diff --git a/_template/exercise_slug_test.sh b/_template/exercise_slug_test.sh
index f029efa8..9fba7f86 100755
--- a/_template/exercise_slug_test.sh
+++ b/_template/exercise_slug_test.sh
@@ -1,14 +1,14 @@
 #!/usr/bin/env bats
 
 @test "Test name - first test shouldn't be skipped" {
-  #skip
+  #[[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash exercise_slug.sh
   [ "$status" -eq 0 ]
   [ "$output" = "What's expected" ]
 }
 
 @test "Second test onwards should be skipped" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash exercise_slug.sh
   [ "$status" -eq 0 ]
   [ "$output" = "What's expected" ]
diff --git a/bin/validate_exercises b/bin/validate_exercises
index c5dbf4d8..00e47f7c 100755
--- a/bin/validate_exercises
+++ b/bin/validate_exercises
@@ -27,11 +27,8 @@ for exercise in *; do
   # Create implementation file from example
   cp example.sh ${exercise_name}.sh
 
-  # Unskip all the tests
-  sed -i 's/skip/# skip/g' $test_file
-
   # Run the tests
-  bats $test_file
+  BATS_RUN_SKIPPED=true bats $test_file
 
   cd ../
 done
diff --git a/config/exercise_readme.go.tmpl b/config/exercise_readme.go.tmpl
index 0085ee31..f6897790 100644
--- a/config/exercise_readme.go.tmpl
+++ b/config/exercise_readme.go.tmpl
@@ -11,7 +11,13 @@ Run the tests with:
 bats {{ .Spec.SnakeCaseName }}_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
+
+To run all tests, including the ones with `skip` annotations, run:
+
+```bash
+BATS_RUN_SKIPPED=true bats {{ .Spec.SnakeCaseName }}_test.sh
+```
 
 {{ with .Spec.Credits -}}
 ## Source
diff --git a/exercises/acronym/acronym_test.sh b/exercises/acronym/acronym_test.sh
index 031dfa5e..67f1cbe5 100644
--- a/exercises/acronym/acronym_test.sh
+++ b/exercises/acronym/acronym_test.sh
@@ -1,42 +1,42 @@
 #!/usr/bin/env bash
 
 @test 'basic' {
-  #skip
+  #[[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash acronym.sh 'Portable Network Graphics'
   [ "$status" -eq 0 ]
   [ "$output" == 'PNG' ]
 }
 
 @test 'lowercase words' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash acronym.sh 'Ruby on Rails'
   [ "$status" -eq 0 ]
   [ "$output" == 'ROR' ]
 }
 
 @test 'punctuation' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash acronym.sh 'First In, First Out'
   [ "$status" -eq 0 ]
   [ "$output" == 'FIFO' ]
 }
 
 @test 'all caps word' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash acronym.sh 'GNU Image Manipulation Program'
   [ "$status" -eq 0 ]
   [ "$output" == 'GIMP' ]
 }
 
 @test 'punctuation without whitespace' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash acronym.sh 'Complementary metal-oxide semiconductor'
   [ "$status" -eq 0 ]
   [ "$output" == 'CMOS' ]
 }
 
 @test 'very long abbreviation' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash acronym.sh 'Rolling On The Floor Laughing So Hard That My Dogs Came Over And Licked Me'
   [ "$status" -eq 0 ]
   [ "$output" == 'ROTFLSHTMDCOALM' ]
diff --git a/exercises/affine-cipher/affine_cipher_test.sh b/exercises/affine-cipher/affine_cipher_test.sh
index 4c785782..f61b330c 100644
--- a/exercises/affine-cipher/affine_cipher_test.sh
+++ b/exercises/affine-cipher/affine_cipher_test.sh
@@ -3,63 +3,63 @@
 # encode
 
  @test "encode yes" {
-  #skip
+  #[[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash affine_cipher.sh encode 5 7 "yes"
   [ "$status" -eq 0 ]
   [ "$output" == "xbt" ]
 }
 
  @test "encode no" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash affine_cipher.sh encode 15 18 "no"
   [ "$status" -eq 0 ]
   [ "$output" == "fu" ]
 }
 
  @test "encode OMG" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash affine_cipher.sh encode 21 3 "OMG"
   [ "$status" -eq 0 ]
   [ "$output" == "lvz" ]
 }
 
  @test "encode O M G" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash affine_cipher.sh encode 25 47 "O M G"
   [ "$status" -eq 0 ]
   [ "$output" == "hjp" ]
 }
 
  @test "encode mindblowingly" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash affine_cipher.sh encode 11 15 "mindblowingly"
   [ "$status" -eq 0 ]
   [ "$output" == "rzcwa gnxzc dgt" ]
 }
 
  @test "encode numbers" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash affine_cipher.sh encode 3 4 "Testing,1 2 3, testing."
   [ "$status" -eq 0 ]
   [ "$output" == "jqgjc rw123 jqgjc rw" ]
 }
 
  @test "encode deep thought" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash affine_cipher.sh encode 5 17 "Truth is fiction."
   [ "$status" -eq 0 ]
   [ "$output" == "iynia fdqfb ifje" ]
 }
 
  @test "encode all the letters" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash affine_cipher.sh encode 17 33 "The quick brown fox jumps over the lazy dog."
   [ "$status" -eq 0 ]
   [ "$output" == "swxtj npvyk lruol iejdc blaxk swxmh qzglf" ]
 }
 
  @test "encode with a not coprime to m" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash affine_cipher.sh encode 6 17 "This is a test."
   [ "$status" -eq 1 ]
   [ "$output" == "a and m must be coprime." ]
@@ -68,49 +68,49 @@
 # decode
 
  @test "decode exercism" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash affine_cipher.sh decode 3 7 "tytgn fjr"
   [ "$status" -eq 0 ]
   [ "$output" == "exercism" ]
 }
 
  @test "decode a sentence" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash affine_cipher.sh decode 19 16 "qdwju nqcro muwhn odqun oppmd aunwd o"
   [ "$status" -eq 0 ]
   [ "$output" == "anobstacleisoftenasteppingstone" ]
 }
 
  @test "decode numbers" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash affine_cipher.sh decode 25 7 "odpoz ub123 odpoz ub"
   [ "$status" -eq 0 ]
   [ "$output" == "testing123testing" ]
 }
 
  @test "decode all the letters" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash affine_cipher.sh decode 17 33 "swxtj npvyk lruol iejdc blaxk swxmh qzglf"
   [ "$status" -eq 0 ]
   [ "$output" == "thequickbrownfoxjumpsoverthelazydog" ]
 }
 
  @test "decode with no spaces in input" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash affine_cipher.sh decode 17 33 "swxtjnpvyklruoliejdcblaxkswxmhqzglf"
   [ "$status" -eq 0 ]
   [ "$output" == "thequickbrownfoxjumpsoverthelazydog" ]
 }
 
  @test "decode with too many spaces" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash affine_cipher.sh decode 15 16 "vszzm    cly   yd cg    qdp"
   [ "$status" -eq 0 ]
   [ "$output" == "jollygreengiant" ]
 }
 
  @test "decode with a not coprime to m" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash affine_cipher.sh decode 13 5 "Test"
   [ "$status" -eq 1 ]
   [ "$output" == "a and m must be coprime." ]
diff --git a/exercises/all-your-base/README.md b/exercises/all-your-base/README.md
index 4b302809..5267c34e 100644
--- a/exercises/all-your-base/README.md
+++ b/exercises/all-your-base/README.md
@@ -31,16 +31,19 @@ I think you got the idea!
 
 *Yes. Those three numbers above are exactly the same. Congratulations!*
 
-
 Run the tests with:
 
 ```bash
 bats all_your_base_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
 
+To run all tests, including the ones with `skip` annotations, run:
 
+```bash
+BATS_RUN_SKIPPED=true bats all_your_base_test.sh
+```
 
 ## External utilities
 `Bash` is a language to write scripts that works closely with various system utilities,
diff --git a/exercises/all-your-base/all_your_base_test.sh b/exercises/all-your-base/all_your_base_test.sh
index 6db3e9c1..d33904cf 100644
--- a/exercises/all-your-base/all_your_base_test.sh
+++ b/exercises/all-your-base/all_your_base_test.sh
@@ -1,147 +1,147 @@
 #!/usr/bin/env bash
 
 @test 'single_bit_to_one_decimal' {
-    #skip
+    #[[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash all_your_base.sh 2 "1" 10
     [[ "$status" -eq 0 ]]
     [[ "$output" == "1" ]]
 }
 
 @test 'binary_to_single_decimal' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash all_your_base.sh 2 "1 0 1" 10
     [[ "$status" -eq 0 ]]
     [[ "$output" == "5" ]]
 }
 
 @test 'single_decimal_to_binary' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash all_your_base.sh 10 "5" 2
     [[ "$status" -eq 0 ]]
     [[ "$output" == "1 0 1" ]]
 }
 
 @test 'binary_to_multiple_decimal' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash all_your_base.sh 2 "1 0 1 0 1 0" 10
     [[ "$status" -eq 0 ]]
     [[ "$output" == "4 2" ]]
 }
 
 @test 'decimal_to_binary' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash all_your_base.sh 10 "4 2" 2
     [[ "$status" -eq 0 ]]
     [[ "$output" == "1 0 1 0 1 0" ]]
 }
 
 @test 'trinary_to_hexadecimal' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash all_your_base.sh 3 "1 1 2 0" 16
     [[ "$status" -eq 0 ]]
     [[ "$output" == "2 10" ]]
 }
 
 @test 'hexadecimal_to_trinary' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash all_your_base.sh 16 "2 10" 3
     [[ "$status" -eq 0 ]]
     [[ "$output" == "1 1 2 0" ]]
 }
 
 @test '15_bit_integer' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash all_your_base.sh 97 "3 46 60" 73
     [[ "$status" -eq 0 ]]
     [[ "$output" == "6 10 45" ]]
 }
 
 @test 'empty_list' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash all_your_base.sh 2 "" 10
     [[ "$status" -eq 0 ]]
     [[ "$output" == "" ]]
 }
 
 @test 'single_zero' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash all_your_base.sh 10 "0" 2
     [[ "$status" -eq 0 ]]
     [[ "$output" == "" ]]
 }
 
 @test 'multiple_zeroes' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash all_your_base.sh 10 "0 0 0" 2
     [[ "$status" -eq 0 ]]
     [[ "$output" == "" ]]
 }
 
 @test 'leading_zeros' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash all_your_base.sh 7 "0 6 0" 10
     [[ "$status" -eq 0 ]]
     [[ "$output" == "4 2" ]]
 }
 
 @test 'input_base_is_one' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash all_your_base.sh 1 "0" 10
     [[ "$status" -gt 0 ]]
     [[ -n "$output" ]]
 }
 
 @test 'input_base_is_zero' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash all_your_base.sh 0 "" 10
     [[ "$status" -gt 0 ]]
     [[ -n "$output" ]]
 }
 
 @test 'input_base_is_negative' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash all_your_base.sh -2 "1" 10
     [[ "$status" -gt 0 ]]
     [[ -n "$output" ]]
 }
 
 @test 'negative_digit' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash all_your_base.sh 2 "1 -1 1 0 1 0" 10
     [[ "$status" -gt 0 ]]
     [[ -n "$output" ]]
 }
 
 @test 'invalid_positive_digit' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash all_your_base.sh 2 "1 2 1 0 1 0" 10
     [[ "$status" -gt 0 ]]
     [[ -n "$output" ]]
 }
 
 @test 'output_base_is_one' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash all_your_base.sh 2 "1 0 1 0 1 0" 1
     [[ "$status" -gt 0 ]]
     [[ -n "$output" ]]
 }
 
 @test 'output_base_is_zero' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash all_your_base.sh 10 "7" 0
     [[ "$status" -gt 0 ]]
     [[ -n "$output" ]]
 }
 
 @test 'output_base_is_negative' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash all_your_base.sh 2 "1" -7
     [[ "$status" -gt 0 ]]
     [[ -n "$output" ]]
 }
 
 @test 'both_bases_are_negative' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash all_your_base.sh -2 "1" -7
     [[ "$status" -gt 0 ]]
     [[ -n "$output" ]]
diff --git a/exercises/allergies/README.md b/exercises/allergies/README.md
index c60ef760..24af6f26 100644
--- a/exercises/allergies/README.md
+++ b/exercises/allergies/README.md
@@ -29,14 +29,19 @@ allergens that score 256, 512, 1024, etc.).  Your program should
 ignore those components of the score.  For example, if the allergy
 score is 257, your program should only report the eggs (1) allergy.
 
-
 Run the tests with:
 
 ```bash
 bats allergies_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
+
+To run all tests, including the ones with `skip` annotations, run:
+
+```bash
+BATS_RUN_SKIPPED=true bats allergies_test.sh
+```
 
 ## Source
 
diff --git a/exercises/allergies/allergies_test.sh b/exercises/allergies/allergies_test.sh
index e0169e73..64910364 100644
--- a/exercises/allergies/allergies_test.sh
+++ b/exercises/allergies/allergies_test.sh
@@ -1,7 +1,7 @@
 #!/usr/bin/env bash
 
 @test 'no_allergies_means_not_allergic' {
-    #skip
+    #[[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash allergies.sh 0 allergic_to peanuts
     [[ $status -eq 0 ]] 
     [[ $output = "false" ]]
@@ -14,14 +14,14 @@
 }
 
 @test 'is_allergic_to_eggs' {
-    skip 
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip 
     run bash allergies.sh 1 allergic_to eggs
     [[ $status -eq 0 ]]
     [[ $output = "true" ]]
 }
 
 @test 'allergic_to_eggs_in_addition_to_other_stuff' {
-    skip 
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip 
     run bash allergies.sh 5 allergic_to eggs
     [[ $status -eq 0 ]]
     [[ $output = "true" ]]
@@ -34,7 +34,7 @@
 }
 
 @test 'allergic_to_strawberries_but_not_peanuts' {
-    skip 
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip 
     run bash allergies.sh 9 allergic_to eggs
     [[ $status -eq 0 ]]
     [[ $output = "true" ]]
@@ -50,63 +50,63 @@
 }
 
 @test 'no_allergies_at_all' {
-    skip 
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip 
     run bash allergies.sh 0 list
     [[ $status -eq 0 ]]
     [[ $output == "" ]]
 }
 
 @test 'allergic_to_just_eggs' {
-    skip 
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip 
     run bash allergies.sh 1 list
     [[ $status -eq 0 ]]
     [[ $output == "eggs" ]]
 }
 
 @test 'allergic_to_just_peanuts' {
-    skip 
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip 
     run bash allergies.sh 2 list
     [[ $status -eq 0 ]]
     [[ $output == "peanuts" ]]
 }
 
 @test 'allergic_to_just_strawberries' {
-    skip 
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip 
     run bash allergies.sh 8 list
     [[ $status -eq 0 ]]
     [[ $output == "strawberries" ]]
 }
 
 @test 'allergic_to_eggs_and_peanuts' {
-    skip 
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip 
     run bash allergies.sh 3 list
     [[ $status -eq 0 ]]
     [[ $output == "eggs peanuts" ]]
 }
 
 @test 'allergic_to_more_than_eggs_but_not_peanuts' {
-    skip 
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip 
     run bash allergies.sh 5 list
     [[ $status -eq 0 ]]
     [[ $output == "eggs shellfish" ]]
 }
 
 @test 'allergic_to_lots_of_stuff' {
-    skip 
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip 
     run bash allergies.sh 248 list
     [[ $status -eq 0 ]]
     [[ $output == "strawberries tomatoes chocolate pollen cats" ]]
 }
 
 @test 'allergic_to_everything' {
-    skip 
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip 
     run bash allergies.sh 255 list
     [[ $status -eq 0 ]]
     [[ $output == "eggs peanuts shellfish strawberries tomatoes chocolate pollen cats" ]]
 }
 
 @test 'ignore_non_allergen_score_parts' {
-    skip 
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip 
     run bash allergies.sh 509 list
     [[ $status -eq 0 ]]
     [[ $output == "eggs shellfish strawberries tomatoes chocolate pollen cats" ]]
diff --git a/exercises/anagram/anagram_test.sh b/exercises/anagram/anagram_test.sh
index 3da11f2d..94fb79e8 100755
--- a/exercises/anagram/anagram_test.sh
+++ b/exercises/anagram/anagram_test.sh
@@ -1,84 +1,84 @@
 #!/usr/bin/env bash
 
 @test "no matches" {
-  #skip
+  #[[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash anagram.sh "diaper" "hello world zombies pants"
   [ "$status" -eq 0 ]
   [ "$output" == "" ]
 }
 
 @test "detects two anagrams" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash anagram.sh "master" "stream pigeon maters"
   [ "$status" -eq 0 ]
   [ "$output" == "stream maters" ]
 }
 
 @test "does not detect anagram subsets" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash anagram.sh "good" "dog goody"
   [ "$status" -eq 0 ]
   [ "$output" == "" ]
 }
 
 @test "detects anagram" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash anagram.sh "listen" "enlists google inlets banana"
   [ "$status" -eq 0 ]
   [ "$output" == "inlets" ]
 }
 
 @test "detects three anagrams" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash anagram.sh "allergy" "gallery ballerina regally clergy largely leading"
   [ "$status" -eq 0 ]
   [ "$output" == "gallery regally largely" ]
 }
 
 @test "does not detect non-anagrams with identical checksum" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash anagram.sh "mass" "last"
   [ "$status" -eq 0 ]
   [ "$output" == "" ]
 }
 
 @test "detects anagrams case-insensitively" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash anagram.sh "Orchestra" "cashregister Carthorse radishes"
   [ "$status" -eq 0 ]
   [ "$output" == "Carthorse" ]
 }
 
 @test "detects anagrams using case-insensitive subject" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash anagram.sh "Orchestra" "cashregister carthorse radishes"
   [ "$status" -eq 0 ]
   [ "$output" == "carthorse" ]
 }
 
 @test "detects anagrams using case-insensitive possible matches" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash anagram.sh "orchestra" "cashregister Carthorse radishes"
   [ "$status" -eq 0 ]
   [ "$output" == "Carthorse" ]
 }
 
 @test "does not detect a anagram if the original word is repeated" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash anagram.sh "go" "go Go GO"
   [ "$status" -eq 0 ]
   [ "$output" == "" ]
 }
 
 @test "anagrams must use all letters exactly once" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash anagram.sh "tapper" "patter"
   [ "$status" -eq 0 ]
   [ "$output" == "" ]
 }
 
 @test "capital word is not own anagram" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash anagram.sh "BANANA" "Banana"
   [ "$status" -eq 0 ]
   [ "$output" == "" ]
diff --git a/exercises/armstrong-numbers/armstrong_numbers_test.sh b/exercises/armstrong-numbers/armstrong_numbers_test.sh
index f3624c9c..ba3d6192 100755
--- a/exercises/armstrong-numbers/armstrong_numbers_test.sh
+++ b/exercises/armstrong-numbers/armstrong_numbers_test.sh
@@ -1,7 +1,7 @@
 #!/usr/bin/env bash
 
 @test 'Single digits are Armstrong numbers' {
-  # skip
+  # [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash armstrong_numbers.sh 5
 
   [ "$status" -eq 0 ]
@@ -9,7 +9,7 @@
 }
 
 @test 'There are no two digit Armstrong numbers' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash armstrong_numbers.sh 10
 
   [ "$status" -eq 0 ]
@@ -17,7 +17,7 @@
 }
 
 @test 'A three digit number that is an Armstrong number' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash armstrong_numbers.sh 153
 
   [ "$status" -eq 0 ]
@@ -25,7 +25,7 @@
 }
 
 @test 'A three digit number that is not an Armstrong number' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash armstrong_numbers.sh 100
 
   [ "$status" -eq 0 ]
@@ -33,7 +33,7 @@
 }
 
 @test 'A four digit number that is an Armstrong number' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash armstrong_numbers.sh 9474
 
   [ "$status" -eq 0 ]
@@ -41,7 +41,7 @@
 }
 
 @test 'A four digit number that is not an Armstrong number' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash armstrong_numbers.sh 9475
 
   [ "$status" -eq 0 ]
@@ -49,7 +49,7 @@
 }
 
 @test 'A seven digit number that is an Armstrong number' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash armstrong_numbers.sh 9926315
 
   [ "$status" -eq 0 ]
@@ -57,7 +57,7 @@
 }
 
 @test 'A seven digit number that is not an Armstrong number' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash armstrong_numbers.sh 9926314
 
   [ "$status" -eq 0 ]
diff --git a/exercises/atbash-cipher/atbash_cipher_test.sh b/exercises/atbash-cipher/atbash_cipher_test.sh
index bc43c0db..fec3cb12 100644
--- a/exercises/atbash-cipher/atbash_cipher_test.sh
+++ b/exercises/atbash-cipher/atbash_cipher_test.sh
@@ -3,56 +3,56 @@
 # encode
 
 @test "encode yes" {
-  #skip
+  #[[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash atbash_cipher.sh encode "yes"
   [ "$status" -eq 0 ]
   [ "$output" == "bvh" ]
 }
 
 @test "encode no" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash atbash_cipher.sh encode "no"
   [ "$status" -eq 0 ]
   [ "$output" == "ml" ]
 }
 
 @test "encode OMG" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash atbash_cipher.sh encode "OMG"
   [ "$status" -eq 0 ]
   [ "$output" == "lnt" ]
 }
 
 @test "encode spaces" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash atbash_cipher.sh encode "O M G"
   [ "$status" -eq 0 ]
   [ "$output" == "lnt" ]
 }
 
 @test "encode mindblowingly" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash atbash_cipher.sh encode "mindblowingly"
   [ "$status" -eq 0 ]
   [ "$output" == "nrmwy oldrm tob" ]
 }
 
 @test "encode numbers" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash atbash_cipher.sh encode "Testing,1 2 3, testing."
   [ "$status" -eq 0 ]
   [ "$output" == "gvhgr mt123 gvhgr mt" ]
 }
 
 @test "encode deep thought" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash atbash_cipher.sh encode "Truth is fiction."
   [ "$status" -eq 0 ]
   [ "$output" == "gifgs rhurx grlm" ]
 }
 
 @test "encode all the letters" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash atbash_cipher.sh encode "The quick brown fox jumps over the lazy dog."
   [ "$status" -eq 0 ]
   [ "$output" == "gsvjf rxpyi ldmul cqfnk hlevi gsvoz abwlt" ]
@@ -61,42 +61,42 @@
 # decode
 
 @test "decode exercism" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash atbash_cipher.sh decode "vcvix rhn"
   [ "$status" -eq 0 ]
   [ "$output" == "exercism" ]
 }
 
 @test "decode a sentence" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash atbash_cipher.sh decode "zmlyh gzxov rhlug vmzhg vkkrm thglm v"
   [ "$status" -eq 0 ]
   [ "$output" == "anobstacleisoftenasteppingstone" ]
 }
 
 @test "decode numbers" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash atbash_cipher.sh decode "gvhgr mt123 gvhgr mt"
   [ "$status" -eq 0 ]
   [ "$output" == "testing123testing" ]
 }
 
 @test "decode all the letters" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash atbash_cipher.sh decode "gsvjf rxpyi ldmul cqfnk hlevi gsvoz abwlt"
   [ "$status" -eq 0 ]
   [ "$output" == "thequickbrownfoxjumpsoverthelazydog" ]
 }
 
 @test "decode with too many spaces" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash atbash_cipher.sh decode "vc vix    r hn"
   [ "$status" -eq 0 ]
   [ "$output" == "exercism" ]
 }
 
 @test "decode with no spaces" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash atbash_cipher.sh decode "zmlyhgzxovrhlugvmzhgvkkrmthglmv"
   [ "$status" -eq 0 ]
   [ "$output" == "anobstacleisoftenasteppingstone" ]
diff --git a/exercises/beer-song/README.md b/exercises/beer-song/README.md
index 1002c592..292bb1ef 100644
--- a/exercises/beer-song/README.md
+++ b/exercises/beer-song/README.md
@@ -320,14 +320,19 @@ are some additional things you could try:
 Then please share your thoughts in a comment on the submission. Did this
 experiment make the code better? Worse? Did you learn anything from it?
 
-
 Run the tests with:
 
 ```bash
 bats beer_song_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
+
+To run all tests, including the ones with `skip` annotations, run:
+
+```bash
+BATS_RUN_SKIPPED=true bats beer_song_test.sh
+```
 
 ## Source
 
diff --git a/exercises/beer-song/beer_song_test.sh b/exercises/beer-song/beer_song_test.sh
index 3a71a836..ff7084b3 100644
--- a/exercises/beer-song/beer_song_test.sh
+++ b/exercises/beer-song/beer_song_test.sh
@@ -1,7 +1,7 @@
 #!/usr/bin/env bash
 
 @test 'first_generic_verse' {
-    #skip
+    #[[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="99 bottles of beer on the wall, 99 bottles of beer.
 Take one down and pass it around, 98 bottles of beer on the wall."
     run bash beer_song.sh 99
@@ -10,7 +10,7 @@ Take one down and pass it around, 98 bottles of beer on the wall."
 }
 
 @test '3rd_last_generic_verse' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="3 bottles of beer on the wall, 3 bottles of beer.
 Take one down and pass it around, 2 bottles of beer on the wall."
     run bash beer_song.sh 3
@@ -19,7 +19,7 @@ Take one down and pass it around, 2 bottles of beer on the wall."
 }
 
 @test '2nd_last_generic_verse' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="2 bottles of beer on the wall, 2 bottles of beer.
 Take one down and pass it around, 1 bottle of beer on the wall."
     run bash beer_song.sh 2
@@ -28,7 +28,7 @@ Take one down and pass it around, 1 bottle of beer on the wall."
 }
 
 @test 'penultimate_verse' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="1 bottle of beer on the wall, 1 bottle of beer.
 Take it down and pass it around, no more bottles of beer on the wall."
     run bash beer_song.sh 1
@@ -37,7 +37,7 @@ Take it down and pass it around, no more bottles of beer on the wall."
 }
 
 @test 'verse_with_zero_bottles' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="No more bottles of beer on the wall, no more bottles of beer.
 Go to the store and buy some more, 99 bottles of beer on the wall."
     run bash beer_song.sh 0
@@ -46,7 +46,7 @@ Go to the store and buy some more, 99 bottles of beer on the wall."
 }
 
 @test 'first_two_verses' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="99 bottles of beer on the wall, 99 bottles of beer.
 Take one down and pass it around, 98 bottles of beer on the wall.
 
@@ -58,7 +58,7 @@ Take one down and pass it around, 97 bottles of beer on the wall."
 }
 
 @test 'last_three_verses' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
         expected="2 bottles of beer on the wall, 2 bottles of beer.
 Take one down and pass it around, 1 bottle of beer on the wall.
 
@@ -74,7 +74,7 @@ Go to the store and buy some more, 99 bottles of beer on the wall."
 }
 
 @test 'all_verses' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="99 bottles of beer on the wall, 99 bottles of beer.
 Take one down and pass it around, 98 bottles of beer on the wall.
 
@@ -381,21 +381,21 @@ Go to the store and buy some more, 99 bottles of beer on the wall."
 }
 
 @test 'no_arguments' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash beer_song.sh
     [[ $status -ne 0 ]]
     [[ $output == *"1 or 2 arguments expected"* ]]
 }
 
 @test 'too_many_arguments' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash beer_song.sh 1 2 3
     [[ $status -ne 0 ]]
     [[ $output == *"1 or 2 arguments expected"* ]]
 }
 
 @test 'wrong_order_arguments' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash beer_song.sh 1 2
     [[ $status -ne 0 ]]
     [[ $output = "Start must be greater than End" ]]
diff --git a/exercises/binary-search/README.md b/exercises/binary-search/README.md
index b74c44e7..3bf5934b 100644
--- a/exercises/binary-search/README.md
+++ b/exercises/binary-search/README.md
@@ -34,14 +34,19 @@ A binary search halves the number of items to check with each iteration,
 so locating an item (or determining its absence) takes logarithmic time.
 A binary search is a dichotomic divide and conquer search algorithm.
 
-
 Run the tests with:
 
 ```bash
 bats binary_search_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
+
+To run all tests, including the ones with `skip` annotations, run:
+
+```bash
+BATS_RUN_SKIPPED=true bats binary_search_test.sh
+```
 
 ## Source
 
diff --git a/exercises/binary-search/binary_search_test.sh b/exercises/binary-search/binary_search_test.sh
index 58bfe6a7..57765ab7 100644
--- a/exercises/binary-search/binary_search_test.sh
+++ b/exercises/binary-search/binary_search_test.sh
@@ -4,7 +4,7 @@
 # sorted. Just assume that it is.
 
 @test "finds a value in an array with one element" {
-    #skip
+    #[[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=0
     input=(6)
     run bash binary_search.sh 6 "${input[@]}"
@@ -13,7 +13,7 @@
 }
 
 @test "finds a value in the middle of an array" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=3
     input=(1 3 4 6 8 9 11)
     run bash binary_search.sh 6 "${input[@]}"
@@ -22,7 +22,7 @@
 }
 
 @test "finds a value at the beginning of an array" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=0
     input=(1 3 4 6 8 9 11)
     run bash binary_search.sh 1 "${input[@]}"
@@ -31,7 +31,7 @@
 }
 
 @test "finds a value at the end of an array" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=6
     input=(1 3 4 6 8 9 11)
     run bash binary_search.sh 11 "${input[@]}"
@@ -40,7 +40,7 @@
 }
 
 @test "finds a value in an array of odd length" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=9
     input=(1 3 5 8 13 21 34 55 89 144 233 377 634)
     run bash binary_search.sh 144 "${input[@]}"
@@ -49,7 +49,7 @@
 }
 
 @test "finds a value in an array of even length" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=5
     input=(1 3 5 8 13 21 34 55 89 144 233 377)
     run bash binary_search.sh 21 "${input[@]}"
@@ -60,7 +60,7 @@
 # error cases
 
 @test "identifies that a value is not included in the array" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="-1"
     input=(1 3 4 6 8 9 11)
     run bash binary_search.sh 7 "${input[@]}"
@@ -69,7 +69,7 @@
 }
 
 @test "a value smaller than the array's smallest value is not found" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="-1"
     input=(1 3 4 6 8 9 11)
     run bash binary_search.sh 0 "${input[@]}"
@@ -78,7 +78,7 @@
 }
 
 @test "a value larger than the array's largest value is not found" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="-1"
     input=(1 3 4 6 8 9 11)
     run bash binary_search.sh 13 "${input[@]}"
@@ -87,7 +87,7 @@
 }
 
 @test "nothing is found in an empty array" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="-1"
     input=()
     run bash binary_search.sh 1 "${input[@]}"
@@ -96,7 +96,7 @@
 }
 
 @test "nothing is found when the left and right bounds cross" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="-1"
     input=(1 2)
     run bash binary_search.sh 0 "${input[@]}"
diff --git a/exercises/bob/bob_test.sh b/exercises/bob/bob_test.sh
index 76805265..87224378 100755
--- a/exercises/bob/bob_test.sh
+++ b/exercises/bob/bob_test.sh
@@ -1,182 +1,182 @@
 #!/usr/bin/env bash
 
 @test "stating something" {
-  #skip
+  #[[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash bob.sh 'Tom-ay-to, tom-aaaah-to.'
   [ "$status" -eq 0 ]
   [ "$output" == "Whatever." ]
 }
 
 @test "shouting" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash bob.sh 'WATCH OUT!'
   [ "$status" -eq 0 ]
   [ "$output" == "Whoa, chill out!" ]
 }
 
 @test "shouting gibberish" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash bob.sh 'FCECDFCAAB'
   [ "$status" -eq 0 ]
   [ "$output" == "Whoa, chill out!" ]
 }
 
 @test "asking a question" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash bob.sh 'Does this cryogenic chamber make me look fat?'
   [ "$status" -eq 0 ]
   [ "$output" == "Sure." ]
 }
 
 @test "asking a numeric question" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash bob.sh 'You are, what, like 15?'
   [ "$status" -eq 0 ]
   [ "$output" == "Sure." ]
 }
 
 @test "asking gibberish" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash bob.sh 'fffbbcbeab?'
   [ "$status" -eq 0 ]
   [ "$output" == "Sure." ]
 }
 
 @test "talking forcefully" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash bob.sh "Let's go make out behind the gym!"
   [ "$status" -eq 0 ]
   [ "$output" == "Whatever." ]
 }
 
 @test "using acronyms in regular speech" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash bob.sh "It's OK if you don't want to go to the DMV."
   [ "$status" -eq 0 ]
   [ "$output" == "Whatever." ]
 }
 
 @test "forceful question" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash bob.sh 'WHAT THE HELL WERE YOU THINKING?'
   [ "$status" -eq 0 ]
   [ "$output" == "Calm down, I know what I'm doing!" ]
 }
 
 @test "shouting numbers" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash bob.sh '1, 2, 3 GO!'
   [ "$status" -eq 0 ]
   [ "$output" == "Whoa, chill out!" ]
 }
 
 @test "no letters" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash bob.sh '1, 2, 3'
   [ "$status" -eq 0 ]
   [ "$output" == "Whatever." ]
 }
 
 @test "question with no letters" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash bob.sh '4?'
   [ "$status" -eq 0 ]
   [ "$output" == "Sure." ]
 }
 
 @test "shouting with special characters" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash bob.sh 'ZOMG THE %^*@#$(*^ ZOMBIES ARE COMING!!11!!1!'
   [ "$status" -eq 0 ]
   [ "$output" == "Whoa, chill out!" ]
 }
 
 @test "shouting with no exclamation mark" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash bob.sh 'I HATE THE DMV'
   [ "$status" -eq 0 ]
   [ "$output" == "Whoa, chill out!" ]
 }
 
 @test "statement containing question mark" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash bob.sh 'Ending with ? means a question.'
   [ "$status" -eq 0 ]
   [ "$output" == "Whatever." ]
 }
 
 @test "non-letters with question" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash bob.sh ':) ?'
   [ "$status" -eq 0 ]
   [ "$output" == "Sure." ]
 }
 
 @test "prattling on" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash bob.sh 'Wait! Hang on. Are you going to be OK?'
   [ "$status" -eq 0 ]
   [ "$output" == "Sure." ]
 }
 
 @test "silence" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash bob.sh ''
   [ "$status" -eq 0 ]
   [ "$output" == "Fine. Be that way!" ]
 }
 
 @test "prolonged silence" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash bob.sh '          '
   [ "$status" -eq 0 ]
   [ "$output" == "Fine. Be that way!" ]
 }
 
 @test "alternate silence" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash bob.sh $'\t\t\t\t\t\t\t\t\t\t'
   [ "$status" -eq 0 ]
   [ "$output" == "Fine. Be that way!" ]
 }
 
 @test "multiple line question" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash bob.sh $'\nDoes this cryogenic chamber make me look fat?\nNo'
   [ "$status" -eq 0 ]
   [ "$output" == "Whatever." ]
 }
 
 @test "starting with whitespace" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash bob.sh '         hmmmmmmm...'
   [ "$status" -eq 0 ]
   [ "$output" == "Whatever." ]
 }
 
 @test "ending with whitespace" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash bob.sh 'Okay if like my  spacebar  quite a bit?   '
   [ "$status" -eq 0 ]
   [ "$output" == "Sure." ]
 }
 # This test might act differently depending on your platform
 @test "other whitespace" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash bob.sh $'\n\r \t'
   [ "$status" -eq 0 ]
   [ "$output" == "Fine. Be that way!" ]
 }
 
 @test "non-question ending with whitespace" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash bob.sh 'This is a statement ending with whitespace      '
   [ "$status" -eq 0 ]
   [ "$output" == "Whatever." ]
 }
 
 @test "no input is silence" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash bob.sh
   [ "$status" -eq 0 ]
   [ "$output" == "Fine. Be that way!" ]
diff --git a/exercises/change/README.md b/exercises/change/README.md
index 322acf26..319c0e68 100644
--- a/exercises/change/README.md
+++ b/exercises/change/README.md
@@ -16,14 +16,19 @@ that the sum of the coins' value would equal the correct amount of change.
 - Can you ask for negative change?
 - Can you ask for a change value smaller than the smallest coin value?
 
-
 Run the tests with:
 
 ```bash
 bats change_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
+
+To run all tests, including the ones with `skip` annotations, run:
+
+```bash
+BATS_RUN_SKIPPED=true bats change_test.sh
+```
 
 ## Source
 
diff --git a/exercises/change/change_test.sh b/exercises/change/change_test.sh
index 2f79a82c..5bd45639 100644
--- a/exercises/change/change_test.sh
+++ b/exercises/change/change_test.sh
@@ -2,7 +2,7 @@
 
 
 @test "single coin change" {
-    #skip
+    #[[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="25"
     coins=(1 5 10 25 100)
     run bash change.sh 25 "${coins[@]}"
@@ -11,7 +11,7 @@
 }
 
 @test "multiple coin change" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="5 10"
     coins=(1 5 10 25 100)
     run bash change.sh 15 "${coins[@]}"
@@ -20,7 +20,7 @@
 }
 
 @test "change with Lilliputian Coins" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="4 4 15"
     coins=(1 4 15 20 50)
     run bash change.sh 23 "${coins[@]}"
@@ -29,7 +29,7 @@
 }
 
 @test "change with Lower Elbonia Coins" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="21 21 21"
     coins=(1 5 10 21 25)
     run bash change.sh 63 "${coins[@]}"
@@ -38,7 +38,7 @@
 }
 
 @test "large target values" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="2 2 5 20 20 50 100 100 100 100 100 100 100 100 100"
     coins=(1 2 5 10 20 50 100)
     run bash change.sh 999 "${coins[@]}"
@@ -47,7 +47,7 @@
 }
 
 @test "possible change without unit coins available" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="2 2 2 5 10"
     coins=(2 5 10 20 50)
     run bash change.sh 21 "${coins[@]}"
@@ -56,7 +56,7 @@
 }
 
 @test "another possible change without unit coins available" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="4 4 4 5 5 5"
     coins=(4 5)
     run bash change.sh 27 "${coins[@]}"
@@ -65,7 +65,7 @@
 }
 
 @test "no coins make 0 change" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=""
     coins=(1 5 10 21 25)
     run bash change.sh 0 "${coins[@]}"
@@ -74,7 +74,7 @@
 }
 
 @test "error testing for change smaller than the smallest of coins" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="can't make target with given coins"
     coins=(5 10)
     run bash change.sh 3 "${coins[@]}"
@@ -83,7 +83,7 @@
 }
 
 @test "error if no combination can add up to target" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="can't make target with given coins"
     coins=(5 10)
     run bash change.sh 94 "${coins[@]}"
@@ -92,7 +92,7 @@
 }
 
 @test "cannot find negative change values" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="target can't be negative"
     coins=(1 2 5)
     run bash change.sh -5 "${coins[@]}"
diff --git a/exercises/collatz-conjecture/collatz_conjecture_test.sh b/exercises/collatz-conjecture/collatz_conjecture_test.sh
index 4cc97bd5..b97c6a75 100755
--- a/exercises/collatz-conjecture/collatz_conjecture_test.sh
+++ b/exercises/collatz-conjecture/collatz_conjecture_test.sh
@@ -1,42 +1,42 @@
 #!/usr/bin/env bash
 
 @test "zero steps for one" {
-  #skip
+  #[[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash collatz_conjecture.sh 1
   [ "$status" -eq 0 ]
   [ "$output" -eq 0 ]
 }
 
 @test "divide if even" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash collatz_conjecture.sh 16
   [ "$status" -eq 0 ]
   [ "$output" -eq 4 ]
 }
 
 @test "even and odd steps" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash collatz_conjecture.sh 12
   [ "$status" -eq 0 ]
   [ "$output" -eq 9 ]
 }
 
 @test "large number of even and odd steps" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash collatz_conjecture.sh 1000000
   [ "$status" -eq 0 ]
   [ "$output" -eq 152 ]
 }
 
 @test "zero is an error" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash collatz_conjecture.sh 0
   [ "$status" -eq 1 ]
   [ "$output" == "Error: Only positive numbers are allowed" ]
 }
 
 @test "negative value is an error" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash collatz_conjecture.sh -15
   [ "$status" -eq 1 ]
   [ "$output" == "Error: Only positive numbers are allowed" ]
diff --git a/exercises/diamond/diamond_test.sh b/exercises/diamond/diamond_test.sh
index a44ea780..2b7fa8db 100644
--- a/exercises/diamond/diamond_test.sh
+++ b/exercises/diamond/diamond_test.sh
@@ -1,7 +1,7 @@
 #!/usr/bin/env bash
 
 @test "Degenerate case with a single 'A' row" {
-  #skip
+  #[[ $BATS_RUN_SKIPPED == true  ]] || skip
   expected="$(cat << EOT
 A
 EOT
@@ -12,7 +12,7 @@ EOT
 }
 
 @test "Degenerate case with no row containing 3 distinct groups of spaces" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   expected="$(cat << EOT
  A 
 B B
@@ -25,7 +25,7 @@ EOT
 }
 
 @test "Smallest non-degenerate case with odd diamond side length" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   expected="$(cat << EOT
   A  
  B B 
@@ -40,7 +40,7 @@ EOT
 }
 
 @test "Smallest non-degenerate case with even diamond side length" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   expected="$(cat << EOT
    A   
   B B  
@@ -57,7 +57,7 @@ EOT
 }
 
 @test "Largest possible diamond" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   expected="$(cat << EOT
                          A                         
                         B B                        
diff --git a/exercises/difference-of-squares/difference_of_squares_test.sh b/exercises/difference-of-squares/difference_of_squares_test.sh
index 15f465cb..c8639fa9 100755
--- a/exercises/difference-of-squares/difference_of_squares_test.sh
+++ b/exercises/difference-of-squares/difference_of_squares_test.sh
@@ -2,63 +2,63 @@
 
 # Square the sum of the numbers up to the given number
 @test "square of sum 1" {
-  #skip
+  #[[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash difference_of_squares.sh square_of_sum 1
   [ "$status" -eq 0 ]
   [ "$output" = "1" ]
 }
 
 @test "square of sum 5" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash difference_of_squares.sh square_of_sum 5
   [ "$status" -eq 0 ]
   [ "$output" = "225" ]
 }
 
 @test "square of sum 100" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash difference_of_squares.sh square_of_sum 100
   [ "$status" -eq 0 ]
   [ "$output" = "25502500" ]
 }
 # Sum the squares of the numbers up to the given number
 @test "sum of squares 1" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash difference_of_squares.sh sum_of_squares 1
   [ "$status" -eq 0 ]
   [ "$output" = "1" ]
 }
 
 @test "sum of squares 5" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash difference_of_squares.sh sum_of_squares 5
   [ "$status" -eq 0 ]
   [ "$output" = "55" ]
 }
 
 @test "sum of squares 100" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash difference_of_squares.sh sum_of_squares 100
   [ "$status" -eq 0 ]
   [ "$output" = "338350" ]
 }
 # Subtract sum of squares from square of sums
 @test "difference of squares 1" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash difference_of_squares.sh difference 1
   [ "$status" -eq 0 ]
   [ "$output" = "0" ]
 }
 
 @test "difference of squares 5" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash difference_of_squares.sh difference 5
   [ "$status" -eq 0 ]
   [ "$output" = "170" ]
 }
 
 @test "difference of squares 100" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash difference_of_squares.sh difference 100
   [ "$status" -eq 0 ]
   [ "$output" = "25164150" ]
diff --git a/exercises/diffie-hellman/README.md b/exercises/diffie-hellman/README.md
index bb773e71..99fc8001 100644
--- a/exercises/diffie-hellman/README.md
+++ b/exercises/diffie-hellman/README.md
@@ -37,14 +37,19 @@ Bob calculates
 The calculations produce the same result!  Alice and Bob now share
 secret s.
 
-
 Run the tests with:
 
 ```bash
 bats diffie_hellman_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
+
+To run all tests, including the ones with `skip` annotations, run:
+
+```bash
+BATS_RUN_SKIPPED=true bats diffie_hellman_test.sh
+```
 
 ## Source
 
diff --git a/exercises/diffie-hellman/diffie_hellman_test.sh b/exercises/diffie-hellman/diffie_hellman_test.sh
index b3bb1b63..c5704ca8 100644
--- a/exercises/diffie-hellman/diffie_hellman_test.sh
+++ b/exercises/diffie-hellman/diffie_hellman_test.sh
@@ -1,7 +1,7 @@
 #!/usr/bin/env bash
 
 @test "private key is in range" {
-    #skip
+    #[[ $BATS_RUN_SKIPPED == true  ]] || skip
     for i in 5 7 11 13 17 19 23 29 31 27 41 43 47; do
         run bash diffie_hellman.sh privateKey $i
         [[ $status -eq 0 ]]
@@ -10,7 +10,7 @@
 }
 
 @test "private key is random" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     # may fail due to randomness
     local -A keys=()
     local -i n=10 p=32000
@@ -23,7 +23,7 @@
 }
 
 @test "can calculate public key using private key" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="8"
     local -i p=23 g=5 private=6
     run bash diffie_hellman.sh publicKey $p $g $private
@@ -32,7 +32,7 @@
 }
 
 @test "can calculate secret key using other's public key" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="2"
     local -i p=23 public=19 private=6
     run bash diffie_hellman.sh secret $p $public $private
@@ -41,7 +41,7 @@
 }
 
 @test "key exchange" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     local -i i p=23 g=5
     local -i alicePublic alicePrivate secret1
     local -i bobPublic bobPrivate secret2
diff --git a/exercises/error-handling/error_handling_test.sh b/exercises/error-handling/error_handling_test.sh
index 38eba5a7..b6187f10 100755
--- a/exercises/error-handling/error_handling_test.sh
+++ b/exercises/error-handling/error_handling_test.sh
@@ -1,7 +1,7 @@
 #!/usr/bin/env bash
 
 @test "correct arguments" {
-  #skip
+  #[[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash error_handling.sh Alice
 
   [ "$status" -eq 0 ]
@@ -9,7 +9,7 @@
 }
 
 @test "one long argument" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash error_handling.sh "Alice and Bob"
 
   [ "$status" -eq 0 ]
@@ -17,7 +17,7 @@
 }
 
 @test "incorrect arguments" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash error_handling.sh Alice Bob
 
   [ "$status" -eq 1 ]
@@ -25,7 +25,7 @@
 }
 
 @test "print usage banner with no value given" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash error_handling.sh
 
   [ "$status" -eq 1 ]
@@ -33,7 +33,7 @@
 }
 
 @test "empty argument" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash error_handling.sh ""
 
   [ "$status" -eq 0 ]
diff --git a/exercises/food-chain/README.md b/exercises/food-chain/README.md
index 0320914f..975482ea 100644
--- a/exercises/food-chain/README.md
+++ b/exercises/food-chain/README.md
@@ -63,14 +63,19 @@ I know an old lady who swallowed a horse.
 She's dead, of course!
 ```
 
-
 Run the tests with:
 
 ```bash
 bats food_chain_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
+
+To run all tests, including the ones with `skip` annotations, run:
+
+```bash
+BATS_RUN_SKIPPED=true bats food_chain_test.sh
+```
 
 ## Source
 
diff --git a/exercises/food-chain/food_chain_test.sh b/exercises/food-chain/food_chain_test.sh
index bb2485b7..d0b4184e 100644
--- a/exercises/food-chain/food_chain_test.sh
+++ b/exercises/food-chain/food_chain_test.sh
@@ -1,7 +1,7 @@
 #!/usr/bin/env bash
 
 @test 'fly' {
-    #skip
+    #[[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="I know an old lady who swallowed a fly.
 I don't know why she swallowed the fly. Perhaps she'll die."
     run bash food_chain.sh 1 1
@@ -10,7 +10,7 @@ I don't know why she swallowed the fly. Perhaps she'll die."
 }
  
 @test 'spider' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="I know an old lady who swallowed a spider.
 It wriggled and jiggled and tickled inside her.
 She swallowed the spider to catch the fly.
@@ -21,7 +21,7 @@ I don't know why she swallowed the fly. Perhaps she'll die."
 }
 
 @test 'bird' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="I know an old lady who swallowed a bird.
 How absurd to swallow a bird!
 She swallowed the bird to catch the spider that wriggled and jiggled and tickled inside her.
@@ -33,7 +33,7 @@ I don't know why she swallowed the fly. Perhaps she'll die."
 }
 
 @test 'cat' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="I know an old lady who swallowed a cat.
 Imagine that, to swallow a cat!
 She swallowed the cat to catch the bird.
@@ -46,7 +46,7 @@ I don't know why she swallowed the fly. Perhaps she'll die."
 }
 
 @test 'dog' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="I know an old lady who swallowed a dog.
 What a hog, to swallow a dog!
 She swallowed the dog to catch the cat.
@@ -60,7 +60,7 @@ I don't know why she swallowed the fly. Perhaps she'll die."
 }
 
 @test 'goat' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="I know an old lady who swallowed a goat.
 Just opened her throat and swallowed a goat!
 She swallowed the goat to catch the dog.
@@ -75,7 +75,7 @@ I don't know why she swallowed the fly. Perhaps she'll die."
 }
 
 @test 'cow' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="I know an old lady who swallowed a cow.
 I don't know how she swallowed a cow!
 She swallowed the cow to catch the goat.
@@ -91,7 +91,7 @@ I don't know why she swallowed the fly. Perhaps she'll die."
 }
 
 @test 'horse' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="I know an old lady who swallowed a horse.
 She's dead, of course!"
     run bash food_chain.sh 8 8
@@ -100,7 +100,7 @@ She's dead, of course!"
 }
 
 @test 'multiple_verses' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="I know an old lady who swallowed a fly.
 I don't know why she swallowed the fly. Perhaps she'll die.
 
@@ -120,7 +120,7 @@ I don't know why she swallowed the fly. Perhaps she'll die."
 }
 
 @test 'full_song' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="I know an old lady who swallowed a fly.
 I don't know why she swallowed the fly. Perhaps she'll die.
 
@@ -177,21 +177,21 @@ She's dead, of course!"
 }
 
 @test 'no_arguments' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash food_chain.sh
     [[ $status -ne 0 ]]
     [[ $output == *"2 arguments expected"* ]]
 }
 
 @test 'too_many_arguments' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash food_chain.sh 1 2 3
     [[ $status -ne 0 ]]
     [[ $output == *"2 arguments expected"* ]]
 }
 
 @test 'wrong_order_arguments' {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash food_chain.sh 8 1
     [[ $status -ne 0 ]]
     [[ $output = *"Start must be less than or equal to End"* ]]
diff --git a/exercises/forth/README.md b/exercises/forth/README.md
index f23aa27b..67850f14 100644
--- a/exercises/forth/README.md
+++ b/exercises/forth/README.md
@@ -25,16 +25,19 @@ enough.)
 
 Words are case-insensitive.
 
-
 Run the tests with:
 
 ```bash
 bats forth_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
 
+To run all tests, including the ones with `skip` annotations, run:
 
+```bash
+BATS_RUN_SKIPPED=true bats forth_test.sh
+```
 
 ## External utilities
 `Bash` is a language to write scripts that works closely with various system utilities,
diff --git a/exercises/forth/forth_test.sh b/exercises/forth/forth_test.sh
index e4a6f04a..38a4acb2 100644
--- a/exercises/forth/forth_test.sh
+++ b/exercises/forth/forth_test.sh
@@ -2,7 +2,7 @@
 
 # parsing and numbers
 @test numbers_only {
-    #skip
+    #[[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 1 2 3 4 5
 END
@@ -12,7 +12,7 @@ END
 
 # addition
 @test addition_ok {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 1 2 +
 END
@@ -21,7 +21,7 @@ END
 }
 
 @test addition_no_args {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 +
 END
@@ -30,7 +30,7 @@ END
 }
 
 @test addition_one_args {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 1 +
 END
@@ -40,7 +40,7 @@ END
 
 # subtraction
 @test subtraction_ok {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 3 4 -
 END
@@ -49,7 +49,7 @@ END
 }
 
 @test subtraction_no_args {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 -
 END
@@ -58,7 +58,7 @@ END
 }
 
 @test subtraction_one_args {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 1 -
 END
@@ -68,7 +68,7 @@ END
 
 # multiplication
 @test multiplication_ok {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 2 4 *
 END
@@ -77,7 +77,7 @@ END
 }
 
 @test multiplication_no_args {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 *
 END
@@ -86,7 +86,7 @@ END
 }
 
 @test multiplication_one_args {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 1 *
 END
@@ -96,7 +96,7 @@ END
 
 # division
 @test division_ok {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 12 4 /
 END
@@ -105,7 +105,7 @@ END
 }
 
 @test division_int_result {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 15 4 /
 END
@@ -114,7 +114,7 @@ END
 }
 
 @test division_no_args {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 /
 END
@@ -123,7 +123,7 @@ END
 }
 
 @test division_one_args {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 1 /
 END
@@ -132,7 +132,7 @@ END
 }
 
 @test division_by_zero {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 2 0 /
 END
@@ -142,7 +142,7 @@ END
 
 # combined arithmetic
 @test add_and_subtract {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 1 2 + 4 -
 END
@@ -150,7 +150,7 @@ END
     [[ $output == "-1" ]]
 }
 @test multiply_and_divide {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 2 4 * 3 /
 END
@@ -160,7 +160,7 @@ END
 
 # dup
 @test dup_1 {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 42 dup
 END
@@ -169,7 +169,7 @@ END
 }
 
 @test dup_2 {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 1 2 dup
 END
@@ -178,7 +178,7 @@ END
 }
 
 @test dup_empty {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 dup
 END
@@ -188,7 +188,7 @@ END
 
 # drop
 @test drop_1 {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 42 drop
 END
@@ -197,7 +197,7 @@ END
 }
 
 @test drop_2 {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 1 2 drop
 END
@@ -206,7 +206,7 @@ END
 }
 
 @test drop_empty {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 drop
 END
@@ -216,7 +216,7 @@ END
 
 # swap
 @test swap_1 {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 1 2 swap
 END
@@ -225,7 +225,7 @@ END
 }
 
 @test swap_2 {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 1 2 3 swap
 END
@@ -234,7 +234,7 @@ END
 }
 
 @test swap_empty {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 swap
 END
@@ -243,7 +243,7 @@ END
 }
 
 @test swap_1arg {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 1 swap
 END
@@ -253,7 +253,7 @@ END
 
 # over
 @test over_1 {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 1 2 over
 END
@@ -262,7 +262,7 @@ END
 }
 
 @test over_2 {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 1 2 3 over
 END
@@ -271,7 +271,7 @@ END
 }
 
 @test over_empty {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 over
 END
@@ -280,7 +280,7 @@ END
 }
 
 @test over_1arg {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 1 over
 END
@@ -290,7 +290,7 @@ END
 
 # user-defined words
 @test macro_with_builtin {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 : dup-twice dup dup ;
 1 dup-twice
@@ -300,7 +300,7 @@ END
 }
 
 @test macro_maintain_order {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 : countup 1 2 3 ;
 countup
@@ -310,7 +310,7 @@ END
 }
 
 @test macro_can_override_macro {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 : foo dup ;
 : foo swap ;
@@ -321,7 +321,7 @@ END
 }
 
 @test macro_can_override_builtin {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 : swap dup ;
 1 swap
@@ -331,7 +331,7 @@ END
 }
 
 @test macro_can_override_operator {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 : + * ;
 3 4 +
@@ -341,7 +341,7 @@ END
 }
 
 @test macro_expand_in_macro_definition {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 : foo 5 ;
 : bar foo ;
@@ -353,7 +353,7 @@ END
 }
 
 @test macro_empty_definition {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 : foo ;
 END
@@ -362,7 +362,7 @@ END
 }
 
 @test macro_expand_in_macro_redefinition {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 : foo 10 ;
 : foo foo 1 + ;
@@ -373,7 +373,7 @@ END
 }
 
 @test macro_cannot_redefine_numbers {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 : 1 2 ;
 END
@@ -382,7 +382,7 @@ END
 }
 
 @test macro_undefined {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 foo
 END
@@ -391,7 +391,7 @@ END
 }
 
 @test macro_missing_semicolon {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 : foo 1
 foo
@@ -403,7 +403,7 @@ END
 
 # case insensitivity
 @test case_dup {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 1 DUP Dup dup
 END
@@ -412,7 +412,7 @@ END
 }
 
 @test case_drop {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 1 2 3 4 DROP DrOp drop
 END
@@ -421,7 +421,7 @@ END
 }
 
 @test case_swap {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 1 2 SWAP 3 Swap 4 swap
 END
@@ -430,7 +430,7 @@ END
 }
 
 @test case_over {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 1 2 OVER Over over
 END
@@ -439,7 +439,7 @@ END
 }
 
 @test case_macro_names {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 : foo dup ;
 1 FOO Foo foo
@@ -449,7 +449,7 @@ END
 }
 
 @test case_macro_definitions {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash forth.sh <<END
 : SWAP DUP Dup dup ;
 1 swap
diff --git a/exercises/gigasecond/gigasecond_test.sh b/exercises/gigasecond/gigasecond_test.sh
index 602798a6..785a4d31 100755
--- a/exercises/gigasecond/gigasecond_test.sh
+++ b/exercises/gigasecond/gigasecond_test.sh
@@ -1,12 +1,7 @@
 #!/usr/bin/env bash
 
 @test 'date only specificaion of time' {
-  # this is used to skip the test
-  # normally, we skip every test except for the first one
-  # (the first one is always commented out)
-  # this allows for a person to focus on solving a test at a time
-  # you can comment out or delete the `skip` to run the test when ready
-  #skip
+  #[[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash gigasecond.sh '2011-04-25Z'
 
   [ "$status" -eq 0 ]
@@ -14,7 +9,7 @@
 }
 
 @test 'second test for date only specification of time' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash gigasecond.sh '1977-06-13Z'
 
   [ "$status" -eq 0 ]
@@ -22,7 +17,7 @@
 }
 
 @test 'third test for date only specification of time' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash gigasecond.sh '1959-07-19Z'
 
   [ "$status" -eq 0 ]
@@ -30,7 +25,7 @@
 }
 
 @test 'full time specified' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash gigasecond.sh '2015-01-24 22:00:00Z'
 
   [ "$status" -eq 0 ]
@@ -38,7 +33,7 @@
 }
 
 @test 'full time with day roll-over' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash gigasecond.sh '2015-01-24 23:59:59Z'
 
   [ "$status" -eq 0 ]
diff --git a/exercises/grains/grains_test.sh b/exercises/grains/grains_test.sh
index 1f41682e..9ee5a78e 100755
--- a/exercises/grains/grains_test.sh
+++ b/exercises/grains/grains_test.sh
@@ -1,77 +1,77 @@
 #!/usr/bin/env bash
 
 @test "1" {
-  #skip
+  #[[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash grains.sh 1
   [ "$status" -eq 0 ]
   [ "$output" == "1" ]
 }
 
 @test "2" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash grains.sh 2
   [ "$status" -eq 0 ]
   [ "$output" == "2" ]
 }
 
 @test "3" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash grains.sh 3
   [ "$status" -eq 0 ]
   [ "$output" == "4" ]
 }
 
 @test "4" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash grains.sh 4
   [ "$status" -eq 0 ]
   [ "$output" == "8" ]
 }
 
 @test "16" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash grains.sh 16
   [ "$status" -eq 0 ]
   [ "$output" == "32768" ]
 }
 
 @test "32" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash grains.sh 32
   [ "$status" -eq 0 ]
   [ "$output" == "2147483648" ]
 }
 
 @test "64" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash grains.sh 64
   [ "$status" -eq 0 ]
   [ "$output" == "9223372036854775808" ]
 }
 
 @test "square 0 raises an exception" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash grains.sh 0
   [ "$status" -eq 1 ]
   [ "$output" == "Error: invalid input" ]
 }
 
 @test "negative square raises an exception" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash grains.sh -1
   [ "$status" -eq 1 ]
   [ "$output" == "Error: invalid input" ]
 }
 
 @test "square greater than 64 raises an exception" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash grains.sh 65
   [ "$status" -eq 1 ]
   [ "$output" == "Error: invalid input" ]
 }
 
 @test "returns the total number of grains on the board" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash grains.sh total
   [ "$status" -eq 0 ]
   [ "$output" == "18446744073709551615" ]
diff --git a/exercises/grep/README.md b/exercises/grep/README.md
index 11da0064..0bcf382b 100644
--- a/exercises/grep/README.md
+++ b/exercises/grep/README.md
@@ -64,14 +64,19 @@ The `grep` command should support multiple flags at once.
 For example, running `grep -l -v "hello" file1.txt file2.txt` should
 print the names of files that do not contain the string "hello".
 
-
 Run the tests with:
 
 ```bash
 bats grep_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
+
+To run all tests, including the ones with `skip` annotations, run:
+
+```bash
+BATS_RUN_SKIPPED=true bats grep_test.sh
+```
 
 ## Source
 
diff --git a/exercises/grep/grep_test.sh b/exercises/grep/grep_test.sh
index 1e4cb91a..a01319ae 100644
--- a/exercises/grep/grep_test.sh
+++ b/exercises/grep/grep_test.sh
@@ -40,7 +40,7 @@ teardown() {
 # Test grepping a single file
 
 @test "One file, one match, no flags" {
-    #skip
+    #[[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="Of Atreus, Agamemnon, King of men."
     pattern="Agamemnon"
     flags=()
@@ -51,7 +51,7 @@ teardown() {
 }
 
 @test "One file, one match, print line numbers flag" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="2:Of that Forbidden Tree, whose mortal tast"
     pattern="Forbidden"
     flags=(-n)
@@ -62,7 +62,7 @@ teardown() {
 }
 
 @test "One file, one match, case-insensitive flag" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="Of that Forbidden Tree, whose mortal tast"
     pattern="FORBIDDEN"
     flags=(-i)
@@ -73,7 +73,7 @@ teardown() {
 }
 
 @test "One file, one match, print file names flag" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="paradise-lost.txt"
     pattern="Forbidden"
     flags=(-l)
@@ -84,7 +84,7 @@ teardown() {
 }
 
 @test "One file, one match, match entire lines flag" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="With loss of Eden, till one greater Man"
     pattern="With loss of Eden, till one greater Man"
     flags=(-x)
@@ -95,7 +95,7 @@ teardown() {
 }
 
 @test "One file, one match, multiple flags" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="9:Of Atreus, Agamemnon, King of men."
     pattern="OF ATREUS, Agamemnon, KIng of MEN."
     flags=(-n -i -x)
@@ -106,7 +106,7 @@ teardown() {
 }
 
 @test "One file, several matches, no flags" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="Nor how it may concern my modesty,
 But I beseech your grace that I may know
 The worst that may befall me in this case,"
@@ -119,7 +119,7 @@ The worst that may befall me in this case,"
 }
 
 @test "One file, several matches, print line numbers flag" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="3:Nor how it may concern my modesty,
 5:But I beseech your grace that I may know
 6:The worst that may befall me in this case,"
@@ -133,7 +133,7 @@ The worst that may befall me in this case,"
 
 
 @test "One file, several matches, match entire lines flag" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=""
     pattern="may"
     flags=(-x)        
@@ -144,7 +144,7 @@ The worst that may befall me in this case,"
 }
 
 @test "One file, several matches, case-insensitive flag" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="Achilles sing, O Goddess! Peleus' son;
 The noble Chief Achilles from the son"
     pattern="ACHILLES"
@@ -156,7 +156,7 @@ The noble Chief Achilles from the son"
 }
 
 @test "One file, several matches, inverted flag" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="Brought Death into the World, and all our woe,
 With loss of Eden, till one greater Man
 Restore us, and regain the blissful Seat,
@@ -171,7 +171,7 @@ That Shepherd, who first taught the chosen Seed"
 }
 
 @test "One file, no matches, various flags" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=""
     pattern="Gandalf"
     flags=(-n -l -x -i)
@@ -182,7 +182,7 @@ That Shepherd, who first taught the chosen Seed"
 }
 
 @test "One file, one match, file flag takes precedence over line flag" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="iliad.txt"
     pattern="ten"
     flags=(-n -l)
@@ -193,7 +193,7 @@ That Shepherd, who first taught the chosen Seed"
 }
 
 @test "One file, several matches, inverted and match entire lines flags" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="Achilles sing, O Goddess! Peleus' son;
 His wrath pernicious, who ten thousand woes
 Caused to Achaia's host, sent many a soul
@@ -213,7 +213,7 @@ Of Atreus, Agamemnon, King of men."
 # Multiple files
             
 @test "Multiple files, one match, no flags" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="iliad.txt:Of Atreus, Agamemnon, King of men."
     pattern="Agamemnon"
     flags=()
@@ -224,7 +224,7 @@ Of Atreus, Agamemnon, King of men."
 }
 
 @test "Multiple files, several matches, no flags" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="midsummer-night.txt:Nor how it may concern my modesty,
 midsummer-night.txt:But I beseech your grace that I may know
 midsummer-night.txt:The worst that may befall me in this case,"
@@ -237,7 +237,7 @@ midsummer-night.txt:The worst that may befall me in this case,"
 }
 
 @test "Multiple files, several matches, print line numbers flag" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="midsummer-night.txt:5:But I beseech your grace that I may know
 midsummer-night.txt:6:The worst that may befall me in this case,
 paradise-lost.txt:2:Of that Forbidden Tree, whose mortal tast
@@ -251,7 +251,7 @@ paradise-lost.txt:6:Sing Heav'nly Muse, that on the secret top"
 }
 
 @test "Multiple files, one match, print file names flag" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="iliad.txt
 paradise-lost.txt"
     pattern="who"
@@ -263,7 +263,7 @@ paradise-lost.txt"
 }
 
 @test "Multiple files, several matches, case-insensitive flag" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="iliad.txt:Caused to Achaia's host, sent many a soul
 iliad.txt:Illustrious into Ades premature,
 iliad.txt:And Heroes gave (so stood the will of Jove)
@@ -283,7 +283,7 @@ paradise-lost.txt:Sing Heav'nly Muse, that on the secret top"
 }
 
 @test "Multiple files, several matches, inverted flag" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="iliad.txt:Achilles sing, O Goddess! Peleus' son;
 iliad.txt:The noble Chief Achilles from the son
 midsummer-night.txt:If I refuse to wed Demetrius."
@@ -296,7 +296,7 @@ midsummer-night.txt:If I refuse to wed Demetrius."
 }
 
 @test "Multiple files, one match, match entire lines flag" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="midsummer-night.txt:But I beseech your grace that I may know"
     pattern="But I beseech your grace that I may know"
     flags=(-x)
@@ -307,7 +307,7 @@ midsummer-night.txt:If I refuse to wed Demetrius."
 }
 
 @test "Multiple files, one match, multiple flags" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="paradise-lost.txt:4:With loss of Eden, till one greater Man"
     pattern="WITH LOSS OF EDEN, TILL ONE GREATER MAN"
     flags=(-n -i -x)
@@ -318,7 +318,7 @@ midsummer-night.txt:If I refuse to wed Demetrius."
 }
 
 @test "Multiple files, no matches, various flags" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=""
     pattern="Frodo"
     flags=(-n -l -i -x)
@@ -329,7 +329,7 @@ midsummer-night.txt:If I refuse to wed Demetrius."
 }
 
 @test "Multiple files, several matches, file flag takes precedence over line number flag" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="iliad.txt
 paradise-lost.txt"
     pattern="who"
@@ -341,7 +341,7 @@ paradise-lost.txt"
 }
 
 @test "Multiple files, several matches, inverted and match entire lines flags" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="iliad.txt:Achilles sing, O Goddess! Peleus' son;
 iliad.txt:His wrath pernicious, who ten thousand woes
 iliad.txt:Caused to Achaia's host, sent many a soul
diff --git a/exercises/hamming/hamming_test.sh b/exercises/hamming/hamming_test.sh
index fa85ace1..50817935 100755
--- a/exercises/hamming/hamming_test.sh
+++ b/exercises/hamming/hamming_test.sh
@@ -1,56 +1,56 @@
 #!/usr/bin/env bash
 
 @test 'empty strands' {
-  #skip
+  #[[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash hamming.sh '' ''
   [ "$status" -eq 0 ]
   [ "$output" -eq 0 ]
 }
 
 @test 'single letter identical strands' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash hamming.sh 'A' 'A'
   [ "$status" -eq 0 ]
   [ "$output" -eq 0 ]
 }
 
 @test 'single letter different strands' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash hamming.sh 'G' 'T'
   [ "$status" -eq 0 ]
   [ "$output" -eq 1 ]
 }
 
 @test 'long identical strands' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash hamming.sh 'GGACTGAAATCTG' 'GGACTGAAATCTG'
   [ "$status" -eq 0 ]
   [ "$output" -eq 0 ]
 }
 
 @test 'long different strands' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash hamming.sh 'GGACGGATTCTG' 'AGGACGGATTCT'
   [ "$status" -eq 0 ]
   [ "$output" -eq 9 ]
 }
 
 @test 'disallow first strand longer' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash hamming.sh 'AATG' 'AAA'
   [ "$status" -eq 1 ]
   [ "$output" == 'left and right strands must be of equal length' ]
 }
 
 @test 'disallow second strand longer' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash hamming.sh 'ATA' 'AGTG'
   [ "$status" -eq 1 ]
   [ "$output" == 'left and right strands must be of equal length' ]
 }
 
 @test "no input" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash hamming.sh
   [ "$status" -eq 1 ]
   [ "$output" == 'Usage: hamming.sh <string1> <string2>' ]
diff --git a/exercises/house/README.md b/exercises/house/README.md
index 4773b156..e08f3467 100644
--- a/exercises/house/README.md
+++ b/exercises/house/README.md
@@ -105,14 +105,19 @@ that ate the malt
 that lay in the house that Jack built.
 ```
 
-
 Run the tests with:
 
 ```bash
 bats house_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
+
+To run all tests, including the ones with `skip` annotations, run:
+
+```bash
+BATS_RUN_SKIPPED=true bats house_test.sh
+```
 
 ## Source
 
diff --git a/exercises/house/house_test.sh b/exercises/house/house_test.sh
index 5621df9b..ed49722e 100644
--- a/exercises/house/house_test.sh
+++ b/exercises/house/house_test.sh
@@ -1,7 +1,7 @@
 #!/usr/bin/env bash
 
 @test "verse 1" {
-    #skip
+    #[[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="This is the house that Jack built."
     run bash house.sh 1 1
     [[ $status -eq 0 ]]
@@ -9,7 +9,7 @@
 }       
 
 @test "verse 2" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 This is the malt
 that lay in the house that Jack built.
@@ -21,7 +21,7 @@ END
 }
 
 @test "verse 3" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 This is the rat
 that ate the malt
@@ -34,7 +34,7 @@ END
 }
 
 @test "verse 4" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 This is the cat
 that killed the rat
@@ -48,7 +48,7 @@ END
 }
 
 @test "verse 5" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 This is the dog
 that worried the cat
@@ -63,7 +63,7 @@ END
 }
 
 @test "verse 6" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 This is the cow with the crumpled horn
 that tossed the dog
@@ -79,7 +79,7 @@ END
 }
 
 @test "verse 7" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 This is the maiden all forlorn
 that milked the cow with the crumpled horn
@@ -96,7 +96,7 @@ END
 }
 
 @test "verse 8" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 This is the man all tattered and torn
 that kissed the maiden all forlorn
@@ -114,7 +114,7 @@ END
 }
 
 @test "verse 9" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 This is the priest all shaven and shorn
 that married the man all tattered and torn
@@ -133,7 +133,7 @@ END
 }
 
 @test "verse 10" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 This is the rooster that crowed in the morn
 that woke the priest all shaven and shorn
@@ -153,7 +153,7 @@ END
 }
 
 @test "verse 11" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 This is the farmer sowing his corn
 that kept the rooster that crowed in the morn
@@ -174,7 +174,7 @@ END
 }
 
 @test "verse 12" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 This is the horse and the hound and the horn
 that belonged to the farmer sowing his corn
@@ -196,7 +196,7 @@ END
 }
 
 @test "verses 4 to 8" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 This is the cat
 that killed the rat
@@ -240,7 +240,7 @@ END
 }
 
 @test "all verses" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 This is the house that Jack built.
 
@@ -340,28 +340,28 @@ END
 
 
 @test "invalid verse 1" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash house.sh 0 12
     [[ $status -ne 0 ]]
     [[ $output == *invalid* ]]
 }
 
 @test "invalid verse 2" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash house.sh 1 -1
     [[ $status -ne 0 ]]
     [[ $output == *invalid* ]]
 }
 
 @test "invalid verse 3" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash house.sh 14 12
     [[ $status -ne 0 ]]
     [[ $output == *invalid* ]]
 }
 
 @test "invalid verse 4" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash house.sh 1 13
     [[ $status -ne 0 ]]
     [[ $output == *invalid* ]]
diff --git a/exercises/isbn-verifier/isbn_verifier_test.sh b/exercises/isbn-verifier/isbn_verifier_test.sh
index 3d88d662..40cfeb9b 100644
--- a/exercises/isbn-verifier/isbn_verifier_test.sh
+++ b/exercises/isbn-verifier/isbn_verifier_test.sh
@@ -1,119 +1,119 @@
 #!/usr/bin/env bash
 
 @test 'valid isbn number' {
-  #skip
+  #[[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash isbn_verifier.sh '3-598-21508-8'
   [ "$status" -eq 0 ]
   [ "$output" == 'true' ]
 }
 
 @test 'invalid isbn check digit' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash isbn_verifier.sh '3-598-21508-9'
   [ "$status" -eq 0 ]
   [ "$output" == 'false' ]
 }
 
 @test 'valid isbn number with a check digit of 10' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash isbn_verifier.sh '3-598-21507-X'
   [ "$status" -eq 0 ]
   [ "$output" == 'true' ]
 }
 
 @test 'check digit is a character other than X' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash isbn_verifier.sh '3-598-21507-A'
   [ "$status" -eq 0 ]
   [ "$output" == 'false' ]
 }
 
 @test 'invalid character in isbn' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash isbn_verifier.sh '3-598-P1581-X'
   [ "$status" -eq 0 ]
   [ "$output" == 'false' ]
 }
 
 @test 'X is only valid as a check digit' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash isbn_verifier.sh '3-598-2X507-9'
   [ "$status" -eq 0 ]
   [ "$output" == 'false' ]
 }
 
 @test 'valid isbn without separating dashes' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash isbn_verifier.sh '3598215088'
   [ "$status" -eq 0 ]
   [ "$output" == 'true' ]
 }
 
 @test 'isbn without separating dashes and X as check digit' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash isbn_verifier.sh '359821507X'
   [ "$status" -eq 0 ]
   [ "$output" == 'true' ]
 }
 
 @test 'isbn without check digit and dashes' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash isbn_verifier.sh '359821507'
   [ "$status" -eq 0 ]
   [ "$output" == 'false' ]
 }
 
 @test 'too long isbn and no dashes' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash isbn_verifier.sh '3598215078X'
   [ "$status" -eq 0 ]
   [ "$output" == 'false' ]
 }
 
 @test 'too short isbn' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash isbn_verifier.sh '00'
   [ "$status" -eq 0 ]
   [ "$output" == 'false' ]
 }
 
 @test 'isbn without check digit' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash isbn_verifier.sh '3-598-21507'
   [ "$status" -eq 0 ]
   [ "$output" == 'false' ]
 }
 
 @test 'check digit of X should not be used for 0' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash isbn_verifier.sh '3-598-21515-X'
   [ "$status" -eq 0 ]
   [ "$output" == 'false' ]
 }
 
 @test 'empty isbn' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash isbn_verifier.sh ''
   [ "$status" -eq 0 ]
   [ "$output" == 'false' ]
 }
 
 @test 'input is 9 characters' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash isbn_verifier.sh '134456729'
   [ "$status" -eq 0 ]
   [ "$output" == 'false' ]
 }
 
 @test 'invalid characters are not ignored' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash isbn_verifier.sh '3132P34035'
   [ "$status" -eq 0 ]
   [ "$output" == 'false' ]
 }
 
 @test 'input is too long but contains a valid isbn' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash isbn_verifier.sh '98245726788'
   [ "$status" -eq 0 ]
   [ "$output" == 'false' ]
diff --git a/exercises/isogram/isogram_test.sh b/exercises/isogram/isogram_test.sh
index d9f6b6f9..f92989c9 100644
--- a/exercises/isogram/isogram_test.sh
+++ b/exercises/isogram/isogram_test.sh
@@ -3,84 +3,84 @@
 # Check if the given string is an isogram
 
 @test 'empty string' {
-  #skip
+  #[[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash isogram.sh ''
   [ "$status" -eq 0 ]
   [ "$output" == 'true' ]
 }
 
 @test 'isogram with only lower case characters' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash isogram.sh 'isogram'
   [ "$status" -eq 0 ]
   [ "$output" == 'true' ]
 }
 
 @test 'word with one duplicated character' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash isogram.sh 'eleven'
   [ "$status" -eq 0 ]
   [ "$output" == 'false' ]
 }
 
 @test 'word with one duplicated character from the end of the alphabet' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash isogram.sh 'zzyzx'
   [ "$status" -eq 0 ]
   [ "$output" == 'false' ]
 }
 
 @test 'longest reported english isogram' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash isogram.sh 'subdermatoglyphic'
   [ "$status" -eq 0 ]
   [ "$output" == 'true' ]
 }
 
 @test 'word with duplicated character in mixed case' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash isogram.sh 'Alphabet'
   [ "$status" -eq 0 ]
   [ "$output" == 'false' ]
 }
 
 @test 'hypothetical isogrammic word with hyphen' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash isogram.sh 'thumbscrew-japingly'
   [ "$status" -eq 0 ]
   [ "$output" == 'true' ]
 }
 
 @test 'isogram with duplicated hyphen' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash isogram.sh 'six-year-old'
   [ "$status" -eq 0 ]
   [ "$output" == 'true' ]
 }
 
 @test 'made-up name that is an isogram' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash isogram.sh 'Emily Jung Schwartzkopf'
   [ "$status" -eq 0 ]
   [ "$output" == 'true' ]
 }
 
 @test 'duplicated character in the middle' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash isogram.sh 'accentor'
   [ "$status" -eq 0 ]
   [ "$output" == 'false' ]
 }
 
 @test 'word with duplicated character in mixed case, lowercase first' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash isogram.sh 'alphAbet'
   [ "$status" -eq 0 ]
   [ "$output" == 'false' ]
 }
 
 @test 'same first and last characters' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash isogram.sh 'angola'
   [ "$status" -eq 0 ]
   [ "$output" == 'false' ]
diff --git a/exercises/largest-series-product/README.md b/exercises/largest-series-product/README.md
index 00f0d4e2..e0b4a3d8 100644
--- a/exercises/largest-series-product/README.md
+++ b/exercises/largest-series-product/README.md
@@ -13,14 +13,19 @@ in the input; the digits need not be *numerically consecutive*.
 For the input `'73167176531330624919225119674426574742355349194934'`,
 the largest product for a series of 6 digits is 23520.
 
-
 Run the tests with:
 
 ```bash
 bats largest_series_product_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
+
+To run all tests, including the ones with `skip` annotations, run:
+
+```bash
+BATS_RUN_SKIPPED=true bats largest_series_product_test.sh
+```
 
 ## Source
 
diff --git a/exercises/largest-series-product/largest_series_product_test.sh b/exercises/largest-series-product/largest_series_product_test.sh
index 218fd0e9..27f3f8e4 100644
--- a/exercises/largest-series-product/largest_series_product_test.sh
+++ b/exercises/largest-series-product/largest_series_product_test.sh
@@ -2,7 +2,7 @@
 
 
 @test "finds the largest product if span equals length" {
-    #skip
+    #[[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash largest_series_product.sh 29 2
     expected=18
     [[ $status -eq 0 ]]
@@ -10,7 +10,7 @@
 }
 
 @test "can find the largest product of 2 with numbers in order" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash largest_series_product.sh 0123456789 2
     expected=72
     [[ $status -eq 0 ]]
@@ -18,7 +18,7 @@
 }
 
 @test "can find the largest product of 2" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash largest_series_product.sh 576802143 2
     expected=48
     [[ $status -eq 0 ]]
@@ -26,7 +26,7 @@
 }
 
 @test "can find the largest product of 3 with numbers in order" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash largest_series_product.sh 0123456789 3
     expected=504
     [[ $status -eq 0 ]]
@@ -34,7 +34,7 @@
 }
 
 @test "can find the largest product of 3" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash largest_series_product.sh 1027839564 3
     expected=270
     [[ $status -eq 0 ]]
@@ -42,7 +42,7 @@
 }
 
 @test "can find the largest product of 5 with numbers in order" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash largest_series_product.sh 0123456789 5
     expected=15120
     [[ $status -eq 0 ]]
@@ -50,7 +50,7 @@
 }
 
 @test "can get the largest product of a big number" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash largest_series_product.sh 73167176531330624919225119674426574742355349194934 6
     expected=23520
     [[ $status -eq 0 ]]
@@ -58,7 +58,7 @@
 }
 
 @test "reports zero if the only digits are zero" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash largest_series_product.sh 0000 2
     expected=0
     [[ $status -eq 0 ]]
@@ -66,7 +66,7 @@
 }
 
 @test "reports zero if all spans include zero" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash largest_series_product.sh 99099 3
     expected=0
     [[ $status -eq 0 ]]
@@ -87,7 +87,7 @@
 # So LSP('123', 4) errors and LSP('', 0) does NOT.
 
 @test "reports 1 for empty string and empty product (0 span)" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash largest_series_product.sh 0
     expected=1
     [[ $status -eq 0 ]]
@@ -98,7 +98,7 @@
 # So again no error. It's the empty product, 1.
 
 @test "reports 1 for nonempty string and empty product (0 span)" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash largest_series_product.sh 123 0
     expected=1
     [[ $status -eq 0 ]]
@@ -108,7 +108,7 @@
 # error cases
 
 @test "rejects span longer than string length" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash largest_series_product.sh 123 4
     expected="span must be smaller than string length"
     [[ $status -ne 0 ]]
@@ -116,7 +116,7 @@
 }
 
 @test "rejects empty string and nonzero span" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash largest_series_product.sh "" 1
     expected="span must be smaller than string length"
     [[ $status -ne 0 ]]
@@ -124,7 +124,7 @@
 }
 
 @test "rejects invalid character in digits" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash largest_series_product.sh 1234a5 2
     expected="input must only contain digits"
     [[ $status -ne 0 ]]
@@ -132,7 +132,7 @@
 }
 
 @test "rejects negative span" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash largest_series_product.sh 12345 -1
     expected="span must be greater than zero"
     [[ $status -ne 0 ]]
diff --git a/exercises/leap/leap_test.sh b/exercises/leap/leap_test.sh
index bc2db4c8..29e9ecb8 100755
--- a/exercises/leap/leap_test.sh
+++ b/exercises/leap/leap_test.sh
@@ -1,7 +1,7 @@
 #!/usr/bin/env bash
 
 @test 'year not divisible by 4: common year' {
-  #skip
+  #[[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash leap.sh 2015
 
   [ "$status" -eq 0 ]
@@ -9,7 +9,7 @@
 }
 
 @test 'year divisible by 4, not divisible by 100: leap year' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash leap.sh 1996
 
   [ "$status" -eq 0 ]
@@ -17,7 +17,7 @@
 }
 
 @test 'year divisible by 100, not divisible by 400: common year' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash leap.sh 2100
 
   [ "$status" -eq 0 ]
@@ -25,7 +25,7 @@
 }
 
 @test 'year divisible by 400: leap year' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash leap.sh 2000
 
   [ "$status" -eq 0 ]
@@ -33,7 +33,7 @@
 }
 
 @test 'No input should return an error' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash leap.sh
 
   [ "$status" -eq 1 ]
@@ -41,7 +41,7 @@
 }
 
 @test 'Too many arguments should return an error' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash leap.sh 2016 4562 4566
 
   [ "$status" -eq 1 ]
@@ -49,7 +49,7 @@
 }
 
 @test 'Float number input should return an error' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash leap.sh 2016.54
 
   [ "$status" -eq 1 ]
@@ -57,7 +57,7 @@
 }
 
 @test 'Alpha input should return an error' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash leap.sh 'abcd'
 
   [ "$status" -eq 1 ]
diff --git a/exercises/luhn/luhn_test.sh b/exercises/luhn/luhn_test.sh
index f66e9279..07ef8a06 100755
--- a/exercises/luhn/luhn_test.sh
+++ b/exercises/luhn/luhn_test.sh
@@ -1,98 +1,98 @@
 #!/usr/bin/env bash
 
 @test "single digit strings can not be valid" {
-  #skip
+  #[[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash luhn.sh "1"
   [ "$status" -eq 0 ]
   [ "$output" == "false" ]
 }
 
 @test "a single zero is invalid" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash luhn.sh "0"
   [ "$status" -eq 0 ]
   [ "$output" == "false" ]
 }
 
 @test "a simple valid SIN that remains valid if reversed" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash luhn.sh "059"
   [ "$status" -eq 0 ]
   [ "$output" == "true" ]
 }
 
 @test "a simple valid SIN that becomes invalid if reversed" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash luhn.sh "59"
   [ "$status" -eq 0 ]
   [ "$output" == "true" ]
 }
 
 @test "a valid Canadian SIN" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash luhn.sh "055 444 285"
   [ "$status" -eq 0 ]
   [ "$output" == "true" ]
 }
 
 @test "invalid Canadian SIN" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash luhn.sh "055 444 286"
   [ "$status" -eq 0 ]
   [ "$output" == "false" ]
 }
 
 @test "invalid credit card" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash luhn.sh "8273 1232 7352 0569"
   [ "$status" -eq 0 ]
   [ "$output" == "false" ]
 }
 
 @test "valid strings with a non-digit included become invalid" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash luhn.sh "055a 444 285"
   [ "$status" -eq 0 ]
   [ "$output" == "false" ]
 }
 
 @test "valid strings with punctuation included become invalid" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash luhn.sh "055-444-285"
   [ "$status" -eq 0 ]
   [ "$output" == "false" ]
 }
 
 @test "valid strings with symbols included become invalid" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash luhn.sh "055£ 444$ 285"
   [ "$status" -eq 0 ]
   [ "$output" == "false" ]
 }
 
 @test "single zero with space is invalid" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash luhn.sh " 0"
   [ "$status" -eq 0 ]
   [ "$output" == "false" ]
 }
 
 @test "more than a single zero is valid" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash luhn.sh "0000 0"
   [ "$status" -eq 0 ]
   [ "$output" == "true" ]
 }
 
 @test "input digit 9 is correctly converted to output digit 9" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash luhn.sh "091"
   [ "$status" -eq 0 ]
   [ "$output" == "true" ]
 }
 
 @test "strings with non-digits is invalid" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash luhn.sh ":9"
   [ "$status" -eq 0 ]
   [ "$output" == "false" ]
diff --git a/exercises/matching-brackets/README.md b/exercises/matching-brackets/README.md
index e9365b1d..6f4d7346 100644
--- a/exercises/matching-brackets/README.md
+++ b/exercises/matching-brackets/README.md
@@ -4,14 +4,19 @@ Given a string containing brackets `[]`, braces `{}`, parentheses `()`,
 or any combination thereof, verify that any and all pairs are matched
 and nested correctly.
 
-
 Run the tests with:
 
 ```bash
 bats matching_brackets_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
+
+To run all tests, including the ones with `skip` annotations, run:
+
+```bash
+BATS_RUN_SKIPPED=true bats matching_brackets_test.sh
+```
 
