We read every piece of feedback, and take your input very seriously.
To see all available qualifiers, see our documentation.
Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.
By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.
Already on GitHub? Sign in to your account
Hi, I'm trying to use tagdust on the simplest toy example I can imagine, but always get a core dump result. Can you tell me what I'm doing wrong ?
Thank you.
Command: ./tagdust -1 B:AACGCTTC -2 R:N sample.fasta -o test
./tagdust -1 B:AACGCTTC -2 R:N sample.fasta -o test
Input sequences (sample.fasta):
>M00234:812:000000000-J36YP:1:1102:17688:2041 1:N:0:GAGTGG AAAACGCTTCCTTCCGGTACACTTACCATGTTACGACTTGTCTCCTCTATATAAATGCGTAGGGGTTTTAGTTAAATGTCCTTTGAAGTATACTTGAGGAGAGTGACGGGCGGTGTGAAGCGTTG
As you can see, the barcode is present at the 3rd position of the input sequence. But I got this error:
$ ./tagdust -1 B:AACGCTTC -2 R:N sample.fasta -o test [2020-05-22 12:08:27] Tagdust 2.32, Copyright (C) 2013-2019 Timo Lassmann <[email protected]> [2020-05-22 12:08:27] cmd: ./tagdust -1 B:AACGCTTC -2 R:N -o test /home/ben/Dropbox/SPYGEN/DEMUX_TESTS/vsearc_merged_sample.fasta [2020-05-22 12:08:27] Start Run -------------------------------------------------- [2020-05-22 12:08:27] Determining threshold for read0. [2020-05-22 12:08:39] Long sequence found. Need to realloc model... [2020-05-22 12:09:13] Selected Threshold:: 0.513514 Segmentation fault (core dumped)
The text was updated successfully, but these errors were encountered:
No branches or pull requests
Hi,
I'm trying to use tagdust on the simplest toy example I can imagine, but always get a core dump result.
Can you tell me what I'm doing wrong ?
Thank you.
Command:
./tagdust -1 B:AACGCTTC -2 R:N sample.fasta -o test
Input sequences (sample.fasta):
As you can see, the barcode is present at the 3rd position of the input sequence.
But I got this error:
The text was updated successfully, but these errors were encountered: