From 73deda8f7ea024cee5000b60601cd81eee456ba2 Mon Sep 17 00:00:00 2001
From: Garrett Stevens <stevens.garrett.j@gmail.com>
Date: Tue, 28 Mar 2023 16:30:09 -0600
Subject: [PATCH 01/17] More consistently use encoding instead to toString

---
 test/format.test.ts | 29 +++++++++++++++++------------
 test/parse.test.ts  |  7 ++++---
 2 files changed, 21 insertions(+), 15 deletions(-)

diff --git a/test/format.test.ts b/test/format.test.ts
index a510cfc..ed71169 100644
--- a/test/format.test.ts
+++ b/test/format.test.ts
@@ -13,13 +13,16 @@ describe('GFF3 formatting', () => {
   ;['spec_eden', 'au9_scaffold_subset', 'hybrid1', 'hybrid2'].forEach(
     (file) => {
       it(`can roundtrip ${file}.gff3 with formatSync`, () => {
-        const inputGFF3 = fs
-          .readFileSync(require.resolve(`./data/${file}.gff3`))
-          .toString('utf8')
+        const inputGFF3 = fs.readFileSync(
+          require.resolve(`./data/${file}.gff3`),
+          'utf8',
+        )
 
         const expectedGFF3 = fs
-          .readFileSync(require.resolve(`./data/${file}.reformatted.gff3`))
-          .toString('utf8')
+          .readFileSync(
+            require.resolve(`./data/${file}.reformatted.gff3`),
+            'utf8',
+          )
           .replace(/###\n/g, '') // formatSync does not insert sync marks
 
         const items = gff.parseStringSync(inputGFF3, { parseAll: true })
@@ -28,9 +31,10 @@ describe('GFF3 formatting', () => {
       })
 
       it(`can roundtrip ${file}.gff3 with formatStream`, async () => {
-        const expectedGFF3 = (
-          await readfile(require.resolve(`./data/${file}.reformatted.gff3`))
-        ).toString('utf8')
+        const expectedGFF3 = await readfile(
+          require.resolve(`./data/${file}.reformatted.gff3`),
+          'utf8',
+        )
 
         const resultGFF3 = await getStream(
           fs
@@ -63,11 +67,12 @@ describe('GFF3 formatting', () => {
         await gff.formatFile(gff3In, fs.createWriteStream(tmpFile.path))
         await fdatasync(tmpFile.fd)
 
-        const resultGFF3 = (await readfile(tmpFile.path)).toString('utf8')
+        const resultGFF3 = await readfile(tmpFile.path, 'utf8')
 
-        const expectedGFF3 = (
-          await readfile(require.resolve(`./data/${file}.reformatted.gff3`))
-        ).toString('utf8')
+        const expectedGFF3 = await readfile(
+          require.resolve(`./data/${file}.reformatted.gff3`),
+          'utf8',
+        )
 
         expect(resultGFF3).toEqual(expectedGFF3)
       })
diff --git a/test/parse.test.ts b/test/parse.test.ts
index 00e57af..35997e2 100644
--- a/test/parse.test.ts
+++ b/test/parse.test.ts
@@ -168,9 +168,10 @@ describe('GFF3 parser', () => {
   )
 
   it('can parse a string synchronously', () => {
-    const gff3 = fs
-      .readFileSync(require.resolve('./data/spec_eden.gff3'))
-      .toString('utf8')
+    const gff3 = fs.readFileSync(
+      require.resolve('./data/spec_eden.gff3'),
+      'utf8',
+    )
     const result = gff.parseStringSync(gff3, {
       parseFeatures: true,
       parseDirectives: true,

From 93b34788d61910b31cfa7fbd2ad13016bb7aa89b Mon Sep 17 00:00:00 2001
From: Garrett Stevens <stevens.garrett.j@gmail.com>
Date: Tue, 28 Mar 2023 16:42:01 -0600
Subject: [PATCH 02/17] Use more promises over sync in tests

---
 package.json        |  5 ++++-
 test/format.test.ts | 37 ++++++++++++++++++++-----------------
 test/parse.test.ts  | 22 ++++++++++++++--------
 yarn.lock           |  8 ++++----
 4 files changed, 42 insertions(+), 30 deletions(-)

diff --git a/package.json b/package.json
index 1dd38eb..d41b6fe 100644
--- a/package.json
+++ b/package.json
@@ -17,6 +17,9 @@
   "bin": {
     "gff-to-json": "dist/gff-to-json.js"
   },
+  "engines": {
+    "node": ">=10"
+  },
   "files": [
     "dist",
     "esm",
@@ -50,7 +53,7 @@
   },
   "devDependencies": {
     "@types/jest": "^29.2.4",
-    "@types/node": "^18.11.16",
+    "@types/node": "^10.17.60",
     "@typescript-eslint/eslint-plugin": "^5.46.1",
     "@typescript-eslint/parser": "^5.46.1",
     "documentation": "^14.0.1",
diff --git a/test/format.test.ts b/test/format.test.ts
index ed71169..07fb94b 100644
--- a/test/format.test.ts
+++ b/test/format.test.ts
@@ -1,4 +1,9 @@
-import fs from 'fs'
+import {
+  createReadStream,
+  createWriteStream,
+  fdatasync as fdatasyncC,
+  promises as fsPromises,
+} from 'fs'
 import tmp from 'tmp-promise'
 
 import { promisify } from 'util'
@@ -6,24 +11,23 @@ import getStream from 'get-stream'
 
 import gff from '../src'
 
-const readfile = promisify(fs.readFile)
-const fdatasync = promisify(fs.fdatasync)
+const fdatasync = promisify(fdatasyncC)
 
 describe('GFF3 formatting', () => {
   ;['spec_eden', 'au9_scaffold_subset', 'hybrid1', 'hybrid2'].forEach(
     (file) => {
-      it(`can roundtrip ${file}.gff3 with formatSync`, () => {
-        const inputGFF3 = fs.readFileSync(
+      it(`can roundtrip ${file}.gff3 with formatSync`, async () => {
+        const inputGFF3 = await fsPromises.readFile(
           require.resolve(`./data/${file}.gff3`),
           'utf8',
         )
 
-        const expectedGFF3 = fs
-          .readFileSync(
+        const expectedGFF3 = (
+          await fsPromises.readFile(
             require.resolve(`./data/${file}.reformatted.gff3`),
             'utf8',
           )
-          .replace(/###\n/g, '') // formatSync does not insert sync marks
+        ).replace(/###\n/g, '') // formatSync does not insert sync marks
 
         const items = gff.parseStringSync(inputGFF3, { parseAll: true })
         const resultGFF3 = gff.formatSync(items)
@@ -31,14 +35,13 @@ describe('GFF3 formatting', () => {
       })
 
       it(`can roundtrip ${file}.gff3 with formatStream`, async () => {
-        const expectedGFF3 = await readfile(
+        const expectedGFF3 = await fsPromises.readFile(
           require.resolve(`./data/${file}.reformatted.gff3`),
           'utf8',
         )
 
         const resultGFF3 = await getStream(
-          fs
-            .createReadStream(require.resolve(`./data/${file}.gff3`))
+          createReadStream(require.resolve(`./data/${file}.gff3`))
             .pipe(
               gff.parseStream({
                 parseFeatures: true,
@@ -60,16 +63,16 @@ describe('GFF3 formatting', () => {
     it(`can roundtrip ${file}.gff3 with formatFile`, async () => {
       jest.setTimeout(1000)
       await tmp.withFile(async (tmpFile) => {
-        const gff3In = fs
-          .createReadStream(require.resolve(`./data/${file}.gff3`))
-          .pipe(gff.parseStream({ parseAll: true }))
+        const gff3In = createReadStream(
+          require.resolve(`./data/${file}.gff3`),
+        ).pipe(gff.parseStream({ parseAll: true }))
 
-        await gff.formatFile(gff3In, fs.createWriteStream(tmpFile.path))
+        await gff.formatFile(gff3In, createWriteStream(tmpFile.path))
         await fdatasync(tmpFile.fd)
 
-        const resultGFF3 = await readfile(tmpFile.path, 'utf8')
+        const resultGFF3 = await fsPromises.readFile(tmpFile.path, 'utf8')
 
-        const expectedGFF3 = await readfile(
+        const expectedGFF3 = await fsPromises.readFile(
           require.resolve(`./data/${file}.reformatted.gff3`),
           'utf8',
         )
diff --git a/test/parse.test.ts b/test/parse.test.ts
index 35997e2..da89284 100644
--- a/test/parse.test.ts
+++ b/test/parse.test.ts
@@ -1,4 +1,4 @@
-import fs from 'fs'
+import { createReadStream, promises as fsPromises } from 'fs'
 import gff from '../src'
 import {
   formatFeature,
@@ -30,7 +30,7 @@ function readAll(
     }
 
     // $p->max_lookback(1)
-    fs.createReadStream(require.resolve(filename))
+    createReadStream(require.resolve(filename))
       .pipe(
         gff.parseStream({
           parseFeatures: true,
@@ -59,7 +59,7 @@ describe('GFF3 parser', () => {
   it('can parse gff3_with_syncs.gff3', async () => {
     const stuff = await readAll('./data/gff3_with_syncs.gff3')
     const referenceResult = JSON.parse(
-      fs.readFileSync(
+      await fsPromises.readFile(
         require.resolve('./data/gff3_with_syncs.result.json'),
         'utf8',
       ),
@@ -92,7 +92,7 @@ describe('GFF3 parser', () => {
     const stuff = await readAll('./data/knownGene_out_of_order.gff3')
     // $p->max_lookback(2);
     const expectedOutput = JSON.parse(
-      fs.readFileSync(
+      await fsPromises.readFile(
         require.resolve('./data/knownGene_out_of_order.result.json'),
         'utf8',
       ),
@@ -133,7 +133,10 @@ describe('GFF3 parser', () => {
     expect(mrnaLines[2].child_features).toHaveLength(6)
 
     const referenceResult = JSON.parse(
-      fs.readFileSync(require.resolve('./data/spec_eden.result.json'), 'utf8'),
+      await fsPromises.readFile(
+        require.resolve('./data/spec_eden.result.json'),
+        'utf8',
+      ),
     )
     expect(stuff.all).toEqual(referenceResult)
   })
@@ -167,8 +170,8 @@ describe('GFF3 parser', () => {
     },
   )
 
-  it('can parse a string synchronously', () => {
-    const gff3 = fs.readFileSync(
+  it('can parse a string synchronously', async () => {
+    const gff3 = await fsPromises.readFile(
       require.resolve('./data/spec_eden.gff3'),
       'utf8',
     )
@@ -179,7 +182,10 @@ describe('GFF3 parser', () => {
     })
     expect(result).toHaveLength(3)
     const referenceResult = JSON.parse(
-      fs.readFileSync(require.resolve('./data/spec_eden.result.json'), 'utf8'),
+      await fsPromises.readFile(
+        require.resolve('./data/spec_eden.result.json'),
+        'utf8',
+      ),
     )
     expect(result).toEqual(referenceResult)
   })
diff --git a/yarn.lock b/yarn.lock
index 55419fd..382b453 100644
--- a/yarn.lock
+++ b/yarn.lock
@@ -949,10 +949,10 @@
   resolved "https://registry.yarnpkg.com/@types/node/-/node-17.0.23.tgz#3b41a6e643589ac6442bdbd7a4a3ded62f33f7da"
   integrity sha512-UxDxWn7dl97rKVeVS61vErvw086aCYhDLyvRQZ5Rk65rZKepaFdm53GeqXaKBuOhED4e9uWq34IC3TdSdJJ2Gw==
 
-"@types/node@^18.11.16":
-  version "18.11.16"
-  resolved "https://registry.yarnpkg.com/@types/node/-/node-18.11.16.tgz#966cae211e970199559cfbd295888fca189e49af"
-  integrity sha512-6T7P5bDkRhqRxrQtwj7vru+bWTpelgtcETAZEUSdq0YISKz8WKdoBukQLYQQ6DFHvU9JRsbFq0JH5C51X2ZdnA==
+"@types/node@^10.17.60":
+  version "10.17.60"
+  resolved "https://registry.yarnpkg.com/@types/node/-/node-10.17.60.tgz#35f3d6213daed95da7f0f73e75bcc6980e90597b"
+  integrity sha512-F0KIgDJfy2nA3zMLmWGKxcH2ZVEtCZXHHdOQs2gSaQ27+lNeEfGxzkIw90aXswATX7AZ33tahPbzy6KAfUreVw==
 
 "@types/normalize-package-data@^2.4.1":
   version "2.4.1"

From 61e76250a64e8ef623328af0b6b9cbb15f6e287f Mon Sep 17 00:00:00 2001
From: Garrett Stevens <stevens.garrett.j@gmail.com>
Date: Tue, 28 Mar 2023 16:55:49 -0600
Subject: [PATCH 03/17] Re-flow comments

---
 README.md    | 13 +++++--------
 src/api.ts   | 12 ++++++------
 src/parse.ts | 27 ++++++++++++---------------
 3 files changed, 23 insertions(+), 29 deletions(-)

diff --git a/README.md b/README.md
index 4a5dfe6..9215895 100644
--- a/README.md
+++ b/README.md
@@ -30,8 +30,7 @@ import gff from '@gmod/gff'
 
 const fs = require('fs')
 
-// parse a file from a file name
-// parses only features and sequences by default,
+// parse a file from a file name. parses only features and sequences by default,
 // set options to parse directives and/or comments
 fs.createReadStream('path/to/my/file.gff3')
   .pipe(gff.parseStream({ parseAll: true }))
@@ -54,16 +53,14 @@ const arrayOfThings = gff.parseStringSync(stringOfGFF3)
 // format an array of items to a string
 const newStringOfGFF3 = gff.formatSync(arrayOfThings)
 
-// format a stream of things to a stream of text.
-// inserts sync marks automatically.
+// format a stream of things to a stream of text. inserts sync marks
+// automatically.
 myStreamOfGFF3Objects
   .pipe(gff.formatStream())
   .pipe(fs.createWriteStream('my_new.gff3'))
 
-// format a stream of things and write it to
-// a gff3 file. inserts sync marks and a
-// '##gff-version 3' header if one is not
-// already present
+// format a stream of things and write it to a gff3 file. inserts sync marks and
+// a '##gff-version 3' header if one is not already present
 gff.formatFile(
   myStreamOfGFF3Objects,
   fs.createWriteStream('my_new_2.gff3', { encoding: 'utf8' }),
diff --git a/src/api.ts b/src/api.ts
index f4b32c9..a1b571b 100644
--- a/src/api.ts
+++ b/src/api.ts
@@ -546,8 +546,8 @@ class FormattingTransform extends Transform {
     _encoding: BufferEncoding,
     callback: TransformCallback,
   ) {
-    // if we have not emitted anything yet, and this first
-    // chunk is not a gff-version directive, emit one
+    // if we have not emitted anything yet, and this first chunk is not a
+    // gff-version directive, emit one
     let str
     if (!this.haveWeEmittedData && this.insertVersionDirective) {
       const thisChunk = Array.isArray(chunk) ? chunk[0] : chunk
@@ -558,8 +558,8 @@ class FormattingTransform extends Transform {
       }
     }
 
-    // if it's a sequence chunk coming down, emit a FASTA directive and
-    // change to FASTA mode
+    // if it's a sequence chunk coming down, emit a FASTA directive and change
+    // to FASTA mode
     if ('sequence' in chunk && !this.fastaMode) {
       this.push('##FASTA\n')
       this.fastaMode = true
@@ -603,8 +603,8 @@ export function formatStream(options: FormatOptions = {}): FormattingTransform {
  * Format a stream of features, directives, comments and/or sequences into a
  * GFF3 file and write it to the filesystem.
 
- * Inserts synchronization (###) marks and a ##gff-version
- * directive automatically (if one is not already present).
+ * Inserts synchronization (###) marks and a ##gff-version directive
+ * automatically (if one is not already present).
  *
  * @param stream - the stream to write to the file
  * @param filename - the file path to write to
diff --git a/src/parse.ts b/src/parse.ts
index abeb4db..1b0ecc7 100644
--- a/src/parse.ts
+++ b/src/parse.ts
@@ -62,13 +62,12 @@ export default class Parser {
   sequenceCallback: (sequence: GFF3.GFF3Sequence) => void
   bufferSize: number
   fastaParser: FASTAParser | undefined = undefined
-  // if this is true, the parser ignores the
-  // rest of the lines in the file.  currently
-  // set when the file switches over to FASTA
+  // if this is true, the parser ignores the  rest of the lines in the file.
+  // currently set when the file switches over to FASTA
   eof = false
   lineNumber = 0
-  // features that we have to keep on hand for now because they
-  // might be referenced by something else
+  // features that we have to keep on hand for now because they might be
+  // referenced by something else
   private _underConstructionTopLevel: GFF3.GFF3Feature[] = []
   // index of the above by ID
   private _underConstructionById: Record<string, GFF3.GFF3Feature | undefined> =
@@ -77,8 +76,7 @@ export default class Parser {
     string,
     Record<string, boolean | undefined> | undefined
   > = {}
-  // features that reference something we have not seen yet
-  // structured as:
+  // features that reference something we have not seen yet. structured as:
   // {  'some_id' : {
   //     'Parent' : [ orphans that have a Parent attr referencing it ],
   //     'Derives_from' : [ orphans that have a Derives_from attr referencing it ],
@@ -211,8 +209,8 @@ export default class Parser {
   }
 
   /**
-   * return all under-construction features, called when we know
-   * there will be no additional data to attach to them
+   * return all under-construction features, called when we know there will be
+   * no additional data to attach to them
    */
   private _emitAllUnderConstructionFeatures() {
     this._underConstructionTopLevel.forEach(this._emitItem.bind(this))
@@ -221,8 +219,8 @@ export default class Parser {
     this._underConstructionById = {}
     this._completedReferences = {}
 
-    // if we have any orphans hanging around still, this is a
-    // problem. die with a parse error
+    // if we have any orphans hanging around still, this is a problem. die with
+    // a parse error
     if (Array.from(Object.values(this._underConstructionOrphans)).length) {
       throw new Error(
         `some features reference other features that do not exist in the file (or in the same '###' scope). ${Object.keys(
@@ -250,8 +248,7 @@ export default class Parser {
       : featureLine.attributes?.Derives_from || []
 
     if (!ids.length && !parents.length && !derives.length) {
-      // if it has no IDs and does not refer to anything, we can just
-      // output it
+      // if it has no IDs and does not refer to anything, we can just output it
       this._emitItem([featureLine])
       return
     }
@@ -271,8 +268,8 @@ export default class Parser {
         existing.push(featureLine)
         feature = existing
       } else {
-        // haven't seen it yet, so buffer it so we can attach
-        // child features to it
+        // haven't seen it yet, so buffer it so we can attach child features to
+        // it
         feature = [featureLine]
 
         this._enforceBufferSizeLimit(1)

From 59d051bd2bd3ff8ec2608caf1e8ae543286dfb9d Mon Sep 17 00:00:00 2001
From: Garrett Stevens <stevens.garrett.j@gmail.com>
Date: Tue, 28 Mar 2023 16:59:01 -0600
Subject: [PATCH 04/17] Use more thorough line ending regexp

---
 src/api.ts   | 2 +-
 src/parse.ts | 2 +-
 src/util.ts  | 4 ++--
 3 files changed, 4 insertions(+), 4 deletions(-)

diff --git a/src/api.ts b/src/api.ts
index a1b571b..4ba1d66 100644
--- a/src/api.ts
+++ b/src/api.ts
@@ -494,7 +494,7 @@ export function parseStringSync(
     },
   })
 
-  str.split(/\r?\n/).forEach(parser.addLine.bind(parser))
+  str.split(/\r\n|[\r\n]/).forEach(parser.addLine.bind(parser))
   parser.finish()
 
   return items
diff --git a/src/parse.ts b/src/parse.ts
index 1b0ecc7..3ef1903 100644
--- a/src/parse.ts
+++ b/src/parse.ts
@@ -154,7 +154,7 @@ export default class Parser {
       this.fastaParser.addLine(line)
     } else {
       // it's a parse error
-      const errLine = line.replace(/\r?\n?$/g, '')
+      const errLine = line.replace(/\r\n|[\r\n]$/g, '')
       throw new Error(`GFF3 parse error.  Cannot parse '${errLine}'.`)
     }
   }
diff --git a/src/util.ts b/src/util.ts
index 239e6f6..8e11865 100644
--- a/src/util.ts
+++ b/src/util.ts
@@ -52,7 +52,7 @@ export function parseAttributes(attrString: string): GFF3Attributes {
   const attrs: GFF3Attributes = {}
 
   attrString
-    .replace(/\r?\n$/, '')
+    .replace(/\r\n|[\r\n]$/, '')
     .split(';')
     .forEach((a) => {
       const nv = a.split('=', 2)
@@ -121,7 +121,7 @@ export function parseDirective(
 
   const parsed: GFF3Directive = { directive: name }
   if (contents.length) {
-    contents = contents.replace(/\r?\n$/, '')
+    contents = contents.replace(/\r\n|[\r\n]$/, '')
     parsed.value = contents
   }
 

From cd334534ef347007834bdd65e328bf83d68f154f Mon Sep 17 00:00:00 2001
From: Garrett Stevens <stevens.garrett.j@gmail.com>
Date: Tue, 28 Mar 2023 17:10:50 -0600
Subject: [PATCH 05/17] Better TypeScript types on formatItem

---
 src/api.ts  |  6 ++++--
 src/util.ts | 33 ++++++++++++++++++++++-----------
 2 files changed, 26 insertions(+), 13 deletions(-)

diff --git a/src/api.ts b/src/api.ts
index 4ba1d66..b4f7b41 100644
--- a/src/api.ts
+++ b/src/api.ts
@@ -515,7 +515,9 @@ export function formatSync(items: GFF3Item[]): string {
     if ('sequence' in i) sequences.push(i)
     else other.push(i)
   })
-  let str = other.map(formatItem).join('')
+  let str = other
+    .map((o) => (Array.isArray(o) ? formatItem(o).join('') : formatItem(o)))
+    .join('')
   if (sequences.length) {
     str += '##FASTA\n'
     str += sequences.map(formatSequence).join('')
@@ -565,7 +567,7 @@ class FormattingTransform extends Transform {
       this.fastaMode = true
     }
 
-    if (Array.isArray(chunk)) str = chunk.map(formatItem).join('')
+    if (Array.isArray(chunk)) str = chunk.map((c) => formatItem(c)).join('')
     else str = formatItem(chunk)
 
     this.push(str)
diff --git a/src/util.ts b/src/util.ts
index 8e11865..c899e68 100644
--- a/src/util.ts
+++ b/src/util.ts
@@ -277,6 +277,16 @@ export function formatSequence(seq: GFF3Sequence): string {
   }\n`
 }
 
+function formatSingleItem(
+  item: GFF3FeatureLineWithRefs | GFF3Directive | GFF3Comment | GFF3Sequence,
+) {
+  if ('attributes' in item) return formatFeature(item)
+  if ('directive' in item) return formatDirective(item)
+  if ('sequence' in item) return formatSequence(item)
+  if ('comment' in item) return formatComment(item)
+  return '# (invalid item found during format)\n'
+}
+
 /**
  * Format a directive, comment, sequence, or feature, or array of such items,
  * into one or more lines of GFF3.
@@ -284,6 +294,17 @@ export function formatSequence(seq: GFF3Sequence): string {
  * @param itemOrItems - A comment, sequence, or feature, or array of such items
  * @returns A formatted string or array of strings
  */
+export function formatItem(
+  item: GFF3FeatureLineWithRefs | GFF3Directive | GFF3Comment | GFF3Sequence,
+): string
+export function formatItem(
+  items: (
+    | GFF3FeatureLineWithRefs
+    | GFF3Directive
+    | GFF3Comment
+    | GFF3Sequence
+  )[],
+): string[]
 export function formatItem(
   itemOrItems:
     | GFF3FeatureLineWithRefs
@@ -291,17 +312,7 @@ export function formatItem(
     | GFF3Comment
     | GFF3Sequence
     | (GFF3FeatureLineWithRefs | GFF3Directive | GFF3Comment | GFF3Sequence)[],
-): string | string[] {
-  function formatSingleItem(
-    item: GFF3FeatureLineWithRefs | GFF3Directive | GFF3Comment | GFF3Sequence,
-  ) {
-    if ('attributes' in item) return formatFeature(item)
-    if ('directive' in item) return formatDirective(item)
-    if ('sequence' in item) return formatSequence(item)
-    if ('comment' in item) return formatComment(item)
-    return '# (invalid item found during format)\n'
-  }
-
+) {
   if (Array.isArray(itemOrItems)) {
     return itemOrItems.map(formatSingleItem)
   }

From 7ac07524be003fb253d1d8d5ba10179f918a1f12 Mon Sep 17 00:00:00 2001
From: Garrett Stevens <stevens.garrett.j@gmail.com>
Date: Tue, 28 Mar 2023 17:19:18 -0600
Subject: [PATCH 06/17] Prefer TS private over _ prefix for private fields

---
 src/api.ts   |  12 +++----
 src/parse.ts | 100 +++++++++++++++++++++++++--------------------------
 2 files changed, 56 insertions(+), 56 deletions(-)

diff --git a/src/api.ts b/src/api.ts
index b4f7b41..1e99caf 100644
--- a/src/api.ts
+++ b/src/api.ts
@@ -105,17 +105,17 @@ class GFFTransform extends Transform {
     })
   }
 
-  private _addLine(data: string | undefined) {
+  private addLine(data: string | undefined) {
     if (data) {
       this.parser.addLine(data)
     }
   }
 
-  private _nextText(buffer: string) {
+  private nextText(buffer: string) {
     const pieces = (this.textBuffer + buffer).split(/\r?\n/)
     this.textBuffer = pieces.pop() || ''
 
-    pieces.forEach((piece) => this._addLine(piece))
+    pieces.forEach((piece) => this.addLine(piece))
   }
 
   _transform(
@@ -123,13 +123,13 @@ class GFFTransform extends Transform {
     _encoding: BufferEncoding,
     callback: TransformCallback,
   ) {
-    this._nextText(this.decoder.write(chunk))
+    this.nextText(this.decoder.write(chunk))
     _callback(callback)
   }
 
   _flush(callback: TransformCallback) {
-    if (this.decoder.end) this._nextText(this.decoder.end())
-    if (this.textBuffer != null) this._addLine(this.textBuffer)
+    if (this.decoder.end) this.nextText(this.decoder.end())
+    if (this.textBuffer != null) this.addLine(this.textBuffer)
     this.parser.finish()
     _callback(callback)
   }
diff --git a/src/parse.ts b/src/parse.ts
index 3ef1903..59ca4f7 100644
--- a/src/parse.ts
+++ b/src/parse.ts
@@ -19,7 +19,7 @@ export class FASTAParser {
   addLine(line: string): void {
     const defMatch = /^>\s*(\S+)\s*(.*)/.exec(line)
     if (defMatch) {
-      this._flush()
+      this.flush()
       this.currentSequence = { id: defMatch[1], sequence: '' }
       if (defMatch[2]) this.currentSequence.description = defMatch[2].trim()
     } else if (this.currentSequence && /\S/.test(line)) {
@@ -27,12 +27,12 @@ export class FASTAParser {
     }
   }
 
-  private _flush() {
+  private flush() {
     if (this.currentSequence) this.seqCallback(this.currentSequence)
   }
 
   finish(): void {
-    this._flush()
+    this.flush()
   }
 }
 
@@ -68,11 +68,11 @@ export default class Parser {
   lineNumber = 0
   // features that we have to keep on hand for now because they might be
   // referenced by something else
-  private _underConstructionTopLevel: GFF3.GFF3Feature[] = []
+  private underConstructionTopLevel: GFF3.GFF3Feature[] = []
   // index of the above by ID
-  private _underConstructionById: Record<string, GFF3.GFF3Feature | undefined> =
+  private underConstructionById: Record<string, GFF3.GFF3Feature | undefined> =
     {}
-  private _completedReferences: Record<
+  private completedReferences: Record<
     string,
     Record<string, boolean | undefined> | undefined
   > = {}
@@ -82,7 +82,7 @@ export default class Parser {
   //     'Derives_from' : [ orphans that have a Derives_from attr referencing it ],
   //    }
   // }
-  private _underConstructionOrphans: Record<string, References | undefined> = {}
+  private underConstructionOrphans: Record<string, References | undefined> = {}
 
   constructor(args: ParserArgs) {
     // eslint-disable-next-line @typescript-eslint/no-empty-function
@@ -116,7 +116,7 @@ export default class Parser {
 
     if (/^\s*[^#\s>]/.test(line)) {
       // feature line, most common case
-      this._bufferLine(line)
+      this.bufferLine(line)
       return
     }
 
@@ -128,27 +128,27 @@ export default class Parser {
 
       if (hashsigns.length === 3) {
         // sync directive, all forward-references are resolved.
-        this._emitAllUnderConstructionFeatures()
+        this.emitAllUnderConstructionFeatures()
       } else if (hashsigns.length === 2) {
         const directive = GFF3.parseDirective(line)
         if (directive) {
           if (directive.directive === 'FASTA') {
-            this._emitAllUnderConstructionFeatures()
+            this.emitAllUnderConstructionFeatures()
             this.eof = true
             this.fastaParser = new FASTAParser(this.sequenceCallback)
           } else {
-            this._emitItem(directive)
+            this.emitItem(directive)
           }
         }
       } else {
         contents = contents.replace(/\s*/, '')
-        this._emitItem({ comment: contents })
+        this.emitItem({ comment: contents })
       }
     } else if (/^\s*$/.test(line)) {
       // blank line, do nothing
     } else if (/^\s*>/.test(line)) {
       // implicit beginning of a FASTA section
-      this._emitAllUnderConstructionFeatures()
+      this.emitAllUnderConstructionFeatures()
       this.eof = true
       this.fastaParser = new FASTAParser(this.sequenceCallback)
       this.fastaParser.addLine(line)
@@ -160,12 +160,12 @@ export default class Parser {
   }
 
   finish(): void {
-    this._emitAllUnderConstructionFeatures()
+    this.emitAllUnderConstructionFeatures()
     if (this.fastaParser) this.fastaParser.finish()
     this.endCallback()
   }
 
-  private _emitItem(
+  private emitItem(
     i: GFF3.GFF3Feature | GFF3.GFF3Directive | GFF3.GFF3Comment,
   ) {
     if (Array.isArray(i)) this.featureCallback(i)
@@ -173,7 +173,7 @@ export default class Parser {
     else if ('comment' in i) this.commentCallback(i)
   }
 
-  private _enforceBufferSizeLimit(additionalItemCount = 0) {
+  private enforceBufferSizeLimit(additionalItemCount = 0) {
     const _unbufferItem = (item?: GFF3.GFF3Feature) => {
       if (
         item &&
@@ -184,8 +184,8 @@ export default class Parser {
       ) {
         const ids = item[0].attributes.ID
         ids.forEach((id) => {
-          delete this._underConstructionById[id]
-          delete this._completedReferences[id]
+          delete this.underConstructionById[id]
+          delete this.completedReferences[id]
         })
         item.forEach((i) => {
           if (i.child_features)
@@ -197,12 +197,12 @@ export default class Parser {
     }
 
     while (
-      this._underConstructionTopLevel.length + additionalItemCount >
+      this.underConstructionTopLevel.length + additionalItemCount >
       this.bufferSize
     ) {
-      const item = this._underConstructionTopLevel.shift()
+      const item = this.underConstructionTopLevel.shift()
       if (item) {
-        this._emitItem(item)
+        this.emitItem(item)
         _unbufferItem(item)
       }
     }
@@ -212,26 +212,26 @@ export default class Parser {
    * return all under-construction features, called when we know there will be
    * no additional data to attach to them
    */
-  private _emitAllUnderConstructionFeatures() {
-    this._underConstructionTopLevel.forEach(this._emitItem.bind(this))
+  private emitAllUnderConstructionFeatures() {
+    this.underConstructionTopLevel.forEach(this.emitItem.bind(this))
 
-    this._underConstructionTopLevel = []
-    this._underConstructionById = {}
-    this._completedReferences = {}
+    this.underConstructionTopLevel = []
+    this.underConstructionById = {}
+    this.completedReferences = {}
 
     // if we have any orphans hanging around still, this is a problem. die with
     // a parse error
-    if (Array.from(Object.values(this._underConstructionOrphans)).length) {
+    if (Array.from(Object.values(this.underConstructionOrphans)).length) {
       throw new Error(
         `some features reference other features that do not exist in the file (or in the same '###' scope). ${Object.keys(
-          this._underConstructionOrphans,
+          this.underConstructionOrphans,
         )}`,
       )
     }
   }
 
   // do the right thing with a newly-parsed feature line
-  private _bufferLine(line: string) {
+  private bufferLine(line: string) {
     const rawFeatureLine = GFF3.parseFeature(line)
     const featureLine: GFF3.GFF3FeatureLineWithRefs = {
       ...rawFeatureLine,
@@ -249,17 +249,17 @@ export default class Parser {
 
     if (!ids.length && !parents.length && !derives.length) {
       // if it has no IDs and does not refer to anything, we can just output it
-      this._emitItem([featureLine])
+      this.emitItem([featureLine])
       return
     }
 
     let feature: GFF3.GFF3Feature | undefined = undefined
     ids.forEach((id) => {
-      const existing = this._underConstructionById[id]
+      const existing = this.underConstructionById[id]
       if (existing) {
         // another location of the same feature
         if (existing[existing.length - 1].type !== featureLine.type) {
-          this._parseError(
+          this.parseError(
             `multi-line feature "${id}" has inconsistent types: "${
               featureLine.type
             }", "${existing[existing.length - 1].type}"`,
@@ -272,27 +272,27 @@ export default class Parser {
         // it
         feature = [featureLine]
 
-        this._enforceBufferSizeLimit(1)
+        this.enforceBufferSizeLimit(1)
         if (!parents.length && !derives.length) {
-          this._underConstructionTopLevel.push(feature)
+          this.underConstructionTopLevel.push(feature)
         }
-        this._underConstructionById[id] = feature
+        this.underConstructionById[id] = feature
 
         // see if we have anything buffered that refers to it
-        this._resolveReferencesTo(feature, id)
+        this.resolveReferencesTo(feature, id)
       }
     })
 
     // try to resolve all its references
-    this._resolveReferencesFrom(
+    this.resolveReferencesFrom(
       feature || [featureLine],
       { Parent: parents, Derives_from: derives },
       ids,
     )
   }
 
-  private _resolveReferencesTo(feature: GFF3.GFF3Feature, id: string) {
-    const references = this._underConstructionOrphans[id]
+  private resolveReferencesTo(feature: GFF3.GFF3Feature, id: string) {
+    const references = this.underConstructionOrphans[id]
     //   references is of the form
     //   {
     //     'Parent' : [ orphans that have a Parent attr referencing this feature ],
@@ -305,15 +305,15 @@ export default class Parser {
     feature.forEach((loc) => {
       loc.derived_features.push(...references.Derives_from)
     })
-    delete this._underConstructionOrphans[id]
+    delete this.underConstructionOrphans[id]
   }
 
-  private _parseError(message: string) {
+  private parseError(message: string) {
     this.eof = true
     this.errorCallback(`${this.lineNumber}: ${message}`)
   }
 
-  private _resolveReferencesFrom(
+  private resolveReferencesFrom(
     feature: GFF3.GFF3Feature,
     references: { Parent: string[]; Derives_from: string[] },
     ids: string[],
@@ -335,12 +335,12 @@ export default class Parser {
     }
 
     references.Parent.forEach((toId) => {
-      const otherFeature = this._underConstructionById[toId]
+      const otherFeature = this.underConstructionById[toId]
       if (otherFeature) {
         const pname = containerAttributes.Parent
         if (
           !ids.filter((id) =>
-            postSet(this._completedReferences, id, `Parent,${toId}`),
+            postSet(this.completedReferences, id, `Parent,${toId}`),
           ).length
         ) {
           otherFeature.forEach((location) => {
@@ -348,25 +348,25 @@ export default class Parser {
           })
         }
       } else {
-        let ref = this._underConstructionOrphans[toId]
+        let ref = this.underConstructionOrphans[toId]
         if (!ref) {
           ref = {
             Parent: [],
             Derives_from: [],
           }
-          this._underConstructionOrphans[toId] = ref
+          this.underConstructionOrphans[toId] = ref
         }
         ref.Parent.push(feature)
       }
     })
 
     references.Derives_from.forEach((toId) => {
-      const otherFeature = this._underConstructionById[toId]
+      const otherFeature = this.underConstructionById[toId]
       if (otherFeature) {
         const pname = containerAttributes.Derives_from
         if (
           !ids.filter((id) =>
-            postSet(this._completedReferences, id, `Derives_from,${toId}`),
+            postSet(this.completedReferences, id, `Derives_from,${toId}`),
           ).length
         ) {
           otherFeature.forEach((location) => {
@@ -374,13 +374,13 @@ export default class Parser {
           })
         }
       } else {
-        let ref = this._underConstructionOrphans[toId]
+        let ref = this.underConstructionOrphans[toId]
         if (!ref) {
           ref = {
             Parent: [],
             Derives_from: [],
           }
-          this._underConstructionOrphans[toId] = ref
+          this.underConstructionOrphans[toId] = ref
         }
         ref.Derives_from.push(feature)
       }

From f3e27f8d2431208c9595e424791de5c5dea8118a Mon Sep 17 00:00:00 2001
From: Garrett Stevens <stevens.garrett.j@gmail.com>
Date: Tue, 28 Mar 2023 22:20:25 -0600
Subject: [PATCH 07/17] Move to web streams, limit to node >=16

---
 .eslintignore                      |   8 +
 .github/workflows/pull_request.yml |  12 +-
 .github/workflows/push.yml         |   6 +-
 README.md                          | 198 ++++++++++++++-------
 package.json                       |  15 +-
 src/api.ts                         | 270 +++++++++++++++--------------
 src/gff-to-json.ts                 |  23 ---
 src/index.ts                       |  36 ++--
 src/parse.ts                       | 145 ++++++++--------
 test/format.test.ts                |  54 +++---
 test/parse.test.ts                 |  87 ++++------
 test/util.ts                       |  46 +++++
 tsconfig.json                      |   4 +-
 yarn.lock                          | 135 ++++++++++-----
 14 files changed, 595 insertions(+), 444 deletions(-)
 create mode 100644 .eslintignore
 delete mode 100644 src/gff-to-json.ts
 create mode 100644 test/util.ts

diff --git a/.eslintignore b/.eslintignore
new file mode 100644
index 0000000..5911fc2
--- /dev/null
+++ b/.eslintignore
@@ -0,0 +1,8 @@
+.DS_Store
+node_modules
+coverage
+dist
+*.log
+.vscode/
+esm
+.eslintcache
diff --git a/.github/workflows/pull_request.yml b/.github/workflows/pull_request.yml
index ede3d8a..f94e6e8 100644
--- a/.github/workflows/pull_request.yml
+++ b/.github/workflows/pull_request.yml
@@ -4,27 +4,27 @@ on: pull_request
 
 jobs:
   lint:
-    name: Lint on node 14 and ubuntu-latest
+    name: Lint on node 16 and ubuntu-latest
     runs-on: ubuntu-latest
     steps:
       - uses: actions/checkout@v2
-      - name: Use Node.js 14
+      - name: Use Node.js 16
         uses: actions/setup-node@v1
         with:
-          node-version: '14'
+          node-version: '16'
       - name: Install deps and build (with cache)
         uses: bahmutov/npm-install@v1
       - name: Lint codebase
         run: yarn lint
   test:
-    name: Test and lint on node 14.x and ubuntu-latest
+    name: Test and lint on node 16.x and ubuntu-latest
     runs-on: ubuntu-latest
     steps:
       - uses: actions/checkout@v2
-      - name: Use Node.js 14.x
+      - name: Use Node.js 16.x
         uses: actions/setup-node@v2
         with:
-          node-version: '14'
+          node-version: '16'
       - name: Install deps (with cache)
         uses: bahmutov/npm-install@v1
       - name: Test codebase
diff --git a/.github/workflows/push.yml b/.github/workflows/push.yml
index f8b5900..6a937ef 100644
--- a/.github/workflows/push.yml
+++ b/.github/workflows/push.yml
@@ -4,14 +4,14 @@ on: push
 
 jobs:
   test:
-    name: Test and lint on node 14.x and ubuntu-latest
+    name: Test and lint on node 16.x and ubuntu-latest
     runs-on: ubuntu-latest
     steps:
       - uses: actions/checkout@v2
-      - name: Use Node.js 14.x
+      - name: Use Node.js 16.x
         uses: actions/setup-node@v2
         with:
-          node-version: '14'
+          node-version: '16'
       - name: Install deps (with cache)
         uses: bahmutov/npm-install@v1
       - name: Test codebase
diff --git a/README.md b/README.md
index 9215895..df93468 100644
--- a/README.md
+++ b/README.md
@@ -17,54 +17,109 @@ specification](https://github.com/The-Sequence-Ontology/Specifications/blob/mast
   with `disableDerivesFromReferences`)
 - only compatible with GFF3
 
+## Compatability
+
+Works in the browser and with Node.js v16 and up.
+
 ## Install
 
     $ npm install --save @gmod/gff
 
 ## Usage
 
-```js
-const gff = require('@gmod/gff').default
-// or in ES6 (recommended)
-import gff from '@gmod/gff'
+### Node.js example
 
-const fs = require('fs')
+```js
+import {
+  createReadStream,
+  createWriteStream,
+  readFileSync,
+  writeFileSync,
+} from 'fs'
+// Readable.toWeb and Writable.toWeb are only available in Node.js v18 and up
+// in Node.js 16, you'll have to provide your own stream source and sink
+import { Readable, Writable } from 'stream'
+// TransformStream is available without importing in Node.js v18 and up
+import { TransformStream } from 'stream/web'
+import {
+  formatSync,
+  parseStringSync,
+  GFFTransformer,
+  GFFFormattingTransformer,
+} from '@gmod/gff'
 
 // parse a file from a file name. parses only features and sequences by default,
 // set options to parse directives and/or comments
-fs.createReadStream('path/to/my/file.gff3')
-  .pipe(gff.parseStream({ parseAll: true }))
-  .on('data', (data) => {
-    if (data.directive) {
+;(async () => {
+  const readStream = createReadStream('/path/to/my/file.gff3')
+  const streamOfGFF3 = Readable.toWeb(readStream).pipeThrough(
+    new TransformStream(new GFFTransformer({ parseAll: true })),
+  )
+  for await (const data of streamOfGFF3) {
+    if ('directive' in data) {
+      console.log('got a directive', data)
+    } else if ('comment' in data) {
+      console.log('got a comment', data)
+    } else if ('sequence' in data) {
+      console.log('got a sequence from a FASTA section')
+    } else {
+      console.log('got a feature', data)
+    }
+  }
+
+  // parse a string of gff3 synchronously
+  const stringOfGFF3 = readFileSync('/path/to/my/file.gff3', 'utf8')
+  const arrayOfGFF3ITems = parseStringSync(stringOfGFF3)
+
+  // format an array of items to a string
+  const newStringOfGFF3 = formatSync(arrayOfGFF3ITems)
+  writeFileSync('/path/to/new/file.gff3', newStringOfGFF3)
+
+  // read a file, format it, and write it to a new file. inserts sync marks and
+  // a '##gff-version 3' header if one is not already present
+  await Readable.toWeb(createReadStream('/path/to/my/file.gff3'))
+    .pipeThrough(new TransformStream(new GFFTransformer({ parseAll: true })))
+    .pipeThrough(new TransformStream(new GFFFormattingTransformer()))
+    .pipeTo(Writable.toWeb(createWriteStream('/path/to/my/file.gff3')))
+})()
+```
+
+### Browser example
+
+```js
+import { GFFTransformer } from '@gmod/gff'
+
+// parse a file from a URL. parses only features and sequences by default, set
+// options to parse directives and/or comments
+;(async () => {
+  const response = await fetch('http://example.com/file.gff3')
+  if (!response.ok) {
+    throw new Error('Bad response')
+  }
+  if (!response.body) {
+    throw new Error('No response body')
+  }
+  const reader = response.body
+    .pipeThrough(new TransformStream(new GFFTransformer({ parseAll: true })))
+    .getReader()
+  let result
+  do {
+    result = await reader.read()
+    if (result.done) {
+      continue
+    }
+    const data = result.value
+    if ('directive' in data) {
       console.log('got a directive', data)
-    } else if (data.comment) {
+    } else if ('comment' in data) {
       console.log('got a comment', data)
-    } else if (data.sequence) {
+    } else if ('sequence' in data) {
       console.log('got a sequence from a FASTA section')
     } else {
       console.log('got a feature', data)
     }
-  })
-
-// parse a string of gff3 synchronously
-const stringOfGFF3 = fs.readFileSync('my_annotations.gff3').toString()
-const arrayOfThings = gff.parseStringSync(stringOfGFF3)
-
-// format an array of items to a string
-const newStringOfGFF3 = gff.formatSync(arrayOfThings)
-
-// format a stream of things to a stream of text. inserts sync marks
-// automatically.
-myStreamOfGFF3Objects
-  .pipe(gff.formatStream())
-  .pipe(fs.createWriteStream('my_new.gff3'))
-
-// format a stream of things and write it to a gff3 file. inserts sync marks and
-// a '##gff-version 3' header if one is not already present
-gff.formatFile(
-  myStreamOfGFF3Objects,
-  fs.createWriteStream('my_new_2.gff3', { encoding: 'utf8' }),
-)
+  } while (!result.done)
+})()
 ```
 
 ## Object format
@@ -202,16 +257,21 @@ ACTGACTAGCTAGCATCAGCGTCGTAGCTATTATATTACGGTAGCCA`)[
   - [parseSequences](#parsesequences)
   - [parseAll](#parseall)
   - [bufferSize](#buffersize)
-- [parseStream](#parsestream)
+- [GFFTransformer](#gfftransformer)
   - [Parameters](#parameters)
-- [parseStringSync](#parsestringsync)
+- [parseStream](#parsestream)
   - [Parameters](#parameters-1)
-- [formatSync](#formatsync)
+- [parseStringSync](#parsestringsync)
   - [Parameters](#parameters-2)
-- [formatStream](#formatstream)
+- [formatSync](#formatsync)
   - [Parameters](#parameters-3)
-- [formatFile](#formatfile)
+- [FormatOptions](#formatoptions)
+  - [minSyncLines](#minsynclines)
+  - [insertVersionDirective](#insertversiondirective)
+- [GFFFormattingTransformer](#gffformattingtransformer)
   - [Parameters](#parameters-4)
+- [formatStream](#formatstream)
+  - [Parameters](#parameters-5)
 
 ### ParseOptions
 
@@ -266,6 +326,15 @@ Maximum number of GFF3 lines to buffer, default 1000
 
 Type: [number](https://developer.mozilla.org/docs/Web/JavaScript/Reference/Global_Objects/Number)
 
+### GFFTransformer
+
+Parse a stream of text data into a stream of feature, directive, comment,
+an sequence objects.
+
+#### Parameters
+
+- `options` **[ParseOptions](#parseoptions)** Parser options (optional, default `{}`)
+
 ### parseStream
 
 Parse a stream of text data into a stream of feature, directive, comment,
@@ -275,7 +344,7 @@ an sequence objects.
 
 - `options` **[ParseOptions](#parseoptions)** Parsing options (optional, default `{}`)
 
-Returns **GFFTransform** stream (in objectMode) of parsed items
+Returns **[GFFTransformer](#gfftransformer)** stream (in objectMode) of parsed items
 
 ### parseStringSync
 
@@ -300,51 +369,59 @@ GFF3. Does not insert synchronization (###) marks.
 
 Returns **[string](https://developer.mozilla.org/docs/Web/JavaScript/Reference/Global_Objects/String)** the formatted GFF3
 
-### formatStream
+### FormatOptions
 
-Format a stream of features, directives, comments and/or sequences into a
+Formatter options
+
+#### minSyncLines
+
+The minimum number of lines to emit between sync (###) directives, default
+100
+
+Type: [number](https://developer.mozilla.org/docs/Web/JavaScript/Reference/Global_Objects/Number)
+
+#### insertVersionDirective
+
+Whether to insert a version directive at the beginning of a formatted
+stream if one does not exist already, default true
+
+Type: [boolean](https://developer.mozilla.org/docs/Web/JavaScript/Reference/Global_Objects/Boolean)
+
+### GFFFormattingTransformer
+
+Transform a stream of features, directives, comments and/or sequences into a
 stream of GFF3 text.
 
 Inserts synchronization (###) marks automatically.
 
 #### Parameters
 
-- `options` **FormatOptions** parser options (optional, default `{}`)
-
-Returns **FormattingTransform**
+- `options` **[FormatOptions](#formatoptions)** Formatter options (optional, default `{}`)
 
-### formatFile
+### formatStream
 
 Format a stream of features, directives, comments and/or sequences into a
-GFF3 file and write it to the filesystem.
+stream of GFF3 text.
 
-Inserts synchronization (###) marks and a ##gff-version
-directive automatically (if one is not already present).
+Inserts synchronization (###) marks automatically.
 
 #### Parameters
 
-- `stream` **Readable** the stream to write to the file
-- `writeStream` **Writable**
-- `options` **FormatOptions** parser options (optional, default `{}`)
-- `filename` the file path to write to
+- `options` **[FormatOptions](#formatoptions)** parser options (optional, default `{}`)
 
-Returns **[Promise](https://developer.mozilla.org/docs/Web/JavaScript/Reference/Global_Objects/Promise)\<null>** promise for null that resolves when the stream has been written
+Returns **[GFFFormattingTransformer](#gffformattingtransformer)**&#x20;
 
 ## About `util`
 
 There is also a `util` module that contains super-low-level functions for dealing with lines and parts of lines.
 
 ```js
-// non-ES6
-const util = require('@gmod/gff').default.util
-// or, with ES6
-import gff from '@gmod/gff'
-const util = gff.util
+import { util } from '@gmod/gff'
 
 const gff3Lines = util.formatItem({
   seq_id: 'ctgA',
   ...
-}))
+})
 ```
 
 ## util
@@ -530,9 +607,10 @@ into one or more lines of GFF3.
 
 #### Parameters
 
-- `itemOrItems` **([GFF3FeatureLineWithRefs](#gff3featurelinewithrefs) | [GFF3Directive](#gff3directive) | [GFF3Comment](#gff3comment) | [GFF3Sequence](#gff3sequence) | [Array](https://developer.mozilla.org/docs/Web/JavaScript/Reference/Global_Objects/Array)<([GFF3FeatureLineWithRefs](#gff3featurelinewithrefs) | [GFF3Directive](#gff3directive) | [GFF3Comment](#gff3comment) | [GFF3Sequence](#gff3sequence))>)** A comment, sequence, or feature, or array of such items
+- `item` **([GFF3FeatureLineWithRefs](#gff3featurelinewithrefs) | [GFF3Directive](#gff3directive) | [GFF3Comment](#gff3comment) | [GFF3Sequence](#gff3sequence))**&#x20;
+- `itemOrItems` A comment, sequence, or feature, or array of such items
 
-Returns **([string](https://developer.mozilla.org/docs/Web/JavaScript/Reference/Global_Objects/String) | [Array](https://developer.mozilla.org/docs/Web/JavaScript/Reference/Global_Objects/Array)<[string](https://developer.mozilla.org/docs/Web/JavaScript/Reference/Global_Objects/String)>)** A formatted string or array of strings
+Returns **[string](https://developer.mozilla.org/docs/Web/JavaScript/Reference/Global_Objects/String)** A formatted string or array of strings
 
 ### GFF3Attributes
 
diff --git a/package.json b/package.json
index d41b6fe..515c706 100644
--- a/package.json
+++ b/package.json
@@ -14,11 +14,8 @@
     "email": "rbuels@gmail.com",
     "url": "https://github.com/rbuels"
   },
-  "bin": {
-    "gff-to-json": "dist/gff-to-json.js"
-  },
   "engines": {
-    "node": ">=10"
+    "node": ">=16"
   },
   "files": [
     "dist",
@@ -35,8 +32,8 @@
     "docs:util": "documentation readme src/util.ts --section=util  --shallow",
     "docs:format": "prettier --write README.md",
     "prebuild": "npm-run-all clean",
-    "build:esm": "tsc --target es2018 --outDir esm",
-    "build:es5": "tsc --target es2015 --module commonjs --outDir dist",
+    "build:esm": "tsc --outDir esm",
+    "build:cjs": "tsc --module commonjs --outDir dist",
     "build": "npm-run-all --parallel build:*",
     "prepublishOnly": "npm-run-all test build",
     "postversion": "git push --follow-tags"
@@ -48,12 +45,9 @@
     "gff",
     "genomics"
   ],
-  "dependencies": {
-    "stream-browserify": "^3.0.0"
-  },
   "devDependencies": {
     "@types/jest": "^29.2.4",
-    "@types/node": "^10.17.60",
+    "@types/node": "^16.11.7",
     "@typescript-eslint/eslint-plugin": "^5.46.1",
     "@typescript-eslint/parser": "^5.46.1",
     "documentation": "^14.0.1",
@@ -69,6 +63,7 @@
     "rimraf": "^3.0.2",
     "tmp-promise": "^3.0.2",
     "ts-jest": "^29.0.3",
+    "ts-node": "^10.9.1",
     "tslib": "^2.4.1",
     "typescript": "^4.9.4"
   }
diff --git a/src/api.ts b/src/api.ts
index 1e99caf..c3f607b 100644
--- a/src/api.ts
+++ b/src/api.ts
@@ -1,29 +1,14 @@
-import { Transform, TransformCallback, Readable, Writable } from 'stream'
-import { StringDecoder as Decoder } from 'string_decoder'
-
-import Parser from './parse'
+import Parser, { ParseCallbacks } from './parse'
 import {
   formatItem,
   formatSequence,
   GFF3Comment,
   GFF3Directive,
   GFF3Feature,
-  GFF3FeatureLine,
-  GFF3FeatureLineWithRefs,
   GFF3Sequence,
   GFF3Item,
 } from './util'
 
-export type {
-  GFF3Comment,
-  GFF3Directive,
-  GFF3Feature,
-  GFF3FeatureLine,
-  GFF3FeatureLineWithRefs,
-  GFF3Sequence,
-  GFF3Item,
-}
-
 /** Parser options */
 export interface ParseOptions {
   /** Whether to resolve references to derives from features */
@@ -49,13 +34,6 @@ export interface ParseOptions {
 
 type ParseOptionsProcessed = Required<Omit<ParseOptions, 'parseAll'>>
 
-// call a callback on the next process tick if running in
-// an environment that supports it
-function _callback(callback: TransformCallback) {
-  if (process && process.nextTick) process.nextTick(callback)
-  else callback()
-}
-
 // shared arg processing for the parse routines
 function _processParseOptions(options: ParseOptions): ParseOptionsProcessed {
   const out = {
@@ -79,59 +57,94 @@ function _processParseOptions(options: ParseOptions): ParseOptionsProcessed {
   return out
 }
 
-class GFFTransform extends Transform {
-  encoding: BufferEncoding
-  decoder: Decoder
-  textBuffer = ''
-  parser: Parser
-
-  constructor(inputOptions: ParseOptions = {}) {
-    super({ objectMode: true })
-    const options = _processParseOptions(inputOptions)
-
-    this.encoding = inputOptions.encoding || 'utf8'
-
-    this.decoder = new Decoder()
+/**
+ * Parse a stream of text data into a stream of feature, directive, comment,
+ * an sequence objects.
+ */
+export class GFFTransformer implements Transformer<Uint8Array, GFF3Item> {
+  private decoder: TextDecoder
+  private parser: Parser
+  private lastString = ''
+  private parseFeatures: boolean
+  private parseDirectives: boolean
+  private parseComments: boolean
+  private parseSequences: boolean
 
-    const push = this.push.bind(this)
-    this.parser = new Parser({
-      featureCallback: options.parseFeatures ? push : undefined,
-      directiveCallback: options.parseDirectives ? push : undefined,
-      commentCallback: options.parseComments ? push : undefined,
-      sequenceCallback: options.parseSequences ? push : undefined,
-      errorCallback: (err) => this.emit('error', err),
-      bufferSize: options.bufferSize,
-      disableDerivesFromReferences: options.disableDerivesFromReferences,
-    })
+  /**
+   * Options for how the text stream is parsed
+   * @param options - Parser options
+   */
+  constructor(options: ParseOptions = {}) {
+    const processedOptions = _processParseOptions(options)
+    this.decoder = new TextDecoder(processedOptions.encoding)
+    const { bufferSize, disableDerivesFromReferences } = processedOptions
+    this.parser = new Parser({ bufferSize, disableDerivesFromReferences })
+    this.parseFeatures = processedOptions.parseFeatures
+    this.parseDirectives = processedOptions.parseDirectives
+    this.parseComments = processedOptions.parseComments
+    this.parseSequences = processedOptions.parseSequences
   }
 
-  private addLine(data: string | undefined) {
-    if (data) {
-      this.parser.addLine(data)
+  private makeCallbacks(
+    controller: TransformStreamDefaultController<GFF3Item>,
+  ) {
+    const callbacks: ParseCallbacks = {
+      errorCallback: this.emitErrorMessage.bind(this, controller),
+    }
+    if (this.parseFeatures) {
+      callbacks.featureCallback = this.enqueueItem.bind(this, controller)
+    }
+    if (this.parseDirectives) {
+      callbacks.directiveCallback = this.enqueueItem.bind(this, controller)
+    }
+    if (this.parseComments) {
+      callbacks.commentCallback = this.enqueueItem.bind(this, controller)
+    }
+    if (this.parseSequences) {
+      callbacks.sequenceCallback = this.enqueueItem.bind(this, controller)
     }
+    return callbacks
   }
 
-  private nextText(buffer: string) {
-    const pieces = (this.textBuffer + buffer).split(/\r?\n/)
-    this.textBuffer = pieces.pop() || ''
-
-    pieces.forEach((piece) => this.addLine(piece))
+  private emitErrorMessage(
+    controller: TransformStreamDefaultController<GFF3Item>,
+    errorMessage: string,
+  ) {
+    controller.error(errorMessage)
+  }
+  private enqueueItem(
+    controller: TransformStreamDefaultController<GFF3Item>,
+    item: GFF3Item,
+  ) {
+    controller.enqueue(item)
   }
 
-  _transform(
-    chunk: Buffer,
-    _encoding: BufferEncoding,
-    callback: TransformCallback,
+  transform(
+    chunk: Uint8Array,
+    controller: TransformStreamDefaultController<GFF3Item>,
   ) {
-    this.nextText(this.decoder.write(chunk))
-    _callback(callback)
+    // Decode the current chunk to string and prepend the last string
+    const string = `${this.lastString}${this.decoder.decode(chunk, {
+      stream: true,
+    })}`
+    // Extract lines from chunk
+    const lines = string.split(/\r\n|[\r\n]/g)
+    // Save last line, as it might be incomplete
+    this.lastString = lines.pop() || ''
+    // Enqueue each line in the next chunk
+    for (const line of lines) {
+      this.parser.addLine(line, this.makeCallbacks(controller))
+    }
   }
 
-  _flush(callback: TransformCallback) {
-    if (this.decoder.end) this.nextText(this.decoder.end())
-    if (this.textBuffer != null) this.addLine(this.textBuffer)
-    this.parser.finish()
-    _callback(callback)
+  flush(controller: TransformStreamDefaultController<GFF3Item>) {
+    const callbacks = this.makeCallbacks(controller)
+    this.lastString = `${this.lastString}${this.decoder.decode()}`
+    if (this.lastString) {
+      this.parser.addLine(this.lastString, callbacks)
+      this.lastString = ''
+    }
+    this.parser.finish(callbacks)
   }
 }
 
@@ -142,8 +155,8 @@ class GFFTransform extends Transform {
  * @param options - Parsing options
  * @returns stream (in objectMode) of parsed items
  */
-export function parseStream(options: ParseOptions = {}): GFFTransform {
-  return new GFFTransform(options)
+export function parseStream(options: ParseOptions = {}): GFFTransformer {
+  return new GFFTransformer(options)
 }
 
 /**
@@ -482,20 +495,33 @@ export function parseStringSync(
   const items: GFF3Item[] = []
   const push = items.push.bind(items)
 
+  const callbacks: ParseCallbacks = {
+    errorCallback: (err: string) => {
+      throw new Error(err)
+    },
+  }
+  if (options.parseFeatures) {
+    callbacks.featureCallback = push
+  }
+  if (options.parseDirectives) {
+    callbacks.directiveCallback = push
+  }
+  if (options.parseComments) {
+    callbacks.commentCallback = push
+  }
+  if (options.parseSequences) {
+    callbacks.sequenceCallback = push
+  }
+
   const parser = new Parser({
-    featureCallback: options.parseFeatures ? push : undefined,
-    directiveCallback: options.parseDirectives ? push : undefined,
-    commentCallback: options.parseComments ? push : undefined,
-    sequenceCallback: options.parseSequences ? push : undefined,
     disableDerivesFromReferences: options.disableDerivesFromReferences || false,
     bufferSize: Infinity,
-    errorCallback: (err) => {
-      throw err
-    },
   })
 
-  str.split(/\r\n|[\r\n]/).forEach(parser.addLine.bind(parser))
-  parser.finish()
+  str
+    .split(/\r\n|[\r\n]/)
+    .forEach((line) => parser.addLine.bind(parser)(line, callbacks))
+  parser.finish(callbacks)
 
   return items
 }
@@ -525,55 +551,71 @@ export function formatSync(items: GFF3Item[]): string {
   return str
 }
 
-interface FormatOptions {
+/** Formatter options */
+export interface FormatOptions {
+  /**
+   * The minimum number of lines to emit between sync (###) directives, default
+   * 100
+   */
   minSyncLines?: number
+  /**
+   * Whether to insert a version directive at the beginning of a formatted
+   * stream if one does not exist already, default true
+   */
   insertVersionDirective?: boolean
-  encoding?: BufferEncoding
 }
 
-class FormattingTransform extends Transform {
+/**
+ * Transform a stream of features, directives, comments and/or sequences into a
+ * stream of GFF3 text.
+ *
+ * Inserts synchronization (###) marks automatically.
+ */
+export class GFFFormattingTransformer implements Transformer<GFF3Item, string> {
   linesSinceLastSyncMark = 0
   haveWeEmittedData = false
   fastaMode = false
   minLinesBetweenSyncMarks: number
   insertVersionDirective: boolean
+  /**
+   * Options for how the output text stream is formatted
+   * @param options - Formatter options
+   */
   constructor(options: FormatOptions = {}) {
-    super(Object.assign(options, { objectMode: true }))
     this.minLinesBetweenSyncMarks = options.minSyncLines || 100
-    this.insertVersionDirective = options.insertVersionDirective || false
+    this.insertVersionDirective = options.insertVersionDirective || true
   }
 
-  _transform(
-    chunk: GFF3Item[],
-    _encoding: BufferEncoding,
-    callback: TransformCallback,
+  transform(
+    chunk: GFF3Item,
+    controller: TransformStreamDefaultController<string>,
   ) {
     // if we have not emitted anything yet, and this first chunk is not a
     // gff-version directive, emit one
-    let str
-    if (!this.haveWeEmittedData && this.insertVersionDirective) {
-      const thisChunk = Array.isArray(chunk) ? chunk[0] : chunk
-      if ('directive' in thisChunk) {
-        if (thisChunk.directive !== 'gff-version') {
-          this.push('##gff-version 3\n')
-        }
-      }
+    let str: string
+    if (
+      !this.haveWeEmittedData &&
+      this.insertVersionDirective &&
+      (!('directive' in chunk) ||
+        ('directive' in chunk && chunk.directive !== 'gff-version'))
+    ) {
+      controller.enqueue('##gff-version 3\n')
     }
 
     // if it's a sequence chunk coming down, emit a FASTA directive and change
     // to FASTA mode
     if ('sequence' in chunk && !this.fastaMode) {
-      this.push('##FASTA\n')
+      controller.enqueue('##FASTA\n')
       this.fastaMode = true
     }
 
     if (Array.isArray(chunk)) str = chunk.map((c) => formatItem(c)).join('')
     else str = formatItem(chunk)
 
-    this.push(str)
+    controller.enqueue(str)
 
     if (this.linesSinceLastSyncMark >= this.minLinesBetweenSyncMarks) {
-      this.push('###\n')
+      controller.enqueue('###\n')
       this.linesSinceLastSyncMark = 0
     } else {
       // count the number of newlines in this chunk
@@ -585,7 +627,6 @@ class FormattingTransform extends Transform {
     }
 
     this.haveWeEmittedData = true
-    _callback(callback)
   }
 }
 
@@ -597,37 +638,8 @@ class FormattingTransform extends Transform {
  *
  * @param options - parser options
  */
-export function formatStream(options: FormatOptions = {}): FormattingTransform {
-  return new FormattingTransform(options)
-}
-
-/**
- * Format a stream of features, directives, comments and/or sequences into a
- * GFF3 file and write it to the filesystem.
-
- * Inserts synchronization (###) marks and a ##gff-version directive
- * automatically (if one is not already present).
- *
- * @param stream - the stream to write to the file
- * @param filename - the file path to write to
- * @param options - parser options
- * @returns promise for null that resolves when the stream has been written
- */
-export function formatFile(
-  stream: Readable,
-  writeStream: Writable,
+export function formatStream(
   options: FormatOptions = {},
-): Promise<null> {
-  const newOptions = {
-    insertVersionDirective: true,
-    ...options,
-  }
-
-  return new Promise((resolve, reject) => {
-    stream
-      .pipe(new FormattingTransform(newOptions))
-      .on('end', () => resolve(null))
-      .on('error', reject)
-      .pipe(writeStream)
-  })
+): GFFFormattingTransformer {
+  return new GFFFormattingTransformer(options)
 }
diff --git a/src/gff-to-json.ts b/src/gff-to-json.ts
deleted file mode 100644
index 51e63bb..0000000
--- a/src/gff-to-json.ts
+++ /dev/null
@@ -1,23 +0,0 @@
-import gff from './index'
-let itemBuffer: any
-
-process.stdout.write('[\n')
-process.stdin
-  .pipe(gff.parseStream({ parseAll: true }))
-  .on('data', (item) => {
-    itemBuffer = JSON.stringify(item)
-    if (itemBuffer) {
-      process.stdout.write(itemBuffer)
-      process.stdout.write(',\n')
-    }
-  })
-  .on('error', (err) => {
-    console.error(err)
-    process.exit(1)
-  })
-  .on('end', () => {
-    if (itemBuffer) {
-      process.stdout.write(itemBuffer)
-    }
-    process.stdout.write('\n]\n')
-  })
diff --git a/src/index.ts b/src/index.ts
index 4a2ee37..ea069a2 100644
--- a/src/index.ts
+++ b/src/index.ts
@@ -1,35 +1,25 @@
-import {
-  parseStream,
-  parseStringSync,
-  formatSync,
-  formatStream,
-  formatFile,
+import * as api from './api'
+
+export * from './api'
+
+export type {
+  GFF3Attributes,
   GFF3Comment,
   GFF3Directive,
   GFF3Feature,
   GFF3FeatureLine,
   GFF3FeatureLineWithRefs,
-  GFF3Sequence,
+  GFF3GenomeBuildDirective,
   GFF3Item,
-} from './api'
+  GFF3Sequence,
+  GFF3SequenceRegionDirective,
+} from './util'
 
 import * as util from './util'
 
-export default {
-  parseStream,
-  parseStringSync,
-  formatSync,
-  formatStream,
-  formatFile,
+export const defaultExport = {
+  ...api,
   util,
 }
 
-export type {
-  GFF3Comment,
-  GFF3Directive,
-  GFF3Feature,
-  GFF3FeatureLine,
-  GFF3FeatureLineWithRefs,
-  GFF3Sequence,
-  GFF3Item,
-}
+export default defaultExport
diff --git a/src/parse.ts b/src/parse.ts
index 59ca4f7..b03be50 100644
--- a/src/parse.ts
+++ b/src/parse.ts
@@ -5,14 +5,23 @@ const containerAttributes = {
   Derives_from: 'derived_features' as const,
 }
 
+export interface ParseCallbacks {
+  featureCallback?(feature: GFF3.GFF3Feature): void
+  commentCallback?(comment: GFF3.GFF3Comment): void
+  errorCallback?(error: string): void
+  directiveCallback?(directive: GFF3.GFF3Directive): void
+  sequenceCallback?(sequence: GFF3.GFF3Sequence): void
+}
+
 export class FASTAParser {
-  seqCallback: (sequence: GFF3.GFF3Sequence) => void
   currentSequence:
     | { id: string; sequence: string; description?: string }
     | undefined
 
-  constructor(seqCallback: (sequence: GFF3.GFF3Sequence) => void) {
-    this.seqCallback = seqCallback
+  constructor(
+    // eslint-disable-next-line @typescript-eslint/no-empty-function
+    private seqCallback: (sequence: GFF3.GFF3Sequence) => void = () => {},
+  ) {
     this.currentSequence = undefined
   }
 
@@ -37,12 +46,7 @@ export class FASTAParser {
 }
 
 interface ParserArgs {
-  featureCallback?(feature: GFF3.GFF3Feature): void
   endCallback?(): void
-  commentCallback?(comment: GFF3.GFF3Comment): void
-  errorCallback?(error: string): void
-  directiveCallback?(directive: GFF3.GFF3Directive): void
-  sequenceCallback?(sequence: GFF3.GFF3Sequence): void
   bufferSize?: number
   disableDerivesFromReferences?: boolean
 }
@@ -53,13 +57,8 @@ interface References {
 }
 
 export default class Parser {
-  featureCallback: (feature: GFF3.GFF3Feature) => void
   endCallback: () => void
-  commentCallback: (comment: GFF3.GFF3Comment) => void
-  errorCallback: (error: string) => void
   disableDerivesFromReferences: boolean
-  directiveCallback: (directive: GFF3.GFF3Directive) => void
-  sequenceCallback: (sequence: GFF3.GFF3Sequence) => void
   bufferSize: number
   fastaParser: FASTAParser | undefined = undefined
   // if this is true, the parser ignores the  rest of the lines in the file.
@@ -82,18 +81,14 @@ export default class Parser {
   //     'Derives_from' : [ orphans that have a Derives_from attr referencing it ],
   //    }
   // }
-  private underConstructionOrphans: Record<string, References | undefined> = {}
+  private underConstructionOrphans: Map<string, References | undefined> =
+    new Map()
 
   constructor(args: ParserArgs) {
     // eslint-disable-next-line @typescript-eslint/no-empty-function
     const nullFunc = () => {}
 
-    this.featureCallback = args.featureCallback || nullFunc
     this.endCallback = args.endCallback || nullFunc
-    this.commentCallback = args.commentCallback || nullFunc
-    this.errorCallback = args.errorCallback || nullFunc
-    this.directiveCallback = args.directiveCallback || nullFunc
-    this.sequenceCallback = args.sequenceCallback || nullFunc
     this.disableDerivesFromReferences =
       args.disableDerivesFromReferences || false
 
@@ -101,7 +96,7 @@ export default class Parser {
     this.bufferSize = args.bufferSize === undefined ? 1000 : args.bufferSize
   }
 
-  addLine(line: string): void {
+  addLine(line: string, callbacks: ParseCallbacks): void {
     // if we have transitioned to a fasta section, just delegate to that parser
     if (this.fastaParser) {
       this.fastaParser.addLine(line)
@@ -116,7 +111,7 @@ export default class Parser {
 
     if (/^\s*[^#\s>]/.test(line)) {
       // feature line, most common case
-      this.bufferLine(line)
+      this.bufferLine(line, callbacks)
       return
     }
 
@@ -128,52 +123,59 @@ export default class Parser {
 
       if (hashsigns.length === 3) {
         // sync directive, all forward-references are resolved.
-        this.emitAllUnderConstructionFeatures()
+        this.emitAllUnderConstructionFeatures(callbacks)
       } else if (hashsigns.length === 2) {
         const directive = GFF3.parseDirective(line)
         if (directive) {
           if (directive.directive === 'FASTA') {
-            this.emitAllUnderConstructionFeatures()
+            this.emitAllUnderConstructionFeatures(callbacks)
             this.eof = true
-            this.fastaParser = new FASTAParser(this.sequenceCallback)
+            this.fastaParser = new FASTAParser(callbacks.sequenceCallback)
           } else {
-            this.emitItem(directive)
+            this.emitItem(directive, callbacks)
           }
         }
       } else {
         contents = contents.replace(/\s*/, '')
-        this.emitItem({ comment: contents })
+        this.emitItem({ comment: contents }, callbacks)
       }
     } else if (/^\s*$/.test(line)) {
       // blank line, do nothing
     } else if (/^\s*>/.test(line)) {
       // implicit beginning of a FASTA section
-      this.emitAllUnderConstructionFeatures()
+      this.emitAllUnderConstructionFeatures(callbacks)
       this.eof = true
-      this.fastaParser = new FASTAParser(this.sequenceCallback)
+      this.fastaParser = new FASTAParser(callbacks.sequenceCallback)
       this.fastaParser.addLine(line)
     } else {
       // it's a parse error
       const errLine = line.replace(/\r\n|[\r\n]$/g, '')
-      throw new Error(`GFF3 parse error.  Cannot parse '${errLine}'.`)
+      throw new Error(`GFF3 parse error. Cannot parse '${errLine}'.`)
     }
   }
 
-  finish(): void {
-    this.emitAllUnderConstructionFeatures()
+  finish(callbacks: ParseCallbacks): void {
+    this.emitAllUnderConstructionFeatures(callbacks)
     if (this.fastaParser) this.fastaParser.finish()
     this.endCallback()
   }
 
   private emitItem(
     i: GFF3.GFF3Feature | GFF3.GFF3Directive | GFF3.GFF3Comment,
+    callbacks: ParseCallbacks,
   ) {
-    if (Array.isArray(i)) this.featureCallback(i)
-    else if ('directive' in i) this.directiveCallback(i)
-    else if ('comment' in i) this.commentCallback(i)
+    if (Array.isArray(i) && callbacks.featureCallback)
+      callbacks.featureCallback(i)
+    else if ('directive' in i && callbacks.directiveCallback)
+      callbacks.directiveCallback(i)
+    else if ('comment' in i && callbacks.commentCallback)
+      callbacks.commentCallback(i)
   }
 
-  private enforceBufferSizeLimit(additionalItemCount = 0) {
+  private enforceBufferSizeLimit(
+    additionalItemCount = 0,
+    callbacks: ParseCallbacks,
+  ) {
     const _unbufferItem = (item?: GFF3.GFF3Feature) => {
       if (
         item &&
@@ -202,7 +204,7 @@ export default class Parser {
     ) {
       const item = this.underConstructionTopLevel.shift()
       if (item) {
-        this.emitItem(item)
+        this.emitItem(item, callbacks)
         _unbufferItem(item)
       }
     }
@@ -212,8 +214,10 @@ export default class Parser {
    * return all under-construction features, called when we know there will be
    * no additional data to attach to them
    */
-  private emitAllUnderConstructionFeatures() {
-    this.underConstructionTopLevel.forEach(this.emitItem.bind(this))
+  private emitAllUnderConstructionFeatures(callbacks: ParseCallbacks) {
+    this.underConstructionTopLevel.forEach((f) =>
+      this.emitItem.bind(this)(f, callbacks),
+    )
 
     this.underConstructionTopLevel = []
     this.underConstructionById = {}
@@ -221,17 +225,17 @@ export default class Parser {
 
     // if we have any orphans hanging around still, this is a problem. die with
     // a parse error
-    if (Array.from(Object.values(this.underConstructionOrphans)).length) {
+    if (this.underConstructionOrphans.size) {
       throw new Error(
-        `some features reference other features that do not exist in the file (or in the same '###' scope). ${Object.keys(
-          this.underConstructionOrphans,
+        `some features reference other features that do not exist in the file (or in the same '###' scope). ${Array.from(
+          this.underConstructionOrphans.keys(),
         )}`,
       )
     }
   }
 
   // do the right thing with a newly-parsed feature line
-  private bufferLine(line: string) {
+  private bufferLine(line: string, callbacks: ParseCallbacks) {
     const rawFeatureLine = GFF3.parseFeature(line)
     const featureLine: GFF3.GFF3FeatureLineWithRefs = {
       ...rawFeatureLine,
@@ -249,7 +253,7 @@ export default class Parser {
 
     if (!ids.length && !parents.length && !derives.length) {
       // if it has no IDs and does not refer to anything, we can just output it
-      this.emitItem([featureLine])
+      this.emitItem([featureLine], callbacks)
       return
     }
 
@@ -263,6 +267,7 @@ export default class Parser {
             `multi-line feature "${id}" has inconsistent types: "${
               featureLine.type
             }", "${existing[existing.length - 1].type}"`,
+            callbacks,
           )
         }
         existing.push(featureLine)
@@ -272,7 +277,7 @@ export default class Parser {
         // it
         feature = [featureLine]
 
-        this.enforceBufferSizeLimit(1)
+        this.enforceBufferSizeLimit(1, callbacks)
         if (!parents.length && !derives.length) {
           this.underConstructionTopLevel.push(feature)
         }
@@ -292,7 +297,7 @@ export default class Parser {
   }
 
   private resolveReferencesTo(feature: GFF3.GFF3Feature, id: string) {
-    const references = this.underConstructionOrphans[id]
+    const references = this.underConstructionOrphans.get(id)
     //   references is of the form
     //   {
     //     'Parent' : [ orphans that have a Parent attr referencing this feature ],
@@ -305,12 +310,28 @@ export default class Parser {
     feature.forEach((loc) => {
       loc.derived_features.push(...references.Derives_from)
     })
-    delete this.underConstructionOrphans[id]
+    this.underConstructionOrphans.delete(id)
   }
 
-  private parseError(message: string) {
+  private parseError(message: string, callbacks: ParseCallbacks) {
     this.eof = true
-    this.errorCallback(`${this.lineNumber}: ${message}`)
+    callbacks.errorCallback?.(`${this.lineNumber}: ${message}`)
+  }
+
+  // this is all a bit more awkward in javascript than it was in perl
+  private postSet(
+    obj: Record<string, Record<string, boolean | undefined> | undefined>,
+    slot1: string,
+    slot2: string,
+  ) {
+    let subObj = obj[slot1]
+    if (!subObj) {
+      subObj = {}
+      obj[slot1] = subObj
+    }
+    const returnVal = subObj[slot2] || false
+    subObj[slot2] = true
+    return returnVal
   }
 
   private resolveReferencesFrom(
@@ -318,29 +339,13 @@ export default class Parser {
     references: { Parent: string[]; Derives_from: string[] },
     ids: string[],
   ) {
-    // this is all a bit more awkward in javascript than it was in perl
-    function postSet(
-      obj: Record<string, Record<string, boolean | undefined> | undefined>,
-      slot1: string,
-      slot2: string,
-    ) {
-      let subObj = obj[slot1]
-      if (!subObj) {
-        subObj = {}
-        obj[slot1] = subObj
-      }
-      const returnVal = subObj[slot2] || false
-      subObj[slot2] = true
-      return returnVal
-    }
-
     references.Parent.forEach((toId) => {
       const otherFeature = this.underConstructionById[toId]
       if (otherFeature) {
         const pname = containerAttributes.Parent
         if (
           !ids.filter((id) =>
-            postSet(this.completedReferences, id, `Parent,${toId}`),
+            this.postSet(this.completedReferences, id, `Parent,${toId}`),
           ).length
         ) {
           otherFeature.forEach((location) => {
@@ -348,13 +353,13 @@ export default class Parser {
           })
         }
       } else {
-        let ref = this.underConstructionOrphans[toId]
+        let ref = this.underConstructionOrphans.get(toId)
         if (!ref) {
           ref = {
             Parent: [],
             Derives_from: [],
           }
-          this.underConstructionOrphans[toId] = ref
+          this.underConstructionOrphans.set(toId, ref)
         }
         ref.Parent.push(feature)
       }
@@ -366,7 +371,7 @@ export default class Parser {
         const pname = containerAttributes.Derives_from
         if (
           !ids.filter((id) =>
-            postSet(this.completedReferences, id, `Derives_from,${toId}`),
+            this.postSet(this.completedReferences, id, `Derives_from,${toId}`),
           ).length
         ) {
           otherFeature.forEach((location) => {
@@ -374,13 +379,13 @@ export default class Parser {
           })
         }
       } else {
-        let ref = this.underConstructionOrphans[toId]
+        let ref = this.underConstructionOrphans.get(toId)
         if (!ref) {
           ref = {
             Parent: [],
             Derives_from: [],
           }
-          this.underConstructionOrphans[toId] = ref
+          this.underConstructionOrphans.set(toId, ref)
         }
         ref.Derives_from.push(feature)
       }
diff --git a/test/format.test.ts b/test/format.test.ts
index 07fb94b..4fbf229 100644
--- a/test/format.test.ts
+++ b/test/format.test.ts
@@ -1,17 +1,9 @@
-import {
-  createReadStream,
-  createWriteStream,
-  fdatasync as fdatasyncC,
-  promises as fsPromises,
-} from 'fs'
+import fsPromises from 'fs/promises'
+import { ReadableStream, WritableStream, TransformStream } from 'stream/web'
 import tmp from 'tmp-promise'
 
-import { promisify } from 'util'
-import getStream from 'get-stream'
-
 import gff from '../src'
-
-const fdatasync = promisify(fdatasyncC)
+import { FileSource, SyncFileSink } from './util'
 
 describe('GFF3 formatting', () => {
   ;['spec_eden', 'au9_scaffold_subset', 'hybrid1', 'hybrid2'].forEach(
@@ -40,17 +32,27 @@ describe('GFF3 formatting', () => {
           'utf8',
         )
 
-        const resultGFF3 = await getStream(
-          createReadStream(require.resolve(`./data/${file}.gff3`))
-            .pipe(
+        const stream = new ReadableStream(
+          new FileSource(require.resolve(`./data/${file}.gff3`)),
+        )
+          .pipeThrough(
+            new TransformStream(
               gff.parseStream({
                 parseFeatures: true,
                 parseComments: true,
                 parseDirectives: true,
               }),
-            )
-            .pipe(gff.formatStream()),
-        )
+            ),
+          )
+          .pipeThrough(new TransformStream(gff.formatStream()))
+        const chunks: string[] = []
+        const reader = stream.getReader()
+        let result: ReadableStreamReadResult<string>
+        do {
+          result = await reader.read()
+          if (result.value !== undefined) chunks.push(result.value)
+        } while (!result.done)
+        const resultGFF3 = chunks.join('')
         expect(resultGFF3).toEqual(expectedGFF3)
       })
     },
@@ -60,15 +62,19 @@ describe('GFF3 formatting', () => {
     'spec_eden.no_version_directive',
     'au9_scaffold_subset',
   ].forEach((file) => {
-    it(`can roundtrip ${file}.gff3 with formatFile`, async () => {
+    it(`can roundtrip ${file}.gff3 with formatStream and insertVersionDirective`, async () => {
       jest.setTimeout(1000)
       await tmp.withFile(async (tmpFile) => {
-        const gff3In = createReadStream(
-          require.resolve(`./data/${file}.gff3`),
-        ).pipe(gff.parseStream({ parseAll: true }))
-
-        await gff.formatFile(gff3In, createWriteStream(tmpFile.path))
-        await fdatasync(tmpFile.fd)
+        await new ReadableStream(
+          new FileSource(require.resolve(`./data/${file}.gff3`)),
+        )
+          .pipeThrough(new TransformStream(gff.parseStream({ parseAll: true })))
+          .pipeThrough(
+            new TransformStream(
+              gff.formatStream({ insertVersionDirective: true }),
+            ),
+          )
+          .pipeTo(new WritableStream(new SyncFileSink(tmpFile.fd)))
 
         const resultGFF3 = await fsPromises.readFile(tmpFile.path, 'utf8')
 
diff --git a/test/parse.test.ts b/test/parse.test.ts
index da89284..7bd6d58 100644
--- a/test/parse.test.ts
+++ b/test/parse.test.ts
@@ -1,4 +1,5 @@
-import { createReadStream, promises as fsPromises } from 'fs'
+import fsPromises from 'fs/promises'
+import { ReadableStream, TransformStream } from 'stream/web'
 import gff from '../src'
 import {
   formatFeature,
@@ -7,6 +8,7 @@ import {
   GFF3Comment,
   GFF3Sequence,
 } from '../src/util'
+import { FileSource } from './util'
 
 interface ReadAllResults {
   features: GFF3Feature[]
@@ -16,43 +18,38 @@ interface ReadAllResults {
   all: (GFF3Feature | GFF3Comment | GFF3Directive | GFF3Sequence)[]
 }
 
-function readAll(
+async function readAll(
   filename: string,
   args: Record<string, unknown> = {},
 ): Promise<ReadAllResults> {
-  return new Promise((resolve, reject) => {
-    const stuff: ReadAllResults = {
-      features: [],
-      comments: [],
-      directives: [],
-      sequences: [],
-      all: [],
-    }
+  const stuff: ReadAllResults = {
+    features: [],
+    comments: [],
+    directives: [],
+    sequences: [],
+    all: [],
+  }
 
-    // $p->max_lookback(1)
-    createReadStream(require.resolve(filename))
-      .pipe(
-        gff.parseStream({
-          parseFeatures: true,
-          parseDirectives: true,
-          parseComments: true,
-          parseSequences: true,
-          bufferSize: 10,
-          ...args,
-        }),
-      )
-      .on('data', (d) => {
-        stuff.all.push(d)
-        if (d.directive) stuff.directives.push(d)
-        else if (d.comment) stuff.comments.push(d)
-        else if (d.sequence) stuff.sequences.push(d)
-        else stuff.features.push(d)
-      })
-      .on('end', () => {
-        resolve(stuff)
-      })
-      .on('error', reject)
-  })
+  const stream = new ReadableStream(new FileSource(require.resolve(filename)))
+  const transformStream = new TransformStream(
+    gff.parseStream({
+      parseFeatures: true,
+      parseDirectives: true,
+      parseComments: true,
+      parseSequences: true,
+      bufferSize: 10,
+      ...args,
+    }),
+  )
+  const gffStream = stream.pipeThrough(transformStream)
+  for await (const value of gffStream) {
+    stuff.all.push(value)
+    if ('directive' in value) stuff.directives.push(value)
+    else if ('comment' in value) stuff.comments.push(value)
+    else if ('sequence' in value) stuff.sequences.push(value)
+    else stuff.features.push(value)
+  }
+  return stuff
 }
 
 describe('GFF3 parser', () => {
@@ -83,7 +80,6 @@ describe('GFF3 parser', () => {
   ].forEach(([count, filename]) => {
     it(`can cursorily parse ${filename}`, async () => {
       const stuff = await readAll(`./data/${filename}`)
-      //     $p->max_lookback(10);
       expect(stuff.all.length).toEqual(count)
     })
   })
@@ -157,7 +153,7 @@ describe('GFF3 parser', () => {
       disableDerivesFromReferences: true,
     })
     expect(stuff.all).toHaveLength(17697)
-  })
+  }, 10000)
 
   // check that some files throw a parse error
   ;['mm9_sample_ensembl.gff3', 'Saccharomyces_cerevisiae_EF3_e64.gff3'].forEach(
@@ -298,23 +294,4 @@ SL2.40%25ch01	IT%25AG eugene	g%25e;ne	80999140	81004317	.	+	.	Alias=Solyc01g0988
       expect(stuff.sequences).toEqual(expectedOutput)
     })
   })
-
-  it('can be written to directly', async () => {
-    const items: GFF3Feature[] = await new Promise((resolve, reject) => {
-      const i: GFF3Feature[] = []
-      const stream = gff
-        .parseStream()
-        .on('data', (d) => i.push(d))
-        .on('end', () => resolve(i))
-        .on('error', reject)
-
-      stream.write(
-        `SL2.40ch00	ITAG_eugene	gene	16437	18189	.	+	.	Alias=Solyc00g005000;ID=gene:Solyc00g005000.2;Name=Solyc00g005000.2;from_BOGAS=1;length=1753\n`,
-      )
-      stream.end()
-    })
-
-    expect(items).toHaveLength(1)
-    expect(items[0][0].seq_id).toEqual('SL2.40ch00')
-  })
 })
diff --git a/test/util.ts b/test/util.ts
new file mode 100644
index 0000000..5a5d0e9
--- /dev/null
+++ b/test/util.ts
@@ -0,0 +1,46 @@
+import fs from 'fs'
+import type {
+  UnderlyingByteSource,
+  UnderlyingSink,
+  ReadableByteStreamController,
+} from 'stream/web'
+
+// In Node 18 we can use `stream.Readable.toWeb()` instead of having to make our
+// own file source
+export class FileSource implements UnderlyingByteSource {
+  type = 'bytes' as const
+  autoAllocateChunkSize = 1024
+  fileHandeP: Promise<fs.promises.FileHandle>
+
+  constructor(filePath: string) {
+    this.fileHandeP = fs.promises.open(filePath)
+  }
+
+  async pull(controller: ReadableByteStreamController) {
+    // eslint-disable-next-line @typescript-eslint/ban-ts-comment
+    // @ts-ignore
+    const view = controller.byobRequest.view as ArrayBufferView
+    const fileHandle = await this.fileHandeP
+    const { bytesRead } = await fileHandle.read({
+      buffer: view,
+      offset: view.byteOffset,
+      length: view.byteLength,
+    })
+
+    if (bytesRead === 0) {
+      await fileHandle.close()
+      controller.close()
+    }
+    // eslint-disable-next-line @typescript-eslint/ban-ts-comment
+    // @ts-ignore
+    controller.byobRequest.respond(bytesRead)
+  }
+}
+
+export class SyncFileSink implements UnderlyingSink<string> {
+  constructor(private fileDescriptor: number) {}
+
+  write(chunk: string) {
+    fs.appendFileSync(this.fileDescriptor, chunk)
+  }
+}
diff --git a/tsconfig.json b/tsconfig.json
index 649e0c4..bd30a82 100644
--- a/tsconfig.json
+++ b/tsconfig.json
@@ -1,8 +1,10 @@
 {
   "include": ["src"],
   "compilerOptions": {
+    // https://github.com/microsoft/TypeScript/wiki/Node-Target-Mapping#node-16
     "types": ["node", "jest"],
-    "lib": ["dom", "esnext"],
+    "lib": ["dom", "es2021"],
+    "target": "es2021",
     "declaration": true,
     "moduleResolution": "node",
     "sourceMap": true,
diff --git a/yarn.lock b/yarn.lock
index 382b453..ab35213 100644
--- a/yarn.lock
+++ b/yarn.lock
@@ -484,6 +484,13 @@
   resolved "https://registry.yarnpkg.com/@bcoe/v8-coverage/-/v8-coverage-0.2.3.tgz#75a2e8b51cb758a7553d6804a5932d7aace75c39"
   integrity sha512-0hYQ8SB4Db5zvZB4axdMHGwEaQjkZzFjQiN9LVYvIFB2nSUHW9tYpxWriPrWDASIxiaXax83REcLxuSdnGPZtw==
 
+"@cspotcode/source-map-support@^0.8.0":
+  version "0.8.1"
+  resolved "https://registry.yarnpkg.com/@cspotcode/source-map-support/-/source-map-support-0.8.1.tgz#00629c35a688e05a88b1cda684fb9d5e73f000a1"
+  integrity sha512-IchNf6dN4tHoMFIn/7OE8LWZ19Y6q/67Bmf6vnGREv8RSbBVb9LPJxEcnwrcwX6ixSvaiGoomAUvu4YSxXrVgw==
+  dependencies:
+    "@jridgewell/trace-mapping" "0.3.9"
+
 "@eslint/eslintrc@^1.4.0":
   version "1.4.0"
   resolved "https://registry.yarnpkg.com/@eslint/eslintrc/-/eslintrc-1.4.0.tgz#8ec64e0df3e7a1971ee1ff5158da87389f167a63"
@@ -760,6 +767,14 @@
   resolved "https://registry.yarnpkg.com/@jridgewell/sourcemap-codec/-/sourcemap-codec-1.4.11.tgz#771a1d8d744eeb71b6adb35808e1a6c7b9b8c8ec"
   integrity sha512-Fg32GrJo61m+VqYSdRSjRXMjQ06j8YIYfcTqndLYVAaHmroZHLJZCydsWBOTDqXS2v+mjxohBWEMfg97GXmYQg==
 
+"@jridgewell/trace-mapping@0.3.9":
+  version "0.3.9"
+  resolved "https://registry.yarnpkg.com/@jridgewell/trace-mapping/-/trace-mapping-0.3.9.tgz#6534fd5933a53ba7cbf3a17615e273a0d1273ff9"
+  integrity sha512-3Belt6tdc8bPgAtbcmdtNJlirVoTmEb5e2gC94PnkwEW9jI6CAHUeoG85tjWP5WquqfavoMtMwiG4P926ZKKuQ==
+  dependencies:
+    "@jridgewell/resolve-uri" "^3.0.3"
+    "@jridgewell/sourcemap-codec" "^1.4.10"
+
 "@jridgewell/trace-mapping@^0.3.0":
   version "0.3.4"
   resolved "https://registry.yarnpkg.com/@jridgewell/trace-mapping/-/trace-mapping-0.3.4.tgz#f6a0832dffd5b8a6aaa633b7d9f8e8e94c83a0c3"
@@ -831,6 +846,26 @@
   dependencies:
     "@sinonjs/commons" "^1.7.0"
 
+"@tsconfig/node10@^1.0.7":
+  version "1.0.9"
+  resolved "https://registry.yarnpkg.com/@tsconfig/node10/-/node10-1.0.9.tgz#df4907fc07a886922637b15e02d4cebc4c0021b2"
+  integrity sha512-jNsYVVxU8v5g43Erja32laIDHXeoNvFEpX33OK4d6hljo3jDhCBDhx5dhCCTMWUojscpAagGiRkBKxpdl9fxqA==
+
+"@tsconfig/node12@^1.0.7":
+  version "1.0.11"
+  resolved "https://registry.yarnpkg.com/@tsconfig/node12/-/node12-1.0.11.tgz#ee3def1f27d9ed66dac6e46a295cffb0152e058d"
+  integrity sha512-cqefuRsh12pWyGsIoBKJA9luFu3mRxCA+ORZvA4ktLSzIuCUtWVxGIuXigEwO5/ywWFMZ2QEGKWvkZG1zDMTag==
+
+"@tsconfig/node14@^1.0.0":
+  version "1.0.3"
+  resolved "https://registry.yarnpkg.com/@tsconfig/node14/-/node14-1.0.3.tgz#e4386316284f00b98435bf40f72f75a09dabf6c1"
+  integrity sha512-ysT8mhdixWK6Hw3i1V2AeRqZ5WfXg1G43mqoYlM2nc6388Fq5jcXyr5mRsqViLx/GJYdoL0bfXD8nmF+Zn/Iow==
+
+"@tsconfig/node16@^1.0.2":
+  version "1.0.3"
+  resolved "https://registry.yarnpkg.com/@tsconfig/node16/-/node16-1.0.3.tgz#472eaab5f15c1ffdd7f8628bd4c4f753995ec79e"
+  integrity sha512-yOlFc+7UtL/89t2ZhjPvvB/DeAr3r+Dq58IgzsFkOAvVC6NMJXmCGjbptdXdR9qsX7pKcTL+s87FtYREi2dEEQ==
+
 "@types/babel__core@^7.1.14":
   version "7.1.19"
   resolved "https://registry.yarnpkg.com/@types/babel__core/-/babel__core-7.1.19.tgz#7b497495b7d1b4812bdb9d02804d0576f43ee460"
@@ -949,10 +984,10 @@
   resolved "https://registry.yarnpkg.com/@types/node/-/node-17.0.23.tgz#3b41a6e643589ac6442bdbd7a4a3ded62f33f7da"
   integrity sha512-UxDxWn7dl97rKVeVS61vErvw086aCYhDLyvRQZ5Rk65rZKepaFdm53GeqXaKBuOhED4e9uWq34IC3TdSdJJ2Gw==
 
-"@types/node@^10.17.60":
-  version "10.17.60"
-  resolved "https://registry.yarnpkg.com/@types/node/-/node-10.17.60.tgz#35f3d6213daed95da7f0f73e75bcc6980e90597b"
-  integrity sha512-F0KIgDJfy2nA3zMLmWGKxcH2ZVEtCZXHHdOQs2gSaQ27+lNeEfGxzkIw90aXswATX7AZ33tahPbzy6KAfUreVw==
+"@types/node@^16.11.7":
+  version "16.18.22"
+  resolved "https://registry.yarnpkg.com/@types/node/-/node-16.18.22.tgz#a6505a5da1387aae03fddfb93591118f27b4c0ea"
+  integrity sha512-LJSIirgASa1LicFGTUFwDY7BfKDtLIbijqDLkH47LxEo/jtdrtiZ4/kLPD99bEQhTcPcuh6KhDllHqRxygJD2w==
 
 "@types/normalize-package-data@^2.4.1":
   version "2.4.1"
@@ -1142,6 +1177,16 @@ acorn-jsx@^5.3.2:
   resolved "https://registry.yarnpkg.com/acorn-jsx/-/acorn-jsx-5.3.2.tgz#7ed5bb55908b3b2f1bc55c6af1653bada7f07937"
   integrity sha512-rq9s+JNhf0IChjtDXxllJ7g41oZk5SlXtp0LHwyA5cejwn7vKmKp4pPri6YEePv2PU65sAsegbXtIinmDFDXgQ==
 
+acorn-walk@^8.1.1:
+  version "8.2.0"
+  resolved "https://registry.yarnpkg.com/acorn-walk/-/acorn-walk-8.2.0.tgz#741210f2e2426454508853a2f44d0ab83b7f69c1"
+  integrity sha512-k+iyHEuPgSw6SbuDpGQM+06HQUa04DZ3o+F6CSzXMvvI5KMvnaEqXe+YVe555R9nn6GPt404fos4wcgpw12SDA==
+
+acorn@^8.4.1:
+  version "8.8.2"
+  resolved "https://registry.yarnpkg.com/acorn/-/acorn-8.8.2.tgz#1b2f25db02af965399b9776b0c2c391276d37c4a"
+  integrity sha512-xjIYgE8HBrkpd/sJqOGNspf8uHG+NOHGOw6a/Urj8taM2EXfdNAH2oFcPeIFfsv3+kz/mJrS5VuMqbNLjCa2vw==
+
 acorn@^8.8.0:
   version "8.8.1"
   resolved "https://registry.yarnpkg.com/acorn/-/acorn-8.8.1.tgz#0a3f9cbecc4ec3bea6f0a80b66ae8dd2da250b73"
@@ -1201,6 +1246,11 @@ anymatch@^3.0.3, anymatch@~3.1.2:
     normalize-path "^3.0.0"
     picomatch "^2.0.4"
 
+arg@^4.1.0:
+  version "4.1.3"
+  resolved "https://registry.yarnpkg.com/arg/-/arg-4.1.3.tgz#269fc7ad5b8e42cb63c896d5666017261c144089"
+  integrity sha512-58S9QDqG0Xx27YwPSt9fJxivjYl432YCwfDMfZ+71RAqUrZef7LrKQZ3LHLOwCS4FLNBplP533Zx895SeOCHvA==
+
 argparse@^1.0.7:
   version "1.0.10"
   resolved "https://registry.yarnpkg.com/argparse/-/argparse-1.0.10.tgz#bcd6791ea5ae09725e17e5ad988134cd40b3d911"
@@ -1550,6 +1600,11 @@ convert-source-map@^2.0.0:
   resolved "https://registry.yarnpkg.com/convert-source-map/-/convert-source-map-2.0.0.tgz#4b560f649fc4e918dd0ab75cf4961e8bc882d82a"
   integrity sha512-Kvp459HrV2FEJ1CAsi1Ku+MY3kasH19TFykTz2xWmMeq6bk2NU3XXvfJ+Q61m0xktWwt+1HSYf3JZsTms3aRJg==
 
+create-require@^1.1.0:
+  version "1.1.1"
+  resolved "https://registry.yarnpkg.com/create-require/-/create-require-1.1.1.tgz#c1d7e8f1e5f6cfc9ff65f9cd352d37348756c333"
+  integrity sha512-dcKFX3jn0MpIaXjisoRvexIJVEKzaq7z2rZKxf+MSr9TkdmHmsU4m2lcLojrj/FHl8mk5VxMmYA+ftRkP/3oKQ==
+
 cross-spawn@^6.0.5:
   version "6.0.5"
   resolved "https://registry.yarnpkg.com/cross-spawn/-/cross-spawn-6.0.5.tgz#4a5ec7c64dfae22c3a14124dbacdee846d80cbc4"
@@ -1648,6 +1703,11 @@ diff-sequences@^29.3.1:
   resolved "https://registry.yarnpkg.com/diff-sequences/-/diff-sequences-29.3.1.tgz#104b5b95fe725932421a9c6e5b4bef84c3f2249e"
   integrity sha512-hlM3QR272NXCi4pq+N4Kok4kOp6EsgOM3ZSpJI7Da3UAs+Ttsi8MRmB6trM/lhyzUxGfOgnpkHtgqm5Q/CTcfQ==
 
+diff@^4.0.1:
+  version "4.0.2"
+  resolved "https://registry.yarnpkg.com/diff/-/diff-4.0.2.tgz#60f3aecb89d5fae520c11aa19efc2bb982aade7d"
+  integrity sha512-58lmxKSA4BNyLz+HHMUzlOEpg09FV+ev6ZMe3vJihgdxzgcwZ8VoEEPmALCZG9LmqfVoNMMKpttIYTVG6uDY7A==
+
 diff@^5.0.0, diff@^5.1.0:
   version "5.1.0"
   resolved "https://registry.yarnpkg.com/diff/-/diff-5.1.0.tgz#bc52d298c5ea8df9194800224445ed43ffc87e40"
@@ -2514,7 +2574,7 @@ inflight@^1.0.4:
     once "^1.3.0"
     wrappy "1"
 
-inherits@2, inherits@^2.0.3, inherits@~2.0.4:
+inherits@2:
   version "2.0.4"
   resolved "https://registry.yarnpkg.com/inherits/-/inherits-2.0.4.tgz#0fa2c64f932917c3433a0ded55363aae37416b7c"
   integrity sha512-k/vGaX4/Yla3WzyMCvTQOXYeIHvqOKtnqBduzTHpzpQZzAskKMhZ2K+EnBiSM9zGSoIFeMpXKxa4dYeZIQqewQ==
@@ -3313,7 +3373,7 @@ make-dir@^3.0.0:
   dependencies:
     semver "^6.0.0"
 
-make-error@1.x:
+make-error@1.x, make-error@^1.1.1:
   version "1.3.6"
   resolved "https://registry.yarnpkg.com/make-error/-/make-error-1.3.6.tgz#2eb2e37ea9b67c4891f684a1394799af484cf7a2"
   integrity sha512-s8UhlNe7vPKomQhC1qFelMokr/Sc3AgNbso3n74mVPA5LTZwkB9NlXf4XPamLxJE8h0gh73rM94xvwRT2CVInw==
@@ -4273,15 +4333,6 @@ read-pkg@^7.1.0:
     parse-json "^5.2.0"
     type-fest "^2.0.0"
 
-readable-stream@^3.5.0:
-  version "3.6.0"
-  resolved "https://registry.yarnpkg.com/readable-stream/-/readable-stream-3.6.0.tgz#337bbda3adc0706bd3e024426a286d4b4b2c9198"
-  integrity sha512-BViHy7LKeTz4oNnkcLJ+lVSL6vpiFeX6/d3oSH8zCW7UxP2onchk+vTGB143xuFjHS3deTgkKoXXymXqymiIdA==
-  dependencies:
-    inherits "^2.0.3"
-    string_decoder "^1.1.1"
-    util-deprecate "^1.0.1"
-
 readdirp@~3.6.0:
   version "3.6.0"
   resolved "https://registry.yarnpkg.com/readdirp/-/readdirp-3.6.0.tgz#74a370bd857116e245b29cc97340cd431a02a6c7"
@@ -4454,11 +4505,6 @@ safe-buffer@~5.1.1:
   resolved "https://registry.yarnpkg.com/safe-buffer/-/safe-buffer-5.1.2.tgz#991ec69d296e0313747d59bdfd2b745c35f8828d"
   integrity sha512-Gd2UZBJDkXlY7GbJxfsE8/nvKkUEU1G38c1siN6QP6a9PT9MmHB8GnpscSmMJSoF8LOIrt8ud/wPtojys4G6+g==
 
-safe-buffer@~5.2.0:
-  version "5.2.1"
-  resolved "https://registry.yarnpkg.com/safe-buffer/-/safe-buffer-5.2.1.tgz#1eaf9fa9bdb1fdd4ec75f58f9cdb4e6b7827eec6"
-  integrity sha512-rp3So07KcdmmKbGvgaNxQSJr7bGVSVk5S9Eq1F+ppbRo70+YeaDxkw5Dd8NPN+GD6bjnYm2VuPuCXmpuYvmCXQ==
-
 safe-regex-test@^1.0.0:
   version "1.0.0"
   resolved "https://registry.yarnpkg.com/safe-regex-test/-/safe-regex-test-1.0.0.tgz#793b874d524eb3640d1873aad03596db2d4f2295"
@@ -4616,14 +4662,6 @@ stack-utils@^2.0.3:
   dependencies:
     escape-string-regexp "^2.0.0"
 
-stream-browserify@^3.0.0:
-  version "3.0.0"
-  resolved "https://registry.yarnpkg.com/stream-browserify/-/stream-browserify-3.0.0.tgz#22b0a2850cdf6503e73085da1fc7b7d0c2122f2f"
-  integrity sha512-H73RAHsVBapbim0tU2JwwOiXUj+fikfiaoYAKHF3VJfA0pe2BCzkhAHBlLG6REzE+2WNZcxOXjK7lkso+9euLA==
-  dependencies:
-    inherits "~2.0.4"
-    readable-stream "^3.5.0"
-
 string-length@^4.0.1:
   version "4.0.2"
   resolved "https://registry.yarnpkg.com/string-length/-/string-length-4.0.2.tgz#a8a8dc7bd5c1a82b9b3c8b87e125f66871b6e57a"
@@ -4693,13 +4731,6 @@ string.prototype.trimstart@^1.0.6:
     define-properties "^1.1.4"
     es-abstract "^1.20.4"
 
-string_decoder@^1.1.1:
-  version "1.3.0"
-  resolved "https://registry.yarnpkg.com/string_decoder/-/string_decoder-1.3.0.tgz#42f114594a46cf1a8e30b0a84f56c78c3edac21e"
-  integrity sha512-hkRX8U1WjJFd8LsDJ2yQ/wWWxaopEsABU1XfkM8A+j0+85JAGppt16cr1Whg6KIbb4okU6Mql6BOj+uup/wKeA==
-  dependencies:
-    safe-buffer "~5.2.0"
-
 stringify-entities@^4.0.2:
   version "4.0.3"
   resolved "https://registry.yarnpkg.com/stringify-entities/-/stringify-entities-4.0.3.tgz#cfabd7039d22ad30f3cc435b0ca2c1574fc88ef8"
@@ -4847,6 +4878,25 @@ ts-jest@^29.0.3:
     semver "7.x"
     yargs-parser "^21.0.1"
 
+ts-node@^10.9.1:
+  version "10.9.1"
+  resolved "https://registry.yarnpkg.com/ts-node/-/ts-node-10.9.1.tgz#e73de9102958af9e1f0b168a6ff320e25adcff4b"
+  integrity sha512-NtVysVPkxxrwFGUUxGYhfux8k78pQB3JqYBXlLRZgdGUqTO5wU/UyHop5p70iEbGhB7q5KmiZiU0Y3KlJrScEw==
+  dependencies:
+    "@cspotcode/source-map-support" "^0.8.0"
+    "@tsconfig/node10" "^1.0.7"
+    "@tsconfig/node12" "^1.0.7"
+    "@tsconfig/node14" "^1.0.0"
+    "@tsconfig/node16" "^1.0.2"
+    acorn "^8.4.1"
+    acorn-walk "^8.1.1"
+    arg "^4.1.0"
+    create-require "^1.1.0"
+    diff "^4.0.1"
+    make-error "^1.1.1"
+    v8-compile-cache-lib "^3.0.1"
+    yn "3.1.1"
+
 tsconfig-paths@^3.14.1:
   version "3.14.1"
   resolved "https://registry.yarnpkg.com/tsconfig-paths/-/tsconfig-paths-3.14.1.tgz#ba0734599e8ea36c862798e920bcf163277b137a"
@@ -5024,11 +5074,6 @@ uri-js@^4.2.2:
   dependencies:
     punycode "^2.1.0"
 
-util-deprecate@^1.0.1:
-  version "1.0.2"
-  resolved "https://registry.yarnpkg.com/util-deprecate/-/util-deprecate-1.0.2.tgz#450d4dc9fa70de732762fbd2d4a28981419a0ccf"
-  integrity sha1-RQ1Nyfpw3nMnYvvS1KKJgUGaDM8=
-
 uvu@^0.5.0:
   version "0.5.6"
   resolved "https://registry.yarnpkg.com/uvu/-/uvu-0.5.6.tgz#2754ca20bcb0bb59b64e9985e84d2e81058502df"
@@ -5039,6 +5084,11 @@ uvu@^0.5.0:
     kleur "^4.0.3"
     sade "^1.7.3"
 
+v8-compile-cache-lib@^3.0.1:
+  version "3.0.1"
+  resolved "https://registry.yarnpkg.com/v8-compile-cache-lib/-/v8-compile-cache-lib-3.0.1.tgz#6336e8d71965cb3d35a1bbb7868445a7c05264bf"
+  integrity sha512-wa7YjyUGfNZngI/vtK0UHAN+lgDCxBPCylVXGp0zu59Fz5aiGtNXaq3DhIov063MorB+VfufLh3JlF2KdTK3xg==
+
 v8-to-istanbul@^9.0.1:
   version "9.0.1"
   resolved "https://registry.yarnpkg.com/v8-to-istanbul/-/v8-to-istanbul-9.0.1.tgz#b6f994b0b5d4ef255e17a0d17dc444a9f5132fa4"
@@ -5195,6 +5245,11 @@ yargs@^17.3.1, yargs@^17.5.1:
     y18n "^5.0.5"
     yargs-parser "^21.1.1"
 
+yn@3.1.1:
+  version "3.1.1"
+  resolved "https://registry.yarnpkg.com/yn/-/yn-3.1.1.tgz#1e87401a09d767c1d5eab26a6e4c185182d2eb50"
+  integrity sha512-Ux4ygGWsu2c7isFWe8Yu1YluJmqVhxqK2cLXNQA5AcC3QfbGNpM7fu0Y8b/z16pXLnFxZYvWhd3fhBY9DLmC6Q==
+
 yocto-queue@^0.1.0:
   version "0.1.0"
   resolved "https://registry.yarnpkg.com/yocto-queue/-/yocto-queue-0.1.0.tgz#0294eb3dee05028d31ee1a5fa2c556a6aaf10a1b"

From 0e5bad1054b44c6994e0644e77dce5ead1f26128 Mon Sep 17 00:00:00 2001
From: Garrett Stevens <stevens.garrett.j@gmail.com>
Date: Mon, 3 Apr 2023 15:50:51 -0600
Subject: [PATCH 08/17] Remove encoding and parseAll options

---
 README.md           | 27 +++++++++------------------
 src/api.ts          | 44 ++------------------------------------------
 test/format.test.ts | 14 ++++++++++++--
 3 files changed, 23 insertions(+), 62 deletions(-)

diff --git a/README.md b/README.md
index df93468..b6821cb 100644
--- a/README.md
+++ b/README.md
@@ -53,7 +53,9 @@ import {
 ;(async () => {
   const readStream = createReadStream('/path/to/my/file.gff3')
   const streamOfGFF3 = Readable.toWeb(readStream).pipeThrough(
-    new TransformStream(new GFFTransformer({ parseAll: true })),
+    new TransformStream(
+      new GFFTransformer({ parseComments: true, parseDirectives: true }),
+    ),
   )
   for await (const data of streamOfGFF3) {
     if ('directive' in data) {
@@ -78,7 +80,11 @@ import {
   // read a file, format it, and write it to a new file. inserts sync marks and
   // a '##gff-version 3' header if one is not already present
   await Readable.toWeb(createReadStream('/path/to/my/file.gff3'))
-    .pipeThrough(new TransformStream(new GFFTransformer({ parseAll: true })))
+    .pipeThrough(
+      new TransformStream(
+        new GFFTransformer({ parseComments: true, parseDirectives: true }),
+      ),
+    )
     .pipeThrough(new TransformStream(new GFFFormattingTransformer()))
     .pipeTo(Writable.toWeb(createWriteStream('/path/to/my/file.gff3')))
 })()
@@ -250,12 +256,10 @@ ACTGACTAGCTAGCATCAGCGTCGTAGCTATTATATTACGGTAGCCA`)[
 
 - [ParseOptions](#parseoptions)
   - [disableDerivesFromReferences](#disablederivesfromreferences)
-  - [encoding](#encoding)
   - [parseFeatures](#parsefeatures)
   - [parseDirectives](#parsedirectives)
   - [parseComments](#parsecomments)
   - [parseSequences](#parsesequences)
-  - [parseAll](#parseall)
   - [bufferSize](#buffersize)
 - [GFFTransformer](#gfftransformer)
   - [Parameters](#parameters)
@@ -283,12 +287,6 @@ Whether to resolve references to derives from features
 
 Type: [boolean](https://developer.mozilla.org/docs/Web/JavaScript/Reference/Global_Objects/Boolean)
 
-#### encoding
-
-Text encoding of the input GFF3. default 'utf8'
-
-Type: BufferEncoding
-
 #### parseFeatures
 
 Whether to parse features, default true
@@ -313,13 +311,6 @@ Whether to parse sequences, default true
 
 Type: [boolean](https://developer.mozilla.org/docs/Web/JavaScript/Reference/Global_Objects/Boolean)
 
-#### parseAll
-
-Parse all features, directives, comments, and sequences. Overrides other
-parsing options. Default false.
-
-Type: [boolean](https://developer.mozilla.org/docs/Web/JavaScript/Reference/Global_Objects/Boolean)
-
 #### bufferSize
 
 Maximum number of GFF3 lines to buffer, default 1000
@@ -354,7 +345,7 @@ parsed items.
 #### Parameters
 
 - `str` **[string](https://developer.mozilla.org/docs/Web/JavaScript/Reference/Global_Objects/String)** GFF3 string
-- `inputOptions` **({disableDerivesFromReferences: [boolean](https://developer.mozilla.org/docs/Web/JavaScript/Reference/Global_Objects/Boolean)?, encoding: BufferEncoding?, bufferSize: [number](https://developer.mozilla.org/docs/Web/JavaScript/Reference/Global_Objects/Number)?} | [undefined](https://developer.mozilla.org/docs/Web/JavaScript/Reference/Global_Objects/undefined))?** Parsing options
+- `inputOptions` **({disableDerivesFromReferences: [boolean](https://developer.mozilla.org/docs/Web/JavaScript/Reference/Global_Objects/Boolean)?, bufferSize: [number](https://developer.mozilla.org/docs/Web/JavaScript/Reference/Global_Objects/Number)?} | [undefined](https://developer.mozilla.org/docs/Web/JavaScript/Reference/Global_Objects/undefined))?** Parsing options
 
 Returns **[Array](https://developer.mozilla.org/docs/Web/JavaScript/Reference/Global_Objects/Array)<(GFF3Feature | GFF3Sequence)>** array of parsed features, directives, comments and/or sequences
 
diff --git a/src/api.ts b/src/api.ts
index c3f607b..2e1f525 100644
--- a/src/api.ts
+++ b/src/api.ts
@@ -13,8 +13,6 @@ import {
 export interface ParseOptions {
   /** Whether to resolve references to derives from features */
   disableDerivesFromReferences?: boolean
-  /** Text encoding of the input GFF3. default 'utf8' */
-  encoding?: BufferEncoding
   /** Whether to parse features, default true */
   parseFeatures?: boolean
   /** Whether to parse directives, default false */
@@ -23,21 +21,15 @@ export interface ParseOptions {
   parseComments?: boolean
   /** Whether to parse sequences, default true */
   parseSequences?: boolean
-  /**
-   * Parse all features, directives, comments, and sequences. Overrides other
-   * parsing options. Default false.
-   */
-  parseAll?: boolean
   /** Maximum number of GFF3 lines to buffer, default 1000 */
   bufferSize?: number
 }
 
-type ParseOptionsProcessed = Required<Omit<ParseOptions, 'parseAll'>>
+type ParseOptionsProcessed = Required<ParseOptions>
 
 // shared arg processing for the parse routines
 function _processParseOptions(options: ParseOptions): ParseOptionsProcessed {
   const out = {
-    encoding: 'utf8' as const,
     parseFeatures: true,
     parseDirectives: false,
     parseSequences: true,
@@ -47,13 +39,6 @@ function _processParseOptions(options: ParseOptions): ParseOptionsProcessed {
     ...options,
   }
 
-  if (options.parseAll) {
-    out.parseFeatures = true
-    out.parseDirectives = true
-    out.parseComments = true
-    out.parseSequences = true
-  }
-
   return out
 }
 
@@ -75,8 +60,8 @@ export class GFFTransformer implements Transformer<Uint8Array, GFF3Item> {
    * @param options - Parser options
    */
   constructor(options: ParseOptions = {}) {
+    this.decoder = new TextDecoder()
     const processedOptions = _processParseOptions(options)
-    this.decoder = new TextDecoder(processedOptions.encoding)
     const { bufferSize, disableDerivesFromReferences } = processedOptions
     this.parser = new Parser({ bufferSize, disableDerivesFromReferences })
     this.parseFeatures = processedOptions.parseFeatures
@@ -172,26 +157,15 @@ export function parseStringSync(
   inputOptions?:
     | {
         disableDerivesFromReferences?: boolean
-        encoding?: BufferEncoding
         bufferSize?: number
       }
     | undefined,
 ): (GFF3Feature | GFF3Sequence)[]
-export function parseStringSync<T extends boolean>(
-  str: string,
-  inputOptions: {
-    parseAll?: T
-    disableDerivesFromReferences?: boolean
-    encoding?: BufferEncoding
-    bufferSize?: number
-  },
-): T extends true ? GFF3Item[] : never
 export function parseStringSync<F extends boolean>(
   str: string,
   inputOptions: {
     disableDerivesFromReferences?: boolean
     parseFeatures: F
-    encoding?: BufferEncoding
     bufferSize?: number
   },
 ): F extends true ? (GFF3Feature | GFF3Sequence)[] : GFF3Sequence[]
@@ -200,7 +174,6 @@ export function parseStringSync<D extends boolean>(
   inputOptions: {
     disableDerivesFromReferences?: boolean
     parseDirectives: D
-    encoding?: BufferEncoding
     bufferSize?: number
   },
 ): D extends true
@@ -210,7 +183,6 @@ export function parseStringSync<C extends boolean>(
   str: string,
   inputOptions: {
     parseComments: C
-    encoding?: BufferEncoding
     bufferSize?: number
   },
 ): C extends true
@@ -221,7 +193,6 @@ export function parseStringSync<S extends boolean>(
   inputOptions: {
     disableDerivesFromReferences?: boolean
     parseSequences: S
-    encoding?: BufferEncoding
     bufferSize?: number
   },
 ): S extends true ? (GFF3Feature | GFF3Sequence)[] : GFF3Feature[]
@@ -231,7 +202,6 @@ export function parseStringSync<F extends boolean, D extends boolean>(
     disableDerivesFromReferences?: boolean
     parseFeatures: F
     parseDirectives: D
-    encoding?: BufferEncoding
     bufferSize?: number
   },
 ): F extends true
@@ -247,7 +217,6 @@ export function parseStringSync<F extends boolean, C extends boolean>(
     disableDerivesFromReferences?: boolean
     parseFeatures: F
     parseComments: C
-    encoding?: BufferEncoding
     bufferSize?: number
   },
 ): F extends true
@@ -263,7 +232,6 @@ export function parseStringSync<F extends boolean, S extends boolean>(
     disableDerivesFromReferences?: boolean
     parseFeatures: F
     parseSequences: S
-    encoding?: BufferEncoding
     bufferSize?: number
   },
 ): F extends true
@@ -279,7 +247,6 @@ export function parseStringSync<D extends boolean, C extends boolean>(
     disableDerivesFromReferences?: boolean
     parseDirectives: D
     parseComments: C
-    encoding?: BufferEncoding
     bufferSize?: number
   },
 ): D extends true
@@ -295,7 +262,6 @@ export function parseStringSync<D extends boolean, S extends boolean>(
     disableDerivesFromReferences?: boolean
     parseDirectives: D
     parseSequences: S
-    encoding?: BufferEncoding
     bufferSize?: number
   },
 ): D extends true
@@ -311,7 +277,6 @@ export function parseStringSync<C extends boolean, S extends boolean>(
     disableDerivesFromReferences?: boolean
     parseComments: C
     parseSequences: S
-    encoding?: BufferEncoding
     bufferSize?: number
   },
 ): C extends true
@@ -332,7 +297,6 @@ export function parseStringSync<
     parseFeatures: F
     parseDirectives: D
     parseComments: C
-    encoding?: BufferEncoding
     bufferSize?: number
   },
 ): F extends true
@@ -361,7 +325,6 @@ export function parseStringSync<
     parseFeatures: F
     parseDirectives: D
     parseSequences: S
-    encoding?: BufferEncoding
     bufferSize?: number
   },
 ): F extends true
@@ -390,7 +353,6 @@ export function parseStringSync<
     parseFeatures: F
     parseComments: C
     parseSequences: S
-    encoding?: BufferEncoding
     bufferSize?: number
   },
 ): F extends true
@@ -419,7 +381,6 @@ export function parseStringSync<
     parseFeatures: D
     parseComments: C
     parseSequences: S
-    encoding?: BufferEncoding
     bufferSize?: number
   },
 ): D extends true
@@ -450,7 +411,6 @@ export function parseStringSync<
     parseDirectives: D
     parseComments: C
     parseSequences: S
-    encoding?: BufferEncoding
     bufferSize?: number
   },
 ): F extends true
diff --git a/test/format.test.ts b/test/format.test.ts
index 4fbf229..8fa4094 100644
--- a/test/format.test.ts
+++ b/test/format.test.ts
@@ -21,7 +21,10 @@ describe('GFF3 formatting', () => {
           )
         ).replace(/###\n/g, '') // formatSync does not insert sync marks
 
-        const items = gff.parseStringSync(inputGFF3, { parseAll: true })
+        const items = gff.parseStringSync(inputGFF3, {
+          parseComments: true,
+          parseDirectives: true,
+        })
         const resultGFF3 = gff.formatSync(items)
         expect(resultGFF3).toEqual(expectedGFF3)
       })
@@ -68,7 +71,14 @@ describe('GFF3 formatting', () => {
         await new ReadableStream(
           new FileSource(require.resolve(`./data/${file}.gff3`)),
         )
-          .pipeThrough(new TransformStream(gff.parseStream({ parseAll: true })))
+          .pipeThrough(
+            new TransformStream(
+              gff.parseStream({
+                parseComments: true,
+                parseDirectives: true,
+              }),
+            ),
+          )
           .pipeThrough(
             new TransformStream(
               gff.formatStream({ insertVersionDirective: true }),

From 088649e6daef4ac9517ba72e881d3b2fa94e30bf Mon Sep 17 00:00:00 2001
From: Garrett Stevens <stevens.garrett.j@gmail.com>
Date: Mon, 3 Apr 2023 15:53:18 -0600
Subject: [PATCH 09/17] Raise default bufferSize from 1000 to 50000

---
 README.md    | 2 +-
 src/api.ts   | 4 ++--
 src/parse.ts | 2 +-
 3 files changed, 4 insertions(+), 4 deletions(-)

diff --git a/README.md b/README.md
index b6821cb..ce7c405 100644
--- a/README.md
+++ b/README.md
@@ -313,7 +313,7 @@ Type: [boolean](https://developer.mozilla.org/docs/Web/JavaScript/Reference/Glob
 
 #### bufferSize
 
-Maximum number of GFF3 lines to buffer, default 1000
+Maximum number of GFF3 lines to buffer, default 50000
 
 Type: [number](https://developer.mozilla.org/docs/Web/JavaScript/Reference/Global_Objects/Number)
 
diff --git a/src/api.ts b/src/api.ts
index 2e1f525..50abe01 100644
--- a/src/api.ts
+++ b/src/api.ts
@@ -21,7 +21,7 @@ export interface ParseOptions {
   parseComments?: boolean
   /** Whether to parse sequences, default true */
   parseSequences?: boolean
-  /** Maximum number of GFF3 lines to buffer, default 1000 */
+  /** Maximum number of GFF3 lines to buffer, default 50000 */
   bufferSize?: number
 }
 
@@ -34,7 +34,7 @@ function _processParseOptions(options: ParseOptions): ParseOptionsProcessed {
     parseDirectives: false,
     parseSequences: true,
     parseComments: false,
-    bufferSize: 1000,
+    bufferSize: 50000,
     disableDerivesFromReferences: false,
     ...options,
   }
diff --git a/src/parse.ts b/src/parse.ts
index b03be50..0c790fc 100644
--- a/src/parse.ts
+++ b/src/parse.ts
@@ -93,7 +93,7 @@ export default class Parser {
       args.disableDerivesFromReferences || false
 
     // number of lines to buffer
-    this.bufferSize = args.bufferSize === undefined ? 1000 : args.bufferSize
+    this.bufferSize = args.bufferSize === undefined ? 50000 : args.bufferSize
   }
 
   addLine(line: string, callbacks: ParseCallbacks): void {

From 7f08375da97c201734d00f6791233665ce84109c Mon Sep 17 00:00:00 2001
From: Garrett Stevens <stevens.garrett.j@gmail.com>
Date: Mon, 3 Apr 2023 16:01:33 -0600
Subject: [PATCH 10/17] Remove wrapper functions

---
 README.md           | 34 +++-------------------------------
 src/api.ts          | 25 -------------------------
 test/format.test.ts | 19 ++++++++++++-------
 test/parse.test.ts  |  4 ++--
 4 files changed, 17 insertions(+), 65 deletions(-)

diff --git a/README.md b/README.md
index ce7c405..ef3223b 100644
--- a/README.md
+++ b/README.md
@@ -263,19 +263,15 @@ ACTGACTAGCTAGCATCAGCGTCGTAGCTATTATATTACGGTAGCCA`)[
   - [bufferSize](#buffersize)
 - [GFFTransformer](#gfftransformer)
   - [Parameters](#parameters)
-- [parseStream](#parsestream)
-  - [Parameters](#parameters-1)
 - [parseStringSync](#parsestringsync)
-  - [Parameters](#parameters-2)
+  - [Parameters](#parameters-1)
 - [formatSync](#formatsync)
-  - [Parameters](#parameters-3)
+  - [Parameters](#parameters-2)
 - [FormatOptions](#formatoptions)
   - [minSyncLines](#minsynclines)
   - [insertVersionDirective](#insertversiondirective)
 - [GFFFormattingTransformer](#gffformattingtransformer)
-  - [Parameters](#parameters-4)
-- [formatStream](#formatstream)
-  - [Parameters](#parameters-5)
+  - [Parameters](#parameters-3)
 
 ### ParseOptions
 
@@ -326,17 +322,6 @@ an sequence objects.
 
 - `options` **[ParseOptions](#parseoptions)** Parser options (optional, default `{}`)
 
-### parseStream
-
-Parse a stream of text data into a stream of feature, directive, comment,
-an sequence objects.
-
-#### Parameters
-
-- `options` **[ParseOptions](#parseoptions)** Parsing options (optional, default `{}`)
-
-Returns **[GFFTransformer](#gfftransformer)** stream (in objectMode) of parsed items
-
 ### parseStringSync
 
 Synchronously parse a string containing GFF3 and return an array of the
@@ -389,19 +374,6 @@ Inserts synchronization (###) marks automatically.
 
 - `options` **[FormatOptions](#formatoptions)** Formatter options (optional, default `{}`)
 
-### formatStream
-
-Format a stream of features, directives, comments and/or sequences into a
-stream of GFF3 text.
-
-Inserts synchronization (###) marks automatically.
-
-#### Parameters
-
-- `options` **[FormatOptions](#formatoptions)** parser options (optional, default `{}`)
-
-Returns **[GFFFormattingTransformer](#gffformattingtransformer)**&#x20;
-
 ## About `util`
 
 There is also a `util` module that contains super-low-level functions for dealing with lines and parts of lines.
diff --git a/src/api.ts b/src/api.ts
index 50abe01..80a3df4 100644
--- a/src/api.ts
+++ b/src/api.ts
@@ -133,17 +133,6 @@ export class GFFTransformer implements Transformer<Uint8Array, GFF3Item> {
   }
 }
 
-/**
- * Parse a stream of text data into a stream of feature, directive, comment,
- * an sequence objects.
- *
- * @param options - Parsing options
- * @returns stream (in objectMode) of parsed items
- */
-export function parseStream(options: ParseOptions = {}): GFFTransformer {
-  return new GFFTransformer(options)
-}
-
 /**
  * Synchronously parse a string containing GFF3 and return an array of the
  * parsed items.
@@ -589,17 +578,3 @@ export class GFFFormattingTransformer implements Transformer<GFF3Item, string> {
     this.haveWeEmittedData = true
   }
 }
-
-/**
- * Format a stream of features, directives, comments and/or sequences into a
- * stream of GFF3 text.
- *
- * Inserts synchronization (###) marks automatically.
- *
- * @param options - parser options
- */
-export function formatStream(
-  options: FormatOptions = {},
-): GFFFormattingTransformer {
-  return new GFFFormattingTransformer(options)
-}
diff --git a/test/format.test.ts b/test/format.test.ts
index 8fa4094..59bd0b7 100644
--- a/test/format.test.ts
+++ b/test/format.test.ts
@@ -2,7 +2,12 @@ import fsPromises from 'fs/promises'
 import { ReadableStream, WritableStream, TransformStream } from 'stream/web'
 import tmp from 'tmp-promise'
 
-import gff from '../src'
+import {
+  GFFFormattingTransformer,
+  GFFTransformer,
+  formatSync,
+  parseStringSync,
+} from '../src'
 import { FileSource, SyncFileSink } from './util'
 
 describe('GFF3 formatting', () => {
@@ -21,11 +26,11 @@ describe('GFF3 formatting', () => {
           )
         ).replace(/###\n/g, '') // formatSync does not insert sync marks
 
-        const items = gff.parseStringSync(inputGFF3, {
+        const items = parseStringSync(inputGFF3, {
           parseComments: true,
           parseDirectives: true,
         })
-        const resultGFF3 = gff.formatSync(items)
+        const resultGFF3 = formatSync(items)
         expect(resultGFF3).toEqual(expectedGFF3)
       })
 
@@ -40,14 +45,14 @@ describe('GFF3 formatting', () => {
         )
           .pipeThrough(
             new TransformStream(
-              gff.parseStream({
+              new GFFTransformer({
                 parseFeatures: true,
                 parseComments: true,
                 parseDirectives: true,
               }),
             ),
           )
-          .pipeThrough(new TransformStream(gff.formatStream()))
+          .pipeThrough(new TransformStream(new GFFFormattingTransformer()))
         const chunks: string[] = []
         const reader = stream.getReader()
         let result: ReadableStreamReadResult<string>
@@ -73,7 +78,7 @@ describe('GFF3 formatting', () => {
         )
           .pipeThrough(
             new TransformStream(
-              gff.parseStream({
+              new GFFTransformer({
                 parseComments: true,
                 parseDirectives: true,
               }),
@@ -81,7 +86,7 @@ describe('GFF3 formatting', () => {
           )
           .pipeThrough(
             new TransformStream(
-              gff.formatStream({ insertVersionDirective: true }),
+              new GFFFormattingTransformer({ insertVersionDirective: true }),
             ),
           )
           .pipeTo(new WritableStream(new SyncFileSink(tmpFile.fd)))
diff --git a/test/parse.test.ts b/test/parse.test.ts
index 7bd6d58..d1b373c 100644
--- a/test/parse.test.ts
+++ b/test/parse.test.ts
@@ -1,6 +1,6 @@
 import fsPromises from 'fs/promises'
 import { ReadableStream, TransformStream } from 'stream/web'
-import gff from '../src'
+import gff, { GFFTransformer } from '../src'
 import {
   formatFeature,
   GFF3Feature,
@@ -32,7 +32,7 @@ async function readAll(
 
   const stream = new ReadableStream(new FileSource(require.resolve(filename)))
   const transformStream = new TransformStream(
-    gff.parseStream({
+    new GFFTransformer({
       parseFeatures: true,
       parseDirectives: true,
       parseComments: true,

From 4ddd64c0bc8fba37be6987a94bb6f663c664d6a3 Mon Sep 17 00:00:00 2001
From: Garrett Stevens <stevens.garrett.j@gmail.com>
Date: Mon, 10 Apr 2023 16:30:01 -0600
Subject: [PATCH 11/17] Colocate tests

---
 jest.config.js                         |  5 +++--
 test/format.test.ts => src/api.test.ts | 16 +++++++-------
 {test => src}/parse.test.ts            | 30 +++++++++++++-------------
 test/utils.test.ts => src/util.test.ts |  4 ++--
 4 files changed, 28 insertions(+), 27 deletions(-)
 rename test/format.test.ts => src/api.test.ts (85%)
 rename {test => src}/parse.test.ts (88%)
 rename test/utils.test.ts => src/util.test.ts (97%)

diff --git a/jest.config.js b/jest.config.js
index 8cbf894..982170c 100644
--- a/jest.config.js
+++ b/jest.config.js
@@ -1,5 +1,6 @@
-/** @type {import('ts-jest/dist/types').InitialOptionsTsJest} */
+/** @type {import('ts-jest/dist/types').JestConfigWithTsJest} */
 module.exports = {
   preset: 'ts-jest',
   testEnvironment: 'node',
-};
\ No newline at end of file
+  collectCoverageFrom: ['**/src/*.ts'],
+}
diff --git a/test/format.test.ts b/src/api.test.ts
similarity index 85%
rename from test/format.test.ts
rename to src/api.test.ts
index 59bd0b7..541ee05 100644
--- a/test/format.test.ts
+++ b/src/api.test.ts
@@ -7,21 +7,21 @@ import {
   GFFTransformer,
   formatSync,
   parseStringSync,
-} from '../src'
-import { FileSource, SyncFileSink } from './util'
+} from '.'
+import { FileSource, SyncFileSink } from '../test/util'
 
 describe('GFF3 formatting', () => {
   ;['spec_eden', 'au9_scaffold_subset', 'hybrid1', 'hybrid2'].forEach(
     (file) => {
       it(`can roundtrip ${file}.gff3 with formatSync`, async () => {
         const inputGFF3 = await fsPromises.readFile(
-          require.resolve(`./data/${file}.gff3`),
+          require.resolve(`../test/data/${file}.gff3`),
           'utf8',
         )
 
         const expectedGFF3 = (
           await fsPromises.readFile(
-            require.resolve(`./data/${file}.reformatted.gff3`),
+            require.resolve(`../test/data/${file}.reformatted.gff3`),
             'utf8',
           )
         ).replace(/###\n/g, '') // formatSync does not insert sync marks
@@ -36,12 +36,12 @@ describe('GFF3 formatting', () => {
 
       it(`can roundtrip ${file}.gff3 with formatStream`, async () => {
         const expectedGFF3 = await fsPromises.readFile(
-          require.resolve(`./data/${file}.reformatted.gff3`),
+          require.resolve(`../test/data/${file}.reformatted.gff3`),
           'utf8',
         )
 
         const stream = new ReadableStream(
-          new FileSource(require.resolve(`./data/${file}.gff3`)),
+          new FileSource(require.resolve(`../test/data/${file}.gff3`)),
         )
           .pipeThrough(
             new TransformStream(
@@ -74,7 +74,7 @@ describe('GFF3 formatting', () => {
       jest.setTimeout(1000)
       await tmp.withFile(async (tmpFile) => {
         await new ReadableStream(
-          new FileSource(require.resolve(`./data/${file}.gff3`)),
+          new FileSource(require.resolve(`../test/data/${file}.gff3`)),
         )
           .pipeThrough(
             new TransformStream(
@@ -94,7 +94,7 @@ describe('GFF3 formatting', () => {
         const resultGFF3 = await fsPromises.readFile(tmpFile.path, 'utf8')
 
         const expectedGFF3 = await fsPromises.readFile(
-          require.resolve(`./data/${file}.reformatted.gff3`),
+          require.resolve(`../test/data/${file}.reformatted.gff3`),
           'utf8',
         )
 
diff --git a/test/parse.test.ts b/src/parse.test.ts
similarity index 88%
rename from test/parse.test.ts
rename to src/parse.test.ts
index d1b373c..eaa35a5 100644
--- a/test/parse.test.ts
+++ b/src/parse.test.ts
@@ -8,7 +8,7 @@ import {
   GFF3Comment,
   GFF3Sequence,
 } from '../src/util'
-import { FileSource } from './util'
+import { FileSource } from '../test/util'
 
 interface ReadAllResults {
   features: GFF3Feature[]
@@ -54,10 +54,10 @@ async function readAll(
 
 describe('GFF3 parser', () => {
   it('can parse gff3_with_syncs.gff3', async () => {
-    const stuff = await readAll('./data/gff3_with_syncs.gff3')
+    const stuff = await readAll('../test/data/gff3_with_syncs.gff3')
     const referenceResult = JSON.parse(
       await fsPromises.readFile(
-        require.resolve('./data/gff3_with_syncs.result.json'),
+        require.resolve('../test/data/gff3_with_syncs.result.json'),
         'utf8',
       ),
     )
@@ -79,17 +79,17 @@ describe('GFF3 parser', () => {
     [8, 'quantitative.gff3'],
   ].forEach(([count, filename]) => {
     it(`can cursorily parse ${filename}`, async () => {
-      const stuff = await readAll(`./data/${filename}`)
+      const stuff = await readAll(`../test/data/${filename}`)
       expect(stuff.all.length).toEqual(count)
     })
   })
 
   it('supports children before parents, and Derives_from', async () => {
-    const stuff = await readAll('./data/knownGene_out_of_order.gff3')
+    const stuff = await readAll('../test/data/knownGene_out_of_order.gff3')
     // $p->max_lookback(2);
     const expectedOutput = JSON.parse(
       await fsPromises.readFile(
-        require.resolve('./data/knownGene_out_of_order.result.json'),
+        require.resolve('../test/data/knownGene_out_of_order.result.json'),
         'utf8',
       ),
     )
@@ -97,7 +97,7 @@ describe('GFF3 parser', () => {
   })
 
   it('can parse the EDEN gene from the gff3 spec', async () => {
-    const stuff = await readAll('./data/spec_eden.gff3')
+    const stuff = await readAll('../test/data/spec_eden.gff3')
     expect(stuff.all[2]).toHaveLength(1)
     const [eden] = stuff.all[2] as GFF3Feature
 
@@ -130,7 +130,7 @@ describe('GFF3 parser', () => {
 
     const referenceResult = JSON.parse(
       await fsPromises.readFile(
-        require.resolve('./data/spec_eden.result.json'),
+        require.resolve('../test/data/spec_eden.result.json'),
         'utf8',
       ),
     )
@@ -138,18 +138,18 @@ describe('GFF3 parser', () => {
   })
 
   it('can parse an excerpt of the refGene gff3', async () => {
-    const stuff = await readAll('./data/refGene_excerpt.gff3')
+    const stuff = await readAll('../test/data/refGene_excerpt.gff3')
     expect(true).toBeTruthy()
     expect(stuff.all).toHaveLength(2)
   })
 
   it('can parse an excerpt of the TAIR10 gff3', async () => {
-    const stuff = await readAll('./data/tair10.gff3')
+    const stuff = await readAll('../test/data/tair10.gff3')
     expect(stuff.all).toHaveLength(3)
   })
 
   it('can parse chr1 TAIR10 gff3', async () => {
-    const stuff = await readAll('./data/tair10_chr1.gff', {
+    const stuff = await readAll('../test/data/tair10_chr1.gff', {
       disableDerivesFromReferences: true,
     })
     expect(stuff.all).toHaveLength(17697)
@@ -159,7 +159,7 @@ describe('GFF3 parser', () => {
   ;['mm9_sample_ensembl.gff3', 'Saccharomyces_cerevisiae_EF3_e64.gff3'].forEach(
     (errorFile) => {
       it(`throws an error when parsing ${errorFile}`, async () => {
-        await expect(readAll(`./data/${errorFile}`)).rejects.toMatch(
+        await expect(readAll(`../test/data/${errorFile}`)).rejects.toMatch(
           /inconsistent types/,
         )
       })
@@ -168,7 +168,7 @@ describe('GFF3 parser', () => {
 
   it('can parse a string synchronously', async () => {
     const gff3 = await fsPromises.readFile(
-      require.resolve('./data/spec_eden.gff3'),
+      require.resolve('../test/data/spec_eden.gff3'),
       'utf8',
     )
     const result = gff.parseStringSync(gff3, {
@@ -179,7 +179,7 @@ describe('GFF3 parser', () => {
     expect(result).toHaveLength(3)
     const referenceResult = JSON.parse(
       await fsPromises.readFile(
-        require.resolve('./data/spec_eden.result.json'),
+        require.resolve('../test/data/spec_eden.result.json'),
         'utf8',
       ),
     )
@@ -290,7 +290,7 @@ SL2.40%25ch01	IT%25AG eugene	g%25e;ne	80999140	81004317	.	+	.	Alias=Solyc01g0988
     ],
   ].forEach(([filename, expectedOutput]) => {
     it(`can parse FASTA sections in hybrid ${filename} file`, async () => {
-      const stuff = await readAll(`./data/${filename}`)
+      const stuff = await readAll(`../test/data/${filename}`)
       expect(stuff.sequences).toEqual(expectedOutput)
     })
   })
diff --git a/test/utils.test.ts b/src/util.test.ts
similarity index 97%
rename from test/utils.test.ts
rename to src/util.test.ts
index 8a9f575..3a6b5f8 100644
--- a/test/utils.test.ts
+++ b/src/util.test.ts
@@ -1,5 +1,5 @@
-import gff from '../src'
-import { GFF3FeatureLine } from '../src/util'
+import gff from '.'
+import { GFF3FeatureLine } from './util'
 
 const {
   parseAttributes,

From bc8436413ad858ecec2d1eb2f64b871f3fd24376 Mon Sep 17 00:00:00 2001
From: Garrett Stevens <stevens.garrett.j@gmail.com>
Date: Tue, 11 Apr 2023 15:28:21 -0600
Subject: [PATCH 12/17] Fold FASTA lines to length 80 when formatting

---
 src/util.ts                        | 13 ++++++++++---
 test/data/hybrid1.reformatted.gff3 |  3 ++-
 2 files changed, 12 insertions(+), 4 deletions(-)

diff --git a/src/util.ts b/src/util.ts
index c899e68..2cd4c30 100644
--- a/src/util.ts
+++ b/src/util.ts
@@ -272,9 +272,16 @@ export function formatComment(comment: GFF3Comment): string {
  * @returns Formatted single FASTA sequence string
  */
 export function formatSequence(seq: GFF3Sequence): string {
-  return `>${seq.id}${seq.description ? ` ${seq.description}` : ''}\n${
-    seq.sequence
-  }\n`
+  const header = `>${seq.id}${seq.description ? ` ${seq.description}` : ''}\n`
+  // split sequence chunks into lines of length 80 for embedded FASTA
+  const lineLength = 80
+  const numChunks = Math.ceil(seq.sequence.length / lineLength)
+  const chunks = new Array(numChunks)
+  for (let i = 0; i < numChunks; i += 1) {
+    const start = i * lineLength
+    chunks[i] = seq.sequence.substring(start, start + lineLength)
+  }
+  return `${header}${chunks.join('\n')}\n`
 }
 
 function formatSingleItem(
diff --git a/test/data/hybrid1.reformatted.gff3 b/test/data/hybrid1.reformatted.gff3
index 5bd53d8..a85d6c2 100644
--- a/test/data/hybrid1.reformatted.gff3
+++ b/test/data/hybrid1.reformatted.gff3
@@ -9,6 +9,7 @@ chr17	UCSC	CDS	62469497	62469506	.	-	0	Parent=A00469
 >A00469
 GATTACAGATTACA
 >zonker
-AAAAAACTAGCATGATCGATCGATCGATCGATATTAGCATGCATGCATGATGATGATAGCTATGATCGATCCCCCCCAAAAAACTAGCATGATCGATCGATCGATCGATATTAGCATGCATGCATGATGATGATAGCTATGATCGATCCCCCCC
+AAAAAACTAGCATGATCGATCGATCGATCGATATTAGCATGCATGCATGATGATGATAGCTATGATCGATCCCCCCCAAA
+AAACTAGCATGATCGATCGATCGATCGATATTAGCATGCATGCATGATGATGATAGCTATGATCGATCCCCCCC
 >zeebo this is a test description
 AAAAACTAGTAGCTAGCTAGCTGATCATAGATCGATGCATGGCATACTGACTGATCGACCCCCC

From d2f632e02ce1630d18f5d45584b399a991eadbd5 Mon Sep 17 00:00:00 2001
From: Garrett Stevens <stevens.garrett.j@gmail.com>
Date: Mon, 10 Apr 2023 16:46:03 -0600
Subject: [PATCH 13/17] Update test imports

---
 src/api.test.ts   | 18 +++++++++---------
 src/index.ts      |  1 +
 src/parse.test.ts | 28 ++++++++++++++--------------
 src/util.test.ts  | 20 ++++++++++----------
 4 files changed, 34 insertions(+), 33 deletions(-)

diff --git a/src/api.test.ts b/src/api.test.ts
index 541ee05..f996945 100644
--- a/src/api.test.ts
+++ b/src/api.test.ts
@@ -1,26 +1,26 @@
-import fsPromises from 'fs/promises'
+import { readFile } from 'fs/promises'
 import { ReadableStream, WritableStream, TransformStream } from 'stream/web'
-import tmp from 'tmp-promise'
+import { withFile } from 'tmp-promise'
 
 import {
   GFFFormattingTransformer,
   GFFTransformer,
   formatSync,
   parseStringSync,
-} from '.'
+} from './api'
 import { FileSource, SyncFileSink } from '../test/util'
 
 describe('GFF3 formatting', () => {
   ;['spec_eden', 'au9_scaffold_subset', 'hybrid1', 'hybrid2'].forEach(
     (file) => {
       it(`can roundtrip ${file}.gff3 with formatSync`, async () => {
-        const inputGFF3 = await fsPromises.readFile(
+        const inputGFF3 = await readFile(
           require.resolve(`../test/data/${file}.gff3`),
           'utf8',
         )
 
         const expectedGFF3 = (
-          await fsPromises.readFile(
+          await readFile(
             require.resolve(`../test/data/${file}.reformatted.gff3`),
             'utf8',
           )
@@ -35,7 +35,7 @@ describe('GFF3 formatting', () => {
       })
 
       it(`can roundtrip ${file}.gff3 with formatStream`, async () => {
-        const expectedGFF3 = await fsPromises.readFile(
+        const expectedGFF3 = await readFile(
           require.resolve(`../test/data/${file}.reformatted.gff3`),
           'utf8',
         )
@@ -72,7 +72,7 @@ describe('GFF3 formatting', () => {
   ].forEach((file) => {
     it(`can roundtrip ${file}.gff3 with formatStream and insertVersionDirective`, async () => {
       jest.setTimeout(1000)
-      await tmp.withFile(async (tmpFile) => {
+      await withFile(async (tmpFile) => {
         await new ReadableStream(
           new FileSource(require.resolve(`../test/data/${file}.gff3`)),
         )
@@ -91,9 +91,9 @@ describe('GFF3 formatting', () => {
           )
           .pipeTo(new WritableStream(new SyncFileSink(tmpFile.fd)))
 
-        const resultGFF3 = await fsPromises.readFile(tmpFile.path, 'utf8')
+        const resultGFF3 = await readFile(tmpFile.path, 'utf8')
 
-        const expectedGFF3 = await fsPromises.readFile(
+        const expectedGFF3 = await readFile(
           require.resolve(`../test/data/${file}.reformatted.gff3`),
           'utf8',
         )
diff --git a/src/index.ts b/src/index.ts
index ea069a2..32e09d7 100644
--- a/src/index.ts
+++ b/src/index.ts
@@ -16,6 +16,7 @@ export type {
 } from './util'
 
 import * as util from './util'
+export { util }
 
 export const defaultExport = {
   ...api,
diff --git a/src/parse.test.ts b/src/parse.test.ts
index eaa35a5..4582c7c 100644
--- a/src/parse.test.ts
+++ b/src/parse.test.ts
@@ -1,13 +1,13 @@
-import fsPromises from 'fs/promises'
+import { readFile } from 'fs/promises'
 import { ReadableStream, TransformStream } from 'stream/web'
-import gff, { GFFTransformer } from '../src'
-import {
-  formatFeature,
+import { GFFTransformer, parseStringSync } from './api'
+import { formatFeature } from './util'
+import type {
   GFF3Feature,
-  GFF3Directive,
   GFF3Comment,
+  GFF3Directive,
   GFF3Sequence,
-} from '../src/util'
+} from './util'
 import { FileSource } from '../test/util'
 
 interface ReadAllResults {
@@ -56,7 +56,7 @@ describe('GFF3 parser', () => {
   it('can parse gff3_with_syncs.gff3', async () => {
     const stuff = await readAll('../test/data/gff3_with_syncs.gff3')
     const referenceResult = JSON.parse(
-      await fsPromises.readFile(
+      await readFile(
         require.resolve('../test/data/gff3_with_syncs.result.json'),
         'utf8',
       ),
@@ -88,7 +88,7 @@ describe('GFF3 parser', () => {
     const stuff = await readAll('../test/data/knownGene_out_of_order.gff3')
     // $p->max_lookback(2);
     const expectedOutput = JSON.parse(
-      await fsPromises.readFile(
+      await readFile(
         require.resolve('../test/data/knownGene_out_of_order.result.json'),
         'utf8',
       ),
@@ -129,7 +129,7 @@ describe('GFF3 parser', () => {
     expect(mrnaLines[2].child_features).toHaveLength(6)
 
     const referenceResult = JSON.parse(
-      await fsPromises.readFile(
+      await readFile(
         require.resolve('../test/data/spec_eden.result.json'),
         'utf8',
       ),
@@ -167,18 +167,18 @@ describe('GFF3 parser', () => {
   )
 
   it('can parse a string synchronously', async () => {
-    const gff3 = await fsPromises.readFile(
+    const gff3 = await readFile(
       require.resolve('../test/data/spec_eden.gff3'),
       'utf8',
     )
-    const result = gff.parseStringSync(gff3, {
+    const result = parseStringSync(gff3, {
       parseFeatures: true,
       parseDirectives: true,
       parseComments: true,
     })
     expect(result).toHaveLength(3)
     const referenceResult = JSON.parse(
-      await fsPromises.readFile(
+      await readFile(
         require.resolve('../test/data/spec_eden.result.json'),
         'utf8',
       ),
@@ -191,7 +191,7 @@ describe('GFF3 parser', () => {
 SL2.40%25ch01	IT%25AG eugene	g%25e;ne	80999140	81004317	.	+	.	 multivalue = val1,val2, val3;testing = blah
 `
 
-    const result = gff.parseStringSync(gff3, {
+    const result = parseStringSync(gff3, {
       parseFeatures: true,
       parseDirectives: true,
       parseComments: true,
@@ -225,7 +225,7 @@ SL2.40%25ch01	IT%25AG eugene	g%25e;ne	80999140	81004317	.	+	.	 multivalue = val1
 SL2.40%25ch01	IT%25AG eugene	g%25e;ne	80999140	81004317	.	+	.	Alias=Solyc01g098840;ID=gene:Solyc01g098840.2;Name=Solyc01g098840.2;from_BOGAS=1;length=5178
 `
 
-    const result = gff.parseStringSync(gff3, {
+    const result = parseStringSync(gff3, {
       parseFeatures: true,
       parseDirectives: true,
       parseComments: true,
diff --git a/src/util.test.ts b/src/util.test.ts
index 3a6b5f8..68a99c6 100644
--- a/src/util.test.ts
+++ b/src/util.test.ts
@@ -1,17 +1,17 @@
-import gff from '.'
-import { GFF3FeatureLine } from './util'
-
-const {
+import {
+  escape,
+  escapeColumn,
+  formatFeature,
   parseAttributes,
   parseFeature,
   parseDirective,
-  formatFeature,
-  escapeColumn,
-} = gff.util
+  unescape,
+  GFF3FeatureLine,
+} from './util'
 
 describe('GFF3 utils', () => {
   it('can escape properly', () => {
-    expect(gff.util.escape(5)).toEqual('5')
+    expect(escape(5)).toEqual('5')
     // TODO: should add more escape tests
   })
   it('can parse a bad directive', () => {
@@ -20,8 +20,8 @@ describe('GFF3 utils', () => {
     }).not.toThrow()
   })
   it('can unescape properly', () => {
-    expect(gff.util.unescape(' ')).toEqual(' ')
-    expect(gff.util.unescape('5')).toEqual('5')
+    expect(unescape(' ')).toEqual(' ')
+    expect(unescape('5')).toEqual('5')
     // TODO: should add more unescape tests
   })
   const attributeCases: [string, Record<string, string[]>][] = [

From 53b4a44199528e24f975e42c4689161e4ab1c5a0 Mon Sep 17 00:00:00 2001
From: Garrett Stevens <stevens.garrett.j@gmail.com>
Date: Tue, 11 Apr 2023 15:31:23 -0600
Subject: [PATCH 14/17] Use decode/encodeURIComponent for (un)escape

---
 src/util.ts | 13 +++++--------
 1 file changed, 5 insertions(+), 8 deletions(-)

diff --git a/src/util.ts b/src/util.ts
index 2cd4c30..26cc17c 100644
--- a/src/util.ts
+++ b/src/util.ts
@@ -8,15 +8,12 @@
  * @returns An unescaped string value
  */
 export function unescape(stringVal: string): string {
-  return stringVal.replace(/%([0-9A-Fa-f]{2})/g, (_match, seq) =>
-    String.fromCharCode(parseInt(seq, 16)),
-  )
+  return decodeURIComponent(stringVal)
 }
 
 function _escape(regex: RegExp, s: string | number) {
-  return String(s).replace(regex, (ch) => {
-    const hex = ch.charCodeAt(0).toString(16).toUpperCase().padStart(2, '0')
-    return `%${hex}`
+  return String(s).replaceAll(regex, (ch) => {
+    return encodeURIComponent(ch).toUpperCase()
   })
 }
 
@@ -27,7 +24,7 @@ function _escape(regex: RegExp, s: string | number) {
  * @returns An escaped string value
  */
 export function escape(rawVal: string | number): string {
-  return _escape(/[\n;\r\t=%&,\x00-\x1f\x7f-\xff]/g, rawVal)
+  return _escape(/[\n;\r\t=%&,\x00-\x1f\x7f]/g, rawVal)
 }
 
 /**
@@ -37,7 +34,7 @@ export function escape(rawVal: string | number): string {
  * @returns An escaped column value
  */
 export function escapeColumn(rawVal: string | number): string {
-  return _escape(/[\n\r\t%\x00-\x1f\x7f-\xff]/g, rawVal)
+  return _escape(/[\n\r\t%\x00-\x1f\x7f]/g, rawVal)
 }
 
 /**

From 53fbd01aa4e34fdfa7166393f18ae0083f279f42 Mon Sep 17 00:00:00 2001
From: Garrett Stevens <stevens.garrett.j@gmail.com>
Date: Tue, 11 Apr 2023 15:32:10 -0600
Subject: [PATCH 15/17] Util fixes and more thorough tests

---
 src/util.test.ts | 494 ++++++++++++++++++++++++++++++++++++++++-------
 src/util.ts      |  30 ++-
 2 files changed, 438 insertions(+), 86 deletions(-)

diff --git a/src/util.test.ts b/src/util.test.ts
index 68a99c6..39a1c22 100644
--- a/src/util.test.ts
+++ b/src/util.test.ts
@@ -1,99 +1,453 @@
 import {
   escape,
   escapeColumn,
+  formatAttributes,
+  formatComment,
+  formatDirective,
   formatFeature,
+  formatItem,
+  formatSequence,
   parseAttributes,
-  parseFeature,
   parseDirective,
+  parseFeature,
   unescape,
-  GFF3FeatureLine,
 } from './util'
 
-describe('GFF3 utils', () => {
-  it('can escape properly', () => {
+describe('unescape(stringVal)', () => {
+  it('handles already unsecaped literals', () => {
+    expect(unescape(' ')).toEqual(' ')
+    expect(unescape('5')).toEqual('5')
+  })
+  it('handles escaped characters', () => {
+    expect(unescape('%09')).toEqual('\t')
+    expect(unescape('%09%0A%0D%25%3B%3D%26%2C')).toEqual('\t\n\r%;=&,')
+  })
+  it('unescapes everything, including spaces, mixed values, and non-specified characters.', () => {
+    expect(unescape('escaped space: "%20", unescaped space: " "')).toEqual(
+      'escaped space: " ", unescaped space: " "',
+    )
+  })
+  it('unescapes an `escape()`d string', () => {
+    const loremIpsum =
+      'value=Lorem ipsum dolor sit amet, consectetur adipiscing elit.'
+    expect(unescape(escape(loremIpsum))).toEqual(loremIpsum)
+  })
+})
+
+describe('escape(rawval)', () => {
+  it('escapes spec-specified characters', () => {
+    expect(escape('\t')).toEqual('%09')
+    expect(escape('\t\n\r%;=&,')).toEqual('%09%0A%0D%25%3B%3D%26%2C')
+  })
+  it("doesn't escape non-spec-specified characters", () => {
+    expect(escape(' ')).toEqual(' ')
     expect(escape(5)).toEqual('5')
-    // TODO: should add more escape tests
+    expect(escape('\t\t + : \n')).toEqual('%09%09 + : %0A')
   })
-  it('can parse a bad directive', () => {
+})
+
+describe('escapeColumn(rawval)', () => {
+  it('escapes spec-specified column characters', () => {
+    expect(escapeColumn('\t')).toEqual('%09')
+    expect(escape('\t\n\r%')).toEqual('%09%0A%0D%25')
+  })
+  it("doesn't escape non-spec-specified characters", () => {
+    expect(escapeColumn(' ')).toEqual(' ')
+    expect(escapeColumn(5)).toEqual('5')
+    expect(escapeColumn(';')).toEqual(';')
+    expect(escapeColumn('\t\n\r%;=&,')).toEqual('%09%0A%0D%25;=&,')
+  })
+})
+
+describe('parseAttributes(attrString)', () => {
+  it('parses a simple attribute value', () => {
+    expect(parseAttributes('foo=bar')).toEqual({ foo: ['bar'] })
+  })
+  it('parses an attribute with escaped values', () => {
+    expect(parseAttributes('ID=Beep%2Cbonk%3B+Foo')).toEqual({
+      ID: ['Beep,bonk;+Foo'],
+    })
+  })
+  it('ignores keys with no value', () => {
+    expect(parseAttributes('Target=Motif;rnd-family-27\n')).toEqual({
+      Target: ['Motif'],
+    })
+  })
+  it('parses an empty attribute', () => {
+    expect(parseAttributes('.')).toEqual({})
+  })
+})
+
+describe('parseFeature(line)', () => {
+  it('parses a line with no missing values', () => {
+    expect(
+      parseFeature(
+        'FooSeq\tbarsource\tmatch\t234\t234\t0\t+\t1\tID=Beep%2Cbonk%3B+Foo\n',
+      ),
+    ).toEqual({
+      attributes: { ID: ['Beep,bonk;+Foo'] },
+      end: 234,
+      phase: '1',
+      score: 0,
+      seq_id: 'FooSeq',
+      source: 'barsource',
+      start: 234,
+      strand: '+',
+      type: 'match',
+    })
+  })
+  it('parses a line with no values', () => {
+    expect(parseFeature('.\t.\t.\t.\t.\t.\t.\t.\t.\n')).toEqual({
+      attributes: null,
+      end: null,
+      phase: null,
+      score: null,
+      seq_id: null,
+      source: null,
+      start: null,
+      strand: null,
+      type: null,
+    })
+  })
+  it('parses a line with escaped values (excluding column 9)', () => {
+    const seq_id = 'ctgAt25%'
+    const source = 'some\nsource'
+    expect(
+      parseFeature(
+        `${escapeColumn(seq_id)}\t${escapeColumn(
+          source,
+        )}\tmatch\t300\t400\t.\t.\t.\t.\n`,
+      ),
+    ).toEqual({
+      attributes: null,
+      end: 400,
+      phase: null,
+      score: null,
+      seq_id,
+      source,
+      start: 300,
+      strand: null,
+      type: 'match',
+    })
+  })
+})
+
+describe('parseDirective(line)', () => {
+  it('parses a directive', () => {
+    expect(parseDirective('##gff-version 3\n')).toEqual({
+      directive: 'gff-version',
+      value: '3',
+    })
+  })
+  it('parses a genome-build directive', () => {
+    expect(parseDirective('##genome-build WormBase ws110\n')).toEqual({
+      directive: 'genome-build',
+      value: 'WormBase ws110',
+      source: 'WormBase',
+      buildName: 'ws110',
+    })
+  })
+  it('parses a sequence-region directive', () => {
+    expect(parseDirective('##sequence-region ctg123 1 1497228\n')).toEqual({
+      directive: 'sequence-region',
+      value: 'ctg123 1 1497228',
+      seq_id: 'ctg123',
+      start: '1',
+      end: '1497228',
+    })
+  })
+  it('return null if the line is not a directive', () => {
+    expect(
+      parseDirective(
+        'FooSeq\tbarsource\tmatch\t234\t234\t0\t+\t.\tID=Beep%2Cbonk%3B+Foo\n',
+      ),
+    ).toBeNull()
+  })
+  it("doesn't fail on a bad directive", () => {
     expect(() => {
       parseDirective('##sequence-region no_start_end_on_sequence_region')
     }).not.toThrow()
   })
-  it('can unescape properly', () => {
-    expect(unescape(' ')).toEqual(' ')
-    expect(unescape('5')).toEqual('5')
-    // TODO: should add more unescape tests
-  })
-  const attributeCases: [string, Record<string, string[]>][] = [
-    ['foo=bar', { foo: ['bar'] }],
-    ['ID=Beep%2Cbonk%3B+Foo\n', { ID: ['Beep,bonk;+Foo'] }],
-    ['Target=Motif;rnd-family-27\n', { Target: ['Motif'] }],
-  ]
-  attributeCases.forEach(([input, output]) => {
-    it(`parses attr string ${input} correctly`, () => {
-      expect(parseAttributes(input)).toEqual(output)
-    })
+})
+
+describe('formatAttributes(attrs)', () => {
+  it('formats a simple attribute value', () => {
+    expect(formatAttributes({ foo: ['bar'] })).toEqual('foo=bar')
+  })
+  it('parses an attribute with escaped values and ignores keys with no value', () => {
+    expect(formatAttributes({ ID: ['Beep,bonk;+Foo'] })).toEqual(
+      'ID=Beep%2Cbonk%3B+Foo',
+    )
   })
+  it('parses an empty attribute', () => {
+    expect(formatAttributes({})).toEqual('.')
+  })
+})
 
-  const tests: [string, GFF3FeatureLine][] = [
-    [
-      `FooSeq\tbarsource\tmatch\t234\t234\t0\t+\t.\tID=Beep%2Cbonk%3B+Foo\n`,
-      {
-        attributes: {
-          ID: ['Beep,bonk;+Foo'],
-        },
+describe('formatFeature(featureOrFeatures)', () => {
+  it('formats a single-line feature', () => {
+    expect(
+      formatFeature({
+        attributes: { ID: ['Beep,bonk;+Foo'] },
         end: 234,
-        phase: null,
+        phase: '1',
         score: 0,
         seq_id: 'FooSeq',
         source: 'barsource',
         start: 234,
         strand: '+',
         type: 'match',
-      },
-    ],
-    [
-      `${escapeColumn(
-        'Noggin,+-%Foo\tbar',
-      )}\tbarsource\tmatch\t234\t234\t0\t+\t.\t.\n`,
-      {
-        attributes: {},
-        end: 234,
-        phase: null,
-        score: 0,
-        seq_id: 'Noggin,+-%Foo\tbar',
-        source: 'barsource',
-        start: 234,
+      }),
+    ).toEqual(
+      'FooSeq\tbarsource\tmatch\t234\t234\t0\t+\t1\tID=Beep%2Cbonk%3B+Foo\n',
+    )
+  })
+  it('formats a feature with a child', () => {
+    expect(
+      formatFeature({
+        seq_id: 'ctgA',
+        source: 'est',
+        type: 'EST_match',
+        start: 1050,
+        end: 3202,
+        score: null,
         strand: '+',
-        type: 'match',
-      },
-    ],
-  ]
-  tests.forEach(([input, output]) => {
-    it(`roundtrips feature line ${input} correctly`, () => {
-      expect(parseFeature(input)).toEqual(output)
-      expect(formatFeature(output)).toEqual(input)
-      expect(formatFeature(parseFeature(input))).toEqual(input)
-      expect(parseFeature(formatFeature(output))).toEqual(output)
-    })
+        phase: null,
+        attributes: { ID: ['Match1'] },
+        child_features: [
+          [
+            {
+              seq_id: 'ctgA',
+              source: 'est',
+              type: 'match_part',
+              start: 1050,
+              end: 1500,
+              score: null,
+              strand: '+',
+              phase: null,
+              attributes: { Parent: ['Match1'] },
+              child_features: [],
+              derived_features: [],
+            },
+          ],
+        ],
+        derived_features: [],
+      }),
+    ).toEqual(
+      `ctgA\test\tEST_match\t1050\t3202\t.\t+\t.\tID=Match1
+ctgA\test\tmatch_part\t1050\t1500\t.\t+\t.\tParent=Match1
+`,
+    )
+  })
+  it('formats a feature with multiple locations', () => {
+    expect(
+      formatFeature([
+        {
+          seq_id: 'ctg123',
+          source: null,
+          type: 'CDS',
+          start: 1201,
+          end: 1500,
+          score: null,
+          strand: '+',
+          phase: '0',
+          attributes: { ID: ['cds00001'], Parent: ['mRNA00001'] },
+          child_features: [],
+          derived_features: [],
+        },
+        {
+          seq_id: 'ctg123',
+          source: null,
+          type: 'CDS',
+          start: 3000,
+          end: 3902,
+          score: null,
+          strand: '+',
+          phase: '0',
+          attributes: { ID: ['cds00001'], Parent: ['mRNA00001'] },
+          child_features: [],
+          derived_features: [],
+        },
+      ]),
+    ).toEqual(
+      `ctg123\t.\tCDS\t1201\t1500\t.\t+\t0\tID=cds00001;Parent=mRNA00001
+ctg123\t.\tCDS\t3000\t3902\t.\t+\t0\tID=cds00001;Parent=mRNA00001
+`,
+    )
+  })
+  it('formats a feature with the same child in child_features and derived_features', () => {
+    expect(
+      formatFeature([
+        {
+          seq_id: 'ctgA',
+          source: 'est',
+          type: 'parent',
+          start: 1050,
+          end: 3202,
+          score: null,
+          strand: '+',
+          phase: null,
+          attributes: { ID: ['Feature1'] },
+          child_features: [
+            [
+              {
+                seq_id: 'ctgA',
+                source: 'est',
+                type: 'child',
+                start: 1050,
+                end: 1500,
+                score: null,
+                strand: '+',
+                phase: null,
+                attributes: {
+                  Parent: ['Feature1'],
+                  Derives_from: ['Feature1'],
+                },
+                child_features: [],
+                derived_features: [],
+              },
+            ],
+          ],
+          derived_features: [
+            [
+              {
+                seq_id: 'ctgA',
+                source: 'est',
+                type: 'child',
+                start: 1050,
+                end: 1500,
+                score: null,
+                strand: '+',
+                phase: null,
+                attributes: {
+                  Parent: ['Feature1'],
+                  Derives_from: ['Feature1'],
+                },
+                child_features: [],
+                derived_features: [],
+              },
+            ],
+          ],
+        },
+      ]),
+    ).toEqual(`ctgA\test\tparent\t1050\t3202\t.\t+\t.\tID=Feature1
+ctgA\test\tchild\t1050\t1500\t.\t+\t.\tParent=Feature1;Derives_from=Feature1
+`)
+  })
+})
+
+describe('formatDirective(directive)', () => {
+  it('formats a directive', () => {
+    expect(formatDirective({ directive: 'gff-version', value: '3' })).toEqual(
+      '##gff-version 3\n',
+    )
+  })
+  it('formats a genome-build directive', () => {
+    expect(
+      formatDirective({
+        directive: 'genome-build',
+        value: 'WormBase ws110',
+        source: 'WormBase',
+        buildName: 'ws110',
+      }),
+    ).toEqual('##genome-build WormBase ws110\n')
+  })
+  it('formats a sequence-region directive', () => {
+    expect(
+      formatDirective({
+        directive: 'sequence-region',
+        value: 'ctg123 1 1497228',
+        seq_id: 'ctg123',
+        start: '1',
+        end: '1497228',
+      }),
+    ).toEqual('##sequence-region ctg123 1 1497228\n')
+  })
+})
+
+describe('formatComment(comment)', () => {
+  it('formats a comment', () => {
+    expect(formatComment({ comment: 'my comment' })).toEqual('# my comment\n')
   })
 })
 
-// is( gff3_format_attributes( undef ), '.', 'format undef attributes' );
-// is( gff3_format_attributes( {}    ), '.', 'format empty attributes' );
-// is( gff3_format_attributes( { zee => 'zoz' } ), 'zee=zoz', 'format malformed attributes' );
-// is( gff3_format_attributes( { Alias => [], ID => ['Jim'] } ), 'ID=Jim', 'skip empty attributes' );
-// is( gff3_format_attributes( { Alias => [], ID => ['Jim'], Alias => ['Bob'], fogbat => ['noggin'], '01base' => ['free'], } ), 'ID=Jim;Alias=Bob;01base=free;fogbat=noggin', 'ID is forced to be first-printed attr' );
-// is( gff3_format_attributes( { ID => 'Bob', zee => undef } ), 'ID=Bob', 'also skip undef attributes 1' );
-// is( gff3_format_attributes( { ID => 'Bob', zee => [ undef ] } ), 'ID=Bob', 'also skip undef attributes 2' );
+describe('formatSequence(seq)', () => {
+  it('formats a short sequence', () => {
+    expect(
+      formatSequence({
+        id: 'ctg123',
+        description: 'test contig',
+        sequence: 'ACTGACTAGCTAGCATCAGCGTCGTAGCTATTATATTACGGTAGCCA',
+      }),
+    ).toEqual(
+      `>ctg123 test contig
+ACTGACTAGCTAGCATCAGCGTCGTAGCTATTATATTACGGTAGCCA
+`,
+    )
+  })
+  it('formats a sequence with no description', () => {
+    expect(
+      formatSequence({
+        id: 'ctg123',
+        sequence: 'ACTGACTAGCTAGCATCAGCGTCGTAGCTATTATATTACGGTAGCCA',
+      }),
+    ).toEqual(
+      `>ctg123
+ACTGACTAGCTAGCATCAGCGTCGTAGCTATTATATTACGGTAGCCA
+`,
+    )
+  })
+  it('folds sequences longer than 80 characters', () => {
+    expect(
+      formatSequence({
+        id: 'ctg123',
+        sequence:
+          'ACTGACTAGCTAGCATCAGCGTCGTAGCTATTATATTACGGTAGCCAACTGACTAGCTAGCATCAGCGTCGTAGCTATTATATTACGGTAGCCA',
+      }),
+    ).toEqual(
+      `>ctg123
+ACTGACTAGCTAGCATCAGCGTCGTAGCTATTATATTACGGTAGCCAACTGACTAGCTAGCATCAGCGTCGTAGCTATTA
+TATTACGGTAGCCA
+`,
+    )
+  })
+})
 
-// is_deeply(
-//     gff3_parse_directive(" ## sequence-region contig12321_2.3  23,232  24,435,432"),
-//     { directive => 'sequence-region',
-//       seq_id => 'contig12321_2.3',
-//       start => 23_232,
-//       end   => 24_435_432,
-//       value => 'contig12321_2.3  23,232  24,435,432',
-//     },
-//     'gff3_parse_directive seems to work',
-// );
+describe('formatItem(itemOrItems)', () => {
+  it('formats a single item', () => {
+    expect(formatItem({ directive: 'gff-version', value: '3' })).toEqual(
+      '##gff-version 3\n',
+    )
+  })
+  it('formats an array of items', () => {
+    expect(
+      formatItem([
+        { directive: 'gff-version', value: '3' },
+        { comment: 'my comment' },
+        {
+          attributes: { ID: ['Beep,bonk;+Foo'] },
+          end: 234,
+          phase: '1',
+          score: 0,
+          seq_id: 'FooSeq',
+          source: 'barsource',
+          start: 234,
+          strand: '+',
+          type: 'match',
+          child_features: [],
+          derived_features: [],
+        },
+        {
+          id: 'ctg123',
+          description: 'test contig',
+          sequence: 'ACTGACTAGCTAGCATCAGCGTCGTAGCTATTATATTACGGTAGCCA',
+        },
+      ]),
+    ).toEqual([
+      '##gff-version 3\n',
+      '# my comment\n',
+      'FooSeq\tbarsource\tmatch\t234\t234\t0\t+\t1\tID=Beep%2Cbonk%3B+Foo\n',
+      '>ctg123 test contig\nACTGACTAGCTAGCATCAGCGTCGTAGCTATTATATTACGGTAGCCA\n',
+    ])
+  })
+})
diff --git a/src/util.ts b/src/util.ts
index 26cc17c..e897b3e 100644
--- a/src/util.ts
+++ b/src/util.ts
@@ -80,7 +80,10 @@ export function parseAttributes(attrString: string): GFF3Attributes {
  */
 export function parseFeature(line: string): GFF3FeatureLine {
   // split the line into columns and replace '.' with null in each column
-  const f = line.split('\t').map((a) => (a === '.' || a === '' ? null : a))
+  const f = line
+    .trim()
+    .split('\t')
+    .map((a) => (a === '.' || a === '' ? null : a))
 
   // unescape only the ref, source, and type columns
   const parsed: GFF3FeatureLine = {
@@ -152,17 +155,7 @@ export function parseDirective(
 export function formatAttributes(attrs: GFF3Attributes): string {
   const attrOrder: string[] = []
   Object.entries(attrs).forEach(([tag, val]) => {
-    if (!val) return
-    let valstring
-    if (val.hasOwnProperty('toString')) {
-      valstring = escape(val.toString())
-      // } else if (Array.isArray(val.values)) {
-      //   valstring = val.values.map(escape).join(',')
-    } else if (Array.isArray(val)) {
-      valstring = val.map(escape).join(',')
-    } else {
-      valstring = escape(val)
-    }
+    const valstring = val.map(escape).join(',')
     attrOrder.push(`${escape(tag)}=${valstring}`)
   })
   return attrOrder.length ? attrOrder.join(';') : '.'
@@ -324,7 +317,7 @@ export function formatItem(
 }
 
 /** A record of GFF3 attribute identifiers and the values of those identifiers */
-export type GFF3Attributes = Record<string, string[] | undefined>
+export type GFF3Attributes = Record<string, string[]>
 
 /** A representation of a single line of a GFF3 file */
 export interface GFF3FeatureLine {
@@ -374,7 +367,7 @@ function _isFeatureLineWithRefs(
 export type GFF3Feature = GFF3FeatureLineWithRefs[]
 
 /** A GFF3 directive */
-export interface GFF3Directive {
+export interface BaseGFF3Directive {
   /** The name of the directive */
   directive: string
   /** The string value of the directive */
@@ -382,7 +375,7 @@ export interface GFF3Directive {
 }
 
 /** A GFF3 sequence-region directive */
-export interface GFF3SequenceRegionDirective extends GFF3Directive {
+export interface GFF3SequenceRegionDirective extends BaseGFF3Directive {
   /** The string value of the directive */
   value: string
   /** The sequence ID parsed from the directive */
@@ -394,7 +387,7 @@ export interface GFF3SequenceRegionDirective extends GFF3Directive {
 }
 
 /** A GFF3 genome-build directive */
-export interface GFF3GenomeBuildDirective extends GFF3Directive {
+export interface GFF3GenomeBuildDirective extends BaseGFF3Directive {
   /** The string value of the directive */
   value: string
   /** The genome build source parsed from the directive */
@@ -403,6 +396,11 @@ export interface GFF3GenomeBuildDirective extends GFF3Directive {
   buildName: string
 }
 
+export type GFF3Directive =
+  | BaseGFF3Directive
+  | GFF3SequenceRegionDirective
+  | GFF3GenomeBuildDirective
+
 /** A GFF3 comment */
 export interface GFF3Comment {
   /** The text of the comment */

From 549bd9fa7fe6741f992cf93c49c48d42080d01ca Mon Sep 17 00:00:00 2001
From: Garrett Stevens <stevens.garrett.j@gmail.com>
Date: Tue, 11 Apr 2023 15:33:47 -0600
Subject: [PATCH 16/17] Add a comment to one of the test GFF3s

---
 src/parse.test.ts                  | 2 +-
 test/data/hybrid1.gff3             | 1 +
 test/data/hybrid1.reformatted.gff3 | 1 +
 3 files changed, 3 insertions(+), 1 deletion(-)

diff --git a/src/parse.test.ts b/src/parse.test.ts
index 4582c7c..e8effed 100644
--- a/src/parse.test.ts
+++ b/src/parse.test.ts
@@ -69,7 +69,7 @@ describe('GFF3 parser', () => {
     [51, 'au9_scaffold_subset.gff3'],
     [14, 'tomato_chr4_head.gff3'],
     [5, 'directives.gff3'],
-    [5, 'hybrid1.gff3'],
+    [6, 'hybrid1.gff3'],
     [3, 'hybrid2.gff3'],
     [6, 'knownGene.gff3'],
     [6, 'knownGene2.gff3'],
diff --git a/test/data/hybrid1.gff3 b/test/data/hybrid1.gff3
index 7995cde..9927e9d 100644
--- a/test/data/hybrid1.gff3
+++ b/test/data/hybrid1.gff3
@@ -1,4 +1,5 @@
 ##gff-version 3
+# This is a comment
 chr17	UCSC	mRNA	62467934	62469545	.	-	.	ID=A00469;Dbxref=AFFX-U133:205840_x_at,Locuslink:2688,Genbank-mRNA:A00469,Swissprot:P01241,PFAM:PF00103,AFFX-U95:1332_f_at,Swissprot:SOMA_HUMAN;Note=growth%20hormone%201;Alias=GH1
 chr17	UCSC	CDS	62468039	62468236	.	-	1	Parent=A00469
 chr17	UCSC	CDS	62468490	62468654	.	-	2	Parent=A00469
diff --git a/test/data/hybrid1.reformatted.gff3 b/test/data/hybrid1.reformatted.gff3
index a85d6c2..230e648 100644
--- a/test/data/hybrid1.reformatted.gff3
+++ b/test/data/hybrid1.reformatted.gff3
@@ -1,4 +1,5 @@
 ##gff-version 3
+# This is a comment
 chr17	UCSC	mRNA	62467934	62469545	.	-	.	ID=A00469;Dbxref=AFFX-U133:205840_x_at,Locuslink:2688,Genbank-mRNA:A00469,Swissprot:P01241,PFAM:PF00103,AFFX-U95:1332_f_at,Swissprot:SOMA_HUMAN;Note=growth hormone 1;Alias=GH1
 chr17	UCSC	CDS	62468039	62468236	.	-	1	Parent=A00469
 chr17	UCSC	CDS	62468490	62468654	.	-	2	Parent=A00469

From 226a50a14429591816b6c95a742066a6ea3fc0ae Mon Sep 17 00:00:00 2001
From: Garrett Stevens <stevens.garrett.j@gmail.com>
Date: Tue, 11 Apr 2023 15:34:38 -0600
Subject: [PATCH 17/17] Standardize imports

---
 src/api.ts   | 11 ++++++-----
 src/parse.ts | 47 +++++++++++++++++++++++++++--------------------
 2 files changed, 33 insertions(+), 25 deletions(-)

diff --git a/src/api.ts b/src/api.ts
index 80a3df4..d81dfa7 100644
--- a/src/api.ts
+++ b/src/api.ts
@@ -1,4 +1,4 @@
-import Parser, { ParseCallbacks } from './parse'
+import { GFF3Parser, ParseCallbacks } from './parse'
 import {
   formatItem,
   formatSequence,
@@ -48,7 +48,7 @@ function _processParseOptions(options: ParseOptions): ParseOptionsProcessed {
  */
 export class GFFTransformer implements Transformer<Uint8Array, GFF3Item> {
   private decoder: TextDecoder
-  private parser: Parser
+  private parser: GFF3Parser
   private lastString = ''
   private parseFeatures: boolean
   private parseDirectives: boolean
@@ -63,7 +63,7 @@ export class GFFTransformer implements Transformer<Uint8Array, GFF3Item> {
     this.decoder = new TextDecoder()
     const processedOptions = _processParseOptions(options)
     const { bufferSize, disableDerivesFromReferences } = processedOptions
-    this.parser = new Parser({ bufferSize, disableDerivesFromReferences })
+    this.parser = new GFF3Parser({ bufferSize, disableDerivesFromReferences })
     this.parseFeatures = processedOptions.parseFeatures
     this.parseDirectives = processedOptions.parseDirectives
     this.parseComments = processedOptions.parseComments
@@ -462,7 +462,7 @@ export function parseStringSync(
     callbacks.sequenceCallback = push
   }
 
-  const parser = new Parser({
+  const parser = new GFF3Parser({
     disableDerivesFromReferences: options.disableDerivesFromReferences || false,
     bufferSize: Infinity,
   })
@@ -532,7 +532,8 @@ export class GFFFormattingTransformer implements Transformer<GFF3Item, string> {
    */
   constructor(options: FormatOptions = {}) {
     this.minLinesBetweenSyncMarks = options.minSyncLines || 100
-    this.insertVersionDirective = options.insertVersionDirective || true
+    this.insertVersionDirective =
+      options.insertVersionDirective === false ? false : true
   }
 
   transform(
diff --git a/src/parse.ts b/src/parse.ts
index 0c790fc..0f0cc86 100644
--- a/src/parse.ts
+++ b/src/parse.ts
@@ -1,4 +1,12 @@
-import * as GFF3 from './util'
+import {
+  parseDirective,
+  parseFeature,
+  GFF3Feature,
+  GFF3FeatureLineWithRefs,
+  GFF3Comment,
+  GFF3Directive,
+  GFF3Sequence,
+} from './util'
 
 const containerAttributes = {
   Parent: 'child_features' as const,
@@ -6,11 +14,11 @@ const containerAttributes = {
 }
 
 export interface ParseCallbacks {
-  featureCallback?(feature: GFF3.GFF3Feature): void
-  commentCallback?(comment: GFF3.GFF3Comment): void
+  featureCallback?(feature: GFF3Feature): void
+  commentCallback?(comment: GFF3Comment): void
   errorCallback?(error: string): void
-  directiveCallback?(directive: GFF3.GFF3Directive): void
-  sequenceCallback?(sequence: GFF3.GFF3Sequence): void
+  directiveCallback?(directive: GFF3Directive): void
+  sequenceCallback?(sequence: GFF3Sequence): void
 }
 
 export class FASTAParser {
@@ -20,7 +28,7 @@ export class FASTAParser {
 
   constructor(
     // eslint-disable-next-line @typescript-eslint/no-empty-function
-    private seqCallback: (sequence: GFF3.GFF3Sequence) => void = () => {},
+    private seqCallback: (sequence: GFF3Sequence) => void = () => {},
   ) {
     this.currentSequence = undefined
   }
@@ -52,11 +60,11 @@ interface ParserArgs {
 }
 
 interface References {
-  Parent: GFF3.GFF3Feature[]
-  Derives_from: GFF3.GFF3Feature[]
+  Parent: GFF3Feature[]
+  Derives_from: GFF3Feature[]
 }
 
-export default class Parser {
+export class GFF3Parser {
   endCallback: () => void
   disableDerivesFromReferences: boolean
   bufferSize: number
@@ -67,10 +75,9 @@ export default class Parser {
   lineNumber = 0
   // features that we have to keep on hand for now because they might be
   // referenced by something else
-  private underConstructionTopLevel: GFF3.GFF3Feature[] = []
+  private underConstructionTopLevel: GFF3Feature[] = []
   // index of the above by ID
-  private underConstructionById: Record<string, GFF3.GFF3Feature | undefined> =
-    {}
+  private underConstructionById: Record<string, GFF3Feature | undefined> = {}
   private completedReferences: Record<
     string,
     Record<string, boolean | undefined> | undefined
@@ -125,7 +132,7 @@ export default class Parser {
         // sync directive, all forward-references are resolved.
         this.emitAllUnderConstructionFeatures(callbacks)
       } else if (hashsigns.length === 2) {
-        const directive = GFF3.parseDirective(line)
+        const directive = parseDirective(line)
         if (directive) {
           if (directive.directive === 'FASTA') {
             this.emitAllUnderConstructionFeatures(callbacks)
@@ -161,7 +168,7 @@ export default class Parser {
   }
 
   private emitItem(
-    i: GFF3.GFF3Feature | GFF3.GFF3Directive | GFF3.GFF3Comment,
+    i: GFF3Feature | GFF3Directive | GFF3Comment,
     callbacks: ParseCallbacks,
   ) {
     if (Array.isArray(i) && callbacks.featureCallback)
@@ -176,7 +183,7 @@ export default class Parser {
     additionalItemCount = 0,
     callbacks: ParseCallbacks,
   ) {
-    const _unbufferItem = (item?: GFF3.GFF3Feature) => {
+    const _unbufferItem = (item?: GFF3Feature) => {
       if (
         item &&
         Array.isArray(item) &&
@@ -236,8 +243,8 @@ export default class Parser {
 
   // do the right thing with a newly-parsed feature line
   private bufferLine(line: string, callbacks: ParseCallbacks) {
-    const rawFeatureLine = GFF3.parseFeature(line)
-    const featureLine: GFF3.GFF3FeatureLineWithRefs = {
+    const rawFeatureLine = parseFeature(line)
+    const featureLine: GFF3FeatureLineWithRefs = {
       ...rawFeatureLine,
       child_features: [],
       derived_features: [],
@@ -257,7 +264,7 @@ export default class Parser {
       return
     }
 
-    let feature: GFF3.GFF3Feature | undefined = undefined
+    let feature: GFF3Feature | undefined = undefined
     ids.forEach((id) => {
       const existing = this.underConstructionById[id]
       if (existing) {
@@ -296,7 +303,7 @@ export default class Parser {
     )
   }
 
-  private resolveReferencesTo(feature: GFF3.GFF3Feature, id: string) {
+  private resolveReferencesTo(feature: GFF3Feature, id: string) {
     const references = this.underConstructionOrphans.get(id)
     //   references is of the form
     //   {
@@ -335,7 +342,7 @@ export default class Parser {
   }
 
   private resolveReferencesFrom(
-    feature: GFF3.GFF3Feature,
+    feature: GFF3Feature,
     references: { Parent: string[]; Derives_from: string[] },
     ids: string[],
   ) {