR5069949.1066259 NS500628:121:HK3MMAFX2:1:11312:18369:8333/1", - "CCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTC", - "AAAAAEAEEAEEEEEEEEEEEEEEEEAEEEEAEEEEEEEEAEEEEEEEEEEEEEEEEE/EAEEEEEE/6EEEEEEEEEEAEEAEEE/EE/AEEAEEEEEAEEEA/EEAAEAE - { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } - } - }, - { read2_lines.each { read2_line -> - { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } - } - }, - { read_merged_lines.each { read_merged_line -> - { assert path(process.out.reads_merged.get(0).get(1)).linesGzip.contains(read_merged_line) } - } - }, - { html_text.each { html_part -> - { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } - } - }, - { json_text.each { json_part -> - { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } - } - }, - { log_text.each { log_part -> - { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } - } - }, - { - assert snapshot( - ( - [process.out.reads[0][0].toString()] + // meta - process.out.reads.collect { it[1].collect { item -> file(item).getName() } } + - process.out.json.collect { file(it[1]).getName() } + - process.out.html.collect { file(it[1]).getName() } + - process.out.log.collect { file(it[1]).getName() } + - process.out.reads_fail.collect { file(it[1]).getName() } + - process.out.reads_merged.collect { file(it[1]).getName() } - ).sort() - ).match("test_fastp_paired_end_merged_match") - }, - { assert snapshot(process.out.versions).match("versions_paired_end_merged") } + { assert snapshot(process.out).match() } ) } } - test("test_fastp_paired_end_merged-stub") { + test("test_fastp_paired_end_merged_adapterlist - stub") { - options '-stub' + options "-stub" when { - params { - outdir = "$outputDir" - } process { """ - adapter_fasta = [] - save_trimmed_fail = false - save_merged = true - input[0] = Channel.of([ [ id:'test', single_end:false ], // meta map [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] ]) - input[1] = adapter_fasta - input[2] = save_trimmed_fail - input[3] = save_merged + input[1] = Channel.of([ file(params.modules_testdata_base_path + 'delete_me/fastp/adapters.fasta', checkIfExists: true) ]) + input[2] = false + input[3] = false + input[4] = true """ } } @@ -625,101 +514,63 @@ nextflow_process { then { assertAll( { assert process.success }, - { - assert snapshot( - ( - [process.out.reads[0][0].toString()] + // meta - process.out.reads.collect { it[1].collect { item -> file(item).getName() } } + - process.out.json.collect { file(it[1]).getName() } + - process.out.html.collect { file(it[1]).getName() } + - process.out.log.collect { file(it[1]).getName() } + - process.out.reads_fail.collect { file(it[1]).getName() } + - process.out.reads_merged.collect { file(it[1]).getName() } - ).sort() - ).match("test_fastp_paired_end_merged-for_stub_match") - }, - { assert snapshot(process.out.versions).match("versions_paired_end_merged_stub") } + { assert snapshot(process.out).match() } ) } } - test("test_fastp_paired_end_merged_adapterlist") { + test("test_fastp_single_end_qc_only - stub") { + + options "-stub" when { - params { - outdir = "$outputDir" - } process { """ - adapter_fasta = Channel.of([ file(params.modules_testdata_base_path + 'delete_me/fastp/adapters.fasta', checkIfExists: true) ]) - save_trimmed_fail = false - save_merged = true + input[0] = Channel.of([ + [ id:'test', single_end:true ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + ]) + input[1] = [] + input[2] = true + input[3] = false + input[4] = false + """ + } + } + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_fastp_paired_end_qc_only - stub") { + + options "-stub" + + when { + process { + """ input[0] = Channel.of([ [ id:'test', single_end:false ], // meta map [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] ]) - input[1] = adapter_fasta - input[2] = save_trimmed_fail - input[3] = save_merged + input[1] = [] + input[2] = true + input[3] = false + input[4] = false """ } } then { - def html_text = [ "
"] - def log_text = [ "Merged and filtered:", - "total reads: 75", - "total bases: 13683"] - def json_text = ['"merged_and_filtered": {', '"total_reads": 75', '"total_bases": 13683',"--adapter_fasta"] - def read1_lines = ["@ERR5069949.1066259 NS500628:121:HK3MMAFX2:1:11312:18369:8333/1", - "CCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTC", - "AAAAAEAEEAEEEEEEEEEEEEEEEEAEEEEAEEEEEEEEAEEEEEEEEEEEEEEEEE/EAEEEEEE/6EEEEEEEEEEAEEAEEE/EE/AEEAEEEEEAEEEA/EEAAEAE - { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } - } - }, - { read2_lines.each { read2_line -> - { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } - } - }, - { read_merged_lines.each { read_merged_line -> - { assert path(process.out.reads_merged.get(0).get(1)).linesGzip.contains(read_merged_line) } - } - }, - { html_text.each { html_part -> - { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } - } - }, - { json_text.each { json_part -> - { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } - } - }, - { log_text.each { log_part -> - { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } - } - }, - { assert snapshot(process.out.versions).match("versions_paired_end_merged_adapterlist") } + { assert snapshot(process.out).match() } ) } } -} +} \ No newline at end of file diff --git a/modules/nf-core/fastp/tests/main.nf.test.snap b/modules/nf-core/fastp/tests/main.nf.test.snap index 3e876288..54be7e45 100644 --- a/modules/nf-core/fastp/tests/main.nf.test.snap +++ b/modules/nf-core/fastp/tests/main.nf.test.snap @@ -1,55 +1,178 @@ { - "fastp test_fastp_interleaved_json": { + "test_fastp_single_end_qc_only - stub": { "content": [ - [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.json:md5,b24e0624df5cc0b11cd5ba21b726fb22" + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + + ], + "5": [ + + ], + "6": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ], + "html": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "json": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + + ], + "reads_fail": [ + + ], + "reads_merged": [ + + ], + "versions": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" ] - ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-03-18T16:19:15.063001" + "timestamp": "2024-07-05T14:31:10.841098" }, - "test_fastp_paired_end_merged-for_stub_match": { + "test_fastp_paired_end": { "content": [ [ [ - "test_1.fastp.fastq.gz", - "test_2.fastp.fastq.gz" - ], - "test.fastp.html", - "test.fastp.json", - "test.fastp.log", - "test.merged.fastq.gz", - "{id=test, single_end=false}" + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7", + "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39" + ] + ] + ], + [ + + ], + [ + + ], + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-01-17T18:10:13.467574" + "timestamp": "2024-07-05T13:43:28.665779" }, - "versions_interleaved": { + "test_fastp_paired_end_merged_adapterlist": { "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,5914ca3f21ce162123a824e33e8564f6" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672", + "test_2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba" + ] + ] + ], + [ + + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5" + ] + ], [ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-01T11:56:24.615634793" + "timestamp": "2024-07-05T13:44:18.210375" }, - "test_fastp_single_end_json": { + "test_fastp_single_end_qc_only": { "content": [ [ [ @@ -57,274 +180,1152 @@ "id": "test", "single_end": true }, - "test.fastp.json:md5,c852d7a6dba5819e4ac8d9673bedcacc" + "test.fastp.json:md5,5cc5f01e449309e0e689ed6f51a2294a" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-03-18T16:18:43.526412" - }, - "versions_paired_end": { - "content": [ + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], [ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-01T11:55:42.333545689" + "timestamp": "2024-07-05T13:44:27.380974" }, - "test_fastp_paired_end_match": { + "test_fastp_paired_end_trim_fail": { "content": [ [ [ - "test_1.fastp.fastq.gz", - "test_2.fastp.fastq.gz" - ], - "test.fastp.html", - "test.fastp.json", - "test.fastp.log", - "{id=test, single_end=false}" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-02-01T12:03:06.431833729" - }, - "test_fastp_interleaved-_match": { - "content": [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,6ff32a64c5188b9a9192be1398c262c7", + "test_2.fastp.fastq.gz:md5,db0cb7c9977e94ac2b4b446ebd017a8a" + ] + ] + ], [ - "test.fastp.fastq.gz", - "test.fastp.html", - "test.fastp.json", - "test.fastp.log", - "{id=test, single_end=true}" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-03-18T16:19:15.111894" - }, - "test_fastp_paired_end_merged_match": { - "content": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.paired.fail.fastq.gz:md5,409b687c734cedd7a1fec14d316e1366", + "test_1.fail.fastq.gz:md5,4f273cf3159c13f79e8ffae12f5661f6", + "test_2.fail.fastq.gz:md5,f97b9edefb5649aab661fbc9e71fc995" + ] + ] + ], + [ + + ], [ [ - "test_1.fastp.fastq.gz", - "test_2.fastp.fastq.gz" - ], - "test.fastp.html", - "test.fastp.json", - "test.fastp.log", - "test.merged.fastq.gz", - "{id=test, single_end=false}" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-02-01T12:08:44.496251446" - }, - "versions_single_end_stub": { - "content": [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,4c3268ddb50ea5b33125984776aa3519" + ] + ], [ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-01T11:55:27.354051299" + "timestamp": "2024-07-05T13:43:58.749589" }, - "versions_interleaved-stub": { + "fastp - stub test_fastp_interleaved": { "content": [ - [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" - ] + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + + ], + "5": [ + + ], + "6": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ], + "html": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "json": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "reads_fail": [ + + ], + "reads_merged": [ + + ], + "versions": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-01T11:56:46.535528418" + "timestamp": "2024-07-05T13:50:00.270029" }, - "versions_single_end_trim_fail": { + "test_fastp_single_end - stub": { "content": [ - [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" - ] + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + + ], + "5": [ + + ], + "6": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ], + "html": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "json": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "reads_fail": [ + + ], + "reads_merged": [ + + ], + "versions": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-01T11:59:03.724591407" + "timestamp": "2024-07-05T13:49:42.502789" }, - "test_fastp_paired_end-for_stub_match": { + "test_fastp_paired_end_merged_adapterlist - stub": { "content": [ - [ - [ - "test_1.fastp.fastq.gz", - "test_2.fastp.fastq.gz" + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] ], - "test.fastp.html", - "test.fastp.json", - "test.fastp.log", - "{id=test, single_end=false}" - ] + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "6": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "json": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "reads_fail": [ + + ], + "reads_merged": [ + [ + { + "id": "test", + "single_end": false + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "versions": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-01-17T18:07:15.398827" + "timestamp": "2024-07-05T13:54:53.458252" }, - "versions_paired_end-stub": { + "test_fastp_paired_end_merged - stub": { "content": [ - [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" - ] + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "6": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "json": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "reads_fail": [ + + ], + "reads_merged": [ + [ + { + "id": "test", + "single_end": false + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "versions": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-01T11:56:06.50017282" + "timestamp": "2024-07-05T13:50:27.689379" }, - "versions_single_end": { + "test_fastp_paired_end_merged": { "content": [ [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-02-01T11:55:07.67921647" - }, - "versions_paired_end_merged_stub": { - "content": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,b712fd68ed0322f4bec49ff2a5237fcc" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672", + "test_2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba" + ] + ] + ], + [ + + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5" + ] + ], [ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-01T11:59:47.350653154" + "timestamp": "2024-07-05T13:44:08.68476" }, - "test_fastp_interleaved-for_stub_match": { + "test_fastp_paired_end - stub": { "content": [ - [ - "test.fastp.fastq.gz", - "test.fastp.html", - "test.fastp.json", - "test.fastp.log", - "{id=test, single_end=true}" - ] + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + + ], + "5": [ + + ], + "6": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "json": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "reads_fail": [ + + ], + "reads_merged": [ + + ], + "versions": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-01-17T18:08:06.127974" + "timestamp": "2024-07-05T13:49:51.679221" }, - "versions_paired_end_trim_fail": { + "test_fastp_single_end": { "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,c852d7a6dba5819e4ac8d9673bedcacc" + ] + ], + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7" + ] + ], + [ + + ], + [ + + ], [ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-01T11:59:18.140484878" + "timestamp": "2024-07-05T13:43:18.834322" }, - "test_fastp_single_end-for_stub_match": { + "test_fastp_single_end_trim_fail - stub": { "content": [ - [ - "test.fastp.fastq.gz", - "test.fastp.html", - "test.fastp.json", - "test.fastp.log", - "{id=test, single_end=true}" - ] + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "5": [ + + ], + "6": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ], + "html": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "json": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "reads_fail": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "reads_merged": [ + + ], + "versions": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-01-17T18:06:00.244202" + "timestamp": "2024-07-05T14:05:36.898142" }, - "test_fastp_single_end-_match": { + "test_fastp_paired_end_trim_fail - stub": { "content": [ - [ - "test.fastp.fastq.gz", - "test.fastp.html", - "test.fastp.json", - "test.fastp.log", - "{id=test, single_end=true}" - ] + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.paired.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_1.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "5": [ + + ], + "6": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "json": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "reads_fail": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.paired.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_1.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "reads_merged": [ + + ], + "versions": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-03-18T16:18:43.580336" + "timestamp": "2024-07-05T14:05:49.212847" }, - "versions_paired_end_merged_adapterlist": { + "fastp test_fastp_interleaved": { "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.fastq.gz:md5,217d62dc13a23e92513a1bd8e1bcea39" + ] + ], + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,b24e0624df5cc0b11cd5ba21b726fb22" + ] + ], [ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-01T12:05:37.845370554" + "timestamp": "2024-07-05T13:43:38.910832" }, - "versions_paired_end_merged": { + "test_fastp_single_end_trim_fail": { "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,9a7ee180f000e8d00c7fb67f06293eb5" + ] + ], + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7" + ] + ], + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fail.fastq.gz:md5,3e4aaadb66a5b8fc9b881bf39c227abd" + ] + ], + [ + + ], [ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-01T11:59:32.860543858" + "timestamp": "2024-07-05T13:43:48.22378" }, - "test_fastp_single_end_trim_fail_json": { + "test_fastp_paired_end_qc_only": { "content": [ [ [ { "id": "test", - "single_end": true + "single_end": false }, - "test.fastp.json:md5,9a7ee180f000e8d00c7fb67f06293eb5" + "test.fastp.json:md5,623064a45912dac6f2b64e3f2e9901df" ] + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-05T13:44:36.334938" + }, + "test_fastp_paired_end_qc_only - stub": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + + ], + "5": [ + + ], + "6": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "json": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + + ], + "reads_fail": [ + + ], + "reads_merged": [ + + ], + "versions": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" }, - "timestamp": "2024-01-17T18:08:41.942317" + "timestamp": "2024-07-05T14:31:27.096468" } } \ No newline at end of file diff --git a/subworkflows/local/fastq_trim_fastp_fastqc.nf b/subworkflows/local/fastq_trim_fastp_fastqc.nf index 101741c8..cdfcc871 100644 --- a/subworkflows/local/fastq_trim_fastp_fastqc.nf +++ b/subworkflows/local/fastq_trim_fastp_fastqc.nf @@ -18,10 +18,11 @@ def getFastpReadsAfterFiltering(json_file) { workflow FASTQ_TRIM_FASTP_FASTQC { take: - reads // channel: [ val(meta), [ reads ] ] - adapter_fasta // file: adapter.fasta - save_trimmed_fail // value: boolean - save_merged // value: boolean + reads // channel: [ val(meta), [ reads ] ] + adapter_fasta // file: adapter.fasta + discard_trimmed_pass // value: boolean + save_trimmed_fail // value: boolean + save_merged // value: boolean main: @@ -50,6 +51,7 @@ workflow FASTQ_TRIM_FASTP_FASTQC { FASTP ( reads, adapter_fasta, + discard_trimmed_pass, save_trimmed_fail, save_merged ) diff --git a/workflows/illumina.nf b/workflows/illumina.nf index af8fb509..ba39a722 100644 --- a/workflows/illumina.nf +++ b/workflows/illumina.nf @@ -205,6 +205,7 @@ workflow ILLUMINA { FASTQ_TRIM_FASTP_FASTQC ( ch_cat_fastq, [], + false, params.save_trimmed_fail, false ) From cfa70749df822e1ed1ab6b735a7fdfb009a000f7 Mon Sep 17 00:00:00 2001 From: Joon-Klaps Date: Tue, 30 Jul 2024 10:03:46 +0000 Subject: [PATCH 4/4] update changelog to include PR --- CHANGELOG.md | 3 ++- 1 file changed, 2 insertions(+), 1 deletion(-) diff --git a/CHANGELOG.md b/CHANGELOG.md index 6769e1eb..074469ad 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -17,7 +17,7 @@ Thank you to everyone else that has contributed by reporting bugs, enhancements ### Enhancements & fixes -- [[#299](https://github.com/nf-core/viralrecon/issues/299)] - Add the freyja pipeline as a subworkflow +- [[PR #375](https://github.com/nf-core/viralrecon/pull/375)] - Add the freyja pipeline as a subworkflow - [[PR #387](https://github.com/nf-core/viralrecon/pull/387)] - Software closes gracefully when encountering an error - [[PR #395](https://github.com/nf-core/viralrecon/pull/395)] - Remove minia from default assemblers because it is unreliable - [[PR #393](https://github.com/nf-core/viralrecon/pull/393)] - Changed primer set to params @@ -27,6 +27,7 @@ Thank you to everyone else that has contributed by reporting bugs, enhancements - [[PR #417](https://github.com/nf-core/viralrecon/pull/417)] - Allow skipping of Freyja bootstrapping module & freyja module update - [[PR #434](https://github.com/nf-core/viralrecon/pull/434)] - Add blast result filtering through `min_contig_length` and `min_perc_contig_aligned`. - [[PR #435](https://github.com/nf-core/viralrecon/pull/435)] - Changed cutadapt to use nf-core modules, added `skip_noninternal_primers` param to allow users to process primers inside the pipeline. +- [[PR #438](https://github.com/nf-core/viralrecon/pull/438)] - Update fastp container to 0.23.4 ### Parameters