You signed in with another tab or window. Reload to refresh your session.You signed out in another tab or window. Reload to refresh your session.You switched accounts on another tab or window. Reload to refresh your session.Dismiss alert
output is: continue_trace: source type switch statement failed type: ÿ
Occurs with master branch and SHAPE branch with no shape data. Completes successfully with SHAPE data. I could post the structures some of the SHAPE ones predict if that would be useful but it's likely different.
On Compute Canada's Cedar, it took 30.5 hours and used 34 GB before failing.
The successful SHAPE run only took 30 hours and used 29 GB.
output is: continue_trace: source type switch statement failed type: ÿ
Occurs with master branch and SHAPE branch with no shape data. Completes successfully with SHAPE data. I could post the structures some of the SHAPE ones predict if that would be useful but it's likely different.
On Compute Canada's Cedar, it took 30.5 hours and used 34 GB before failing.
The successful SHAPE run only took 30 hours and used 29 GB.
Sequence: GGUCUCUCUGGUUAGACCAGAUCUGAGCCUGGGAGCUCUCUGGCUAACUAGGGAACCCACUGCUUAAGCCUCAAUAAAGCUUGCCUUGAGUGCUCAAAGUAGUGUGUGCCCGUCUGUUGUGUGACUCUGGUAACUAGAGAUCCCUCAGACCCUUUUAGUCAGUGUGGAAAAUCUCUAGCAGUGGCGCCCGAACAGGGACUUGAAAGCGAAAGUAAAGCCAGAGGAGAUCUCUCGACGCAGGACUCGGCUUGCUGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACUGGUGAGUACGCCAAAAAUUUUGACUAGCGGAGGCUAGAAGGAGAGAGAUGGGUGCGAGAGCGUCGGUAUUAAGCGGGGGAGAAUUAGAUAAAUGGGAAAAAAUUCGGUUAAGGCCAGGGGGAAAGAAACAAUAUAAACUAAAACAUAUAGUAUGGGCAAGCAGGGAGCUAGAACGAUUCGCAGUUAAUCCUGGCCUUUUAGAGACAUCAGAA
The text was updated successfully, but these errors were encountered: