New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Jump to bottom

How to include gene descriptions ? #49

Open

tseemann opened this issue May 13, 2019 · 0 comments

tseemann commented May 13, 2019 •

edited

Loading

Any chance you could add the gene 'Description` to the output Degust table?

eg.

>ENST00000390463.3 cdna chromosome:GRCh38:14:22226746:22227254:1 
gene:ENSG00000211815.3 gene_biotype:TR_V_gene transcript_biotype:TR_V_gene
gene_symbol:TRAV36DV7 
description:T cell receptor alpha variable 36/delta variable 7 [Source:HGNC Symbol;Acc:HGNC:12135]
ACTTGATAACTGAAGGATGATGAAGTGTCCACAGGCTTTACTAGCTATCTTTTGGCTTCT
ACTGAGCTGGGTGAGCAGTGAAGACAAGGTGGTACAAAGCCCTCTATCTCTGGTTGTCCA

The text was updated successfully, but these errors were encountered:

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment