Unhandled BWA error

[lorenapr92]

I'm having the following issue. I do not understand what the problem could be. I do have the indexes. Is there a problem with the fastq file?

CRITICAL [2019-10-01 20:36:21,200]: Unhandled BWA error while processing Tillamook-V2_S1_L001_R1R2_genome.fastq. Check /tmp/decont.py.bwa.li5rtkqj

[andreas-wilm]

Hi, could you share that log file?

[lorenapr92]

I don't have permission to check the log file.

[andreas-wilm]

You cannot access /tmp/decont.py.bwa.li5rtkqj? That's strange. Did you run the program?

By the way, what where the exact arguments you used?

[lorenapr92]

I'm running it on a cluster, would that be the reason why it won't let me open it?

python3 decont.py -i Tillamook-V2_S1_L001_R1R2_genome.fastq -o TillamookV2vsAll -r monkey_mycoplasma_contaminant.fasta -c 0.0

I tried to use -c 0.9 first but got the same error so I went with -c 0.0

[andreas-wilm]

You can get the log file from the machine where the code was executed.

Without that it's hard to guess what's going on.

[lorenapr92]

Gotcha, I can't seem to find the tmp folder with the other files, but I think I know the issue. When you create your bwa files, do you get 5 or 8? bwa index fails right at creating the .sa file.

[andreas-wilm]

It should be five (bwt, pac, ann, amb, sa). Sounds like your reference is not properly formatted. Could you send the output of head monkey_mycoplasma_contaminant.fasta?

By the way, decont was reimplemented in Nim and is now much faster. The new version can be found here: https://bitbucket.org/andreas-wilm/decontanimate/src/master/. A binary is currently hosted here: https://drive.google.com/file/d/1yPZeFDvDwTQ2DM6Awt1k-ZVOwR69eVc6/view in case you want to try. I'll move this to Github soon and create proper releases

[lorenapr92]

I deleted the monkey_mycoplasma_contaminant.fasta but it was a copy of the file named deconseq_contaminant.fasta, which is a combination of monkey 'chlorocebus' and 'mycoplasma' sequences I made using 'cat' command. Bwa made the 5 files using index on the clorocebus.fasta file without issues, but for some reason it won't work when I cat both files.

[spere004@coreV4-21-030 Rickettsia]$ less -s deconseq_contaminant.fasta | head -10

NC_023642.1 Chlorocebus sabaeus isolate 1994-021 chromosome 1, Chlorocebus_sabeus 1.1, whole genome shotgun sequence
GTGAAAGAAGccaaaaaggctacatactgtatgattccaattacgtgacattttggaaaagggaaaATTACAAAGATAGT
AAAACAATCAATAGTTGACAGGGGTTGGGGAGAttggggagaggaaaggatggATGGGCAGAGAGCCCCGGCTGTTTAGG
GCAGTGAGACCACTGTGGGTGATTTCACCACAACGGTGGACCCACGACAGCGTGCAGATGCCCACACCCATTGAATTAAG
ACCACAAAAAGGTATTAATTACATCAACTATGAACTTtcataatgaaataaatcatGTTTTTTAAAGTGGACAGTTTTGT
TCAGTTACCGTCTACTTTCTGAAATGGAGACGGTGGAGTGCTTCCATGGTTGTGAGGATAAAAATAGCTTAGAGAATGTA
ATAACNNNNNNNNNNTTGTGAGGATAAAAATAGCTTAGAGAATGTAATAACTAAAATAGGTGCGTAAACATTGTTAAAct
attttattctcattaaaaAGCATTgcttaagtatatttatatttaaaaattgagaaaggaGTGCAAATGCATTAACATAA
TTCTCCTCTAGCTCCACTCAGAAGTCAGGACTGCACGGCTCCACTTGCACCTGCGAAACACAACAACCTTTTTCAGCGTC
ATTGAAATATTTCAGTGGGAGGATTGACTTTAGACTCAACCTGTGTTTTCTCCCCTGGAAAACAAAGGTTTTATGAAACA
[spere004@coreV4-21-030 Rickettsia]$ less -s mycoplasma.fasta | head -10
NZ_AP014657.1 Mycoplasma arginini DNA, complete genome, strain: HAZ145_1
GCAGAAGATTTAGCATCTAAATTAACAGATGATAAATATAAGGCTGTTAAAGATAAATTAGACAAAGCTA
TTGTTGATGTAACAAAAAATATCAACGAAAATAGTTCAAAAGAAGATTACGAACTAGCAACTGAAAAATT
AAATAAAGCAATTGATCAAGCAAAAAAACAAGAAAAAGATATAAGTTTATCTGAATTTGACGAATTAGCT
TTAAGAGCAAATGAATTGGATAATTCCATTGCCGATACAAAATACTATTCATATTTTAAAGATCAAGTTA
AAAAATTAATTAATGATAATTTTCAACCACAAAATAAAAAATCATTTTCTTCACTAACACCAAAAGAAAG
AAAACAAAAAATCGATTTCTTGAGAAGTGAAGTAAATGAACAAGAAGCAACTTTAGAAAATTATTTACTT
TTGATTAGTAGATATTTAGACTTAAAGAAAGAAGCAGAAGCTTTTCTCCAAGAATTAAGTAAAAATGTAA
TTTACAGAGATATTCAAAATGAATTACAAGAACAAATTTTTAATAGTGAAGATAATATTAAAAAAAGTAA
TTACGTTGGTTATTATGGACAAGATCTAATTTTAGAAGAAGCATTAAAATTATCTAAACAAAATAAGAAA
[spere004@coreV4-21-030 Rickettsia]$

[andreas-wilm]

If both files work with BWA separately but not the concatenated version then there might a newline missing between the two entries. You could try tools like seqtk or seqkit for reformatting.

[lorenapr92]

It worked but would this work with interleaved files? I keep getting only 1s instead of 1s and 2s.

[andreas-wilm]

Yeah sorry. This doesn't support interleaved files (even though BWA MEM does) I've created an issue here: https://bitbucket.org/andreas-wilm/decontanimate/issues/1/support-interleaved-files Andreas

…

On Sat, 5 Oct 2019 at 01:08, lorenapr92 ***@***.***> wrote: It worked but would this work with interleaved files? I keep getting only 1s instead of 1s and 2s. — You are receiving this because you commented. Reply to this email directly, view it on GitHub <#4?email_source=notifications&email_token=AAILSCOCLVKL4PFY7BFX2BDQM5Z7JA5CNFSM4I4QOX62YY3PNVWWK3TUL52HS4DFVREXG43VMVBW63LNMVXHJKTDN5WW2ZLOORPWSZGOEAMJM7A#issuecomment-538482300>, or mute the thread <https://github.com/notifications/unsubscribe-auth/AAILSCMEBHMYF7TULE35NSDQM5Z7JANCNFSM4I4QOX6Q> .

-- Andreas Wilm [email protected] | [email protected] | 0x7C68FBCC