 ## Source
 
diff --git a/exercises/matching-brackets/matching_brackets_test.sh b/exercises/matching-brackets/matching_brackets_test.sh
index c48943ca..501565ef 100644
--- a/exercises/matching-brackets/matching_brackets_test.sh
+++ b/exercises/matching-brackets/matching_brackets_test.sh
@@ -2,119 +2,119 @@
 
 
 @test "paired square brackets" {
-    #skip
+    #[[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash matching_brackets.sh "[]"
     [[ $status -eq 0 ]] 
     [[ $output == "true" ]]
 }
 
 @test "empty string" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash matching_brackets.sh ""
     [[ $status -eq 0 ]] 
     [[ $output == "true" ]]
 }
 
 @test "unpaired brackets" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash matching_brackets.sh "[["
     [[ $status -eq 0 ]] 
     [[ $output == "false" ]]
 }
 
 @test "wrong ordered brackets" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash matching_brackets.sh "}{"
     [[ $status -eq 0 ]] 
     [[ $output == "false" ]]
 }
 
 @test "wrong closing bracket" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash matching_brackets.sh "{]"
     [[ $status -eq 0 ]] 
     [[ $output == "false" ]]
 }
 
 @test "paired with whitespace" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash matching_brackets.sh "{ }"
     [[ $status -eq 0 ]] 
     [[ $output == "true" ]]
 }
 
 @test "partially paired brackets" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash matching_brackets.sh "{[])"
     [[ $status -eq 0 ]] 
     [[ $output == "false" ]]
 }
 
 @test "simple nested brackets" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash matching_brackets.sh "{[]}"
     [[ $status -eq 0 ]] 
     [[ $output == "true" ]]
 }
 
 @test "several paired brackets" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash matching_brackets.sh "{}[]"
     [[ $status -eq 0 ]] 
     [[ $output == "true" ]]
 }
 
 @test "paired and nested brackets" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash matching_brackets.sh "([{}({}[])])"
     [[ $status -eq 0 ]] 
     [[ $output == "true" ]]
 }
 
 @test "unopened closing brackets" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash matching_brackets.sh "{[)][]}"
     [[ $status -eq 0 ]] 
     [[ $output == "false" ]]
 }
 
 @test "unpaired and nested brackets" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash matching_brackets.sh "([{])"
     [[ $status -eq 0 ]] 
     [[ $output == "false" ]]
 }
 
 @test "paired and wrong nested brackets" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash matching_brackets.sh "[({]})"
     [[ $status -eq 0 ]] 
     [[ $output == "false" ]]
 }
 
 @test "paired and incomplete brackets" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash matching_brackets.sh "{}["
     [[ $status -eq 0 ]] 
     [[ $output == "false" ]]
 }
 
 @test "too many closing brackets" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash matching_brackets.sh "[]]"
     [[ $status -eq 0 ]] 
     [[ $output == "false" ]]
 }
 
 @test "math expression" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash matching_brackets.sh "(((185 + 223.85) * 15) - 543)/2"
     [[ $status -eq 0 ]] 
     [[ $output == "true" ]]
 }
 
 @test "complex latex expression" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash matching_brackets.sh "\\left(\\begin{array}{cc} \\frac{1}{3} & x\\\\ \\mathrm{e}^{x} &... x^2 \\end{array}\\right)"
     [[ $status -eq 0 ]] 
     [[ $output == "true" ]]
diff --git a/exercises/nucleotide-count/nucleotide_count_test.sh b/exercises/nucleotide-count/nucleotide_count_test.sh
index 1788b6b5..7a5df13d 100755
--- a/exercises/nucleotide-count/nucleotide_count_test.sh
+++ b/exercises/nucleotide-count/nucleotide_count_test.sh
@@ -3,35 +3,35 @@
 # count all nucleotides in a strand
 
 @test "empty strand" {
-  #skip
+  #[[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash nucleotide_count.sh ""
   [ "$status" -eq 0 ]
   [ "$output" == $'A: 0\nC: 0\nG: 0\nT: 0' ]
 }
 
 @test "can count one nucleotide in single-character input" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash nucleotide_count.sh "G"
   [ "$status" -eq 0 ]
   [ "$output" == $'A: 0\nC: 0\nG: 1\nT: 0' ]
 }
 
 @test "strand with repeated nucleotide" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash nucleotide_count.sh "GGGGGGG"
   [ "$status" -eq 0 ]
   [ "$output" == $'A: 0\nC: 0\nG: 7\nT: 0' ]
 }
 
 @test "strand with multiple nucleotides" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash nucleotide_count.sh "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"
   [ "$status" -eq 0 ]
   [ "$output" == $'A: 20\nC: 12\nG: 17\nT: 21' ]
 }
 
 @test "strand with invalid nucleotides" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash nucleotide_count.sh "AGXXACT"
   [ "$status" -eq 1 ]
   [ "$output" == "Invalid nucleotide in strand" ]
diff --git a/exercises/pangram/pangram_test.sh b/exercises/pangram/pangram_test.sh
index 8f25b291..108751ce 100755
--- a/exercises/pangram/pangram_test.sh
+++ b/exercises/pangram/pangram_test.sh
@@ -3,70 +3,70 @@
 # Check if the given string is a pangram
 
 @test "sentence empty" {
-  #skip
+  #[[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash pangram.sh ""
   [ "$status" -eq 0 ]
   [ "$output" == "false" ]
 }
 
 @test "recognizes a perfect lower case pangram" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash pangram.sh "abcdefghijklmnopqrstuvwxyz"
   [ "$status" -eq 0 ]
   [ "$output" == "true" ]
 }
 
 @test "pangram with only lower case" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash pangram.sh "the quick brown fox jumps over the lazy dog"
   [ "$status" -eq 0 ]
   [ "$output" == "true" ]
 }
 
 @test "missing character 'x'" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash pangram.sh "a quick movement of the enemy will jeopardize five gunboats"
   [ "$status" -eq 0 ]
   [ "$output" == "false" ]
 }
 
 @test "another missing character, e.g. 'h'" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash pangram.sh "five boxing wizards jump quickly at it"
   [ "$status" -eq 0 ]
   [ "$output" == "false" ]
 }
 
 @test "pangram with underscores" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash pangram.sh "the_quick_brown_fox_jumps_over_the_lazy_dog"
   [ "$status" -eq 0 ]
   [ "$output" == "true" ]
 }
 
 @test "pangram with numbers" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash pangram.sh "the 1 quick brown fox jumps over the 2 lazy dogs"
   [ "$status" -eq 0 ]
   [ "$output" == "true" ]
 }
 
 @test "missing letters replaced by numbers" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash pangram.sh "7h3 qu1ck brown fox jumps ov3r 7h3 lazy dog"
   [ "$status" -eq 0 ]
   [ "$output" == "false" ]
 }
 
 @test "pangram with mixed case and punctuation" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash pangram.sh "\"Five quacking Zephyrs jolt my wax bed.\""
   [ "$status" -eq 0 ]
   [ "$output" == "true" ]
 }
 
 @test "upper and lower case versions of the same character should not be counted separately" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash pangram.sh "the quick brown fox jumps over with lazy FX"
   [ "$status" -eq 0 ]
   [ "$output" == "false" ]
diff --git a/exercises/perfect-numbers/README.md b/exercises/perfect-numbers/README.md
index 955d3375..edaa604b 100644
--- a/exercises/perfect-numbers/README.md
+++ b/exercises/perfect-numbers/README.md
@@ -17,14 +17,19 @@ The Greek mathematician [Nicomachus](https://en.wikipedia.org/wiki/Nicomachus) d
 
 Implement a way to determine whether a given number is **perfect**. Depending on your language track, you may also need to implement a way to determine whether a given number is **abundant** or **deficient**.
 
-
 Run the tests with:
 
 ```bash
 bats perfect_numbers_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
+
+To run all tests, including the ones with `skip` annotations, run:
+
+```bash
+BATS_RUN_SKIPPED=true bats perfect_numbers_test.sh
+```
 
 ## Source
 
diff --git a/exercises/perfect-numbers/perfect_numbers_test.sh b/exercises/perfect-numbers/perfect_numbers_test.sh
index 9c0acae4..5ed510c8 100644
--- a/exercises/perfect-numbers/perfect_numbers_test.sh
+++ b/exercises/perfect-numbers/perfect_numbers_test.sh
@@ -3,21 +3,21 @@
 # "Perfect numbers"
 
 @test "Smallest perfect number is classified correctly" {
-    #skip
+    #[[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash perfect_numbers.sh 6
     [[ $status -eq 0 ]] 
     [[ $output == "perfect" ]]
 }
 
 @test "Medium perfect number is classified correctly" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash perfect_numbers.sh 28
     [[ $status -eq 0 ]] 
     [[ $output == "perfect" ]]
 }
 
 @test "Large perfect number is classified correctly" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash perfect_numbers.sh 33550336
     [[ $status -eq 0 ]] 
     [[ $output == "perfect" ]]
@@ -26,21 +26,21 @@
 # "Abundant numbers"
 
 @test "Smallest abundant number is classified correctly" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash perfect_numbers.sh 12
     [[ $status -eq 0 ]] 
     [[ $output == "abundant" ]]
 }
 
 @test "Medium abundant number is classified correctly" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash perfect_numbers.sh 30
     [[ $status -eq 0 ]] 
     [[ $output == "abundant" ]]
 }
 
 @test "Large abundant number is classified correctly" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash perfect_numbers.sh 33550335
     [[ $status -eq 0 ]] 
     [[ $output == "abundant" ]]
@@ -49,35 +49,35 @@
 # "Deficient numbers"
 
 @test "Smallest prime deficient number is classified correctly" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash perfect_numbers.sh 2
     [[ $status -eq 0 ]]
     [[ $output == "deficient" ]]
 }
 
 @test "Smallest non-prime deficient number is classified correctly" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash perfect_numbers.sh 4
     [[ $status -eq 0 ]]
     [[ $output == "deficient" ]]
 }
 
 @test "Medium deficient number is classified correctly" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash perfect_numbers.sh 32
     [[ $status -eq 0 ]] 
     [[ $output == "deficient" ]]
 }
 
 @test "Large deficient number is classified correctly" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash perfect_numbers.sh 33550337
     [[ $status -eq 0 ]] 
     [[ $output == "deficient" ]]
 }
 
 @test "Edge case (no factors other than itself) is classified correctly" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash perfect_numbers.sh 1
     [[ $status -eq 0 ]] 
     [[ $output == "deficient" ]]
@@ -86,14 +86,14 @@
 # "Invalid inputs"
 
 @test "Zero is rejected (not a natural number)" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash perfect_numbers.sh 0
     [[ $status -eq 1 ]] 
     [[ $output == "Classification is only possible for natural numbers." ]]
 }
 
 @test "Negative integer is rejected (not a natural number)" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash perfect_numbers.sh -1
     [[ $status -eq 1 ]] 
     [[ $output == "Classification is only possible for natural numbers." ]]
diff --git a/exercises/phone-number/phone_number_test.sh b/exercises/phone-number/phone_number_test.sh
index 6adb2dae..75081a3c 100755
--- a/exercises/phone-number/phone_number_test.sh
+++ b/exercises/phone-number/phone_number_test.sh
@@ -1,98 +1,98 @@
 #!/usr/bin/env bash
 
 @test "cleans the number" {
-  #skip
+  #[[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash phone_number.sh "(223) 456-7890"
   [ "$status" -eq 0 ]
   [ "$output" == "2234567890" ]
 }
 
 @test "cleans numbers with dots" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash phone_number.sh "223.456.7890"
   [ "$status" -eq 0 ]
   [ "$output" == "2234567890" ]
 }
 
 @test "cleans numbers with multiple spaces" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash phone_number.sh "223 456   7890   "
   [ "$status" -eq 0 ]
   [ "$output" == "2234567890" ]
 }
 
 @test "invalid when 9 digits" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash phone_number.sh "123456789"
   [ "$status" -eq 1 ]
   [ "$output" == "Invalid number.  [1]NXX-NXX-XXXX N=2-9, X=0-9" ]
 }
 
 @test "invalid when 11 digits does not start with a 1" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash phone_number.sh "22234567890"
   [ "$status" -eq 1 ]
   [ "$output" == "Invalid number.  [1]NXX-NXX-XXXX N=2-9, X=0-9" ]
 }
 
 @test "valid when 11 digits and starting with 1" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash phone_number.sh "12234567890"
   [ "$status" -eq 0 ]
   [ "$output" == "2234567890" ]
 }
 
 @test "valid when 11 digits and starting with 1 even with punctuation" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash phone_number.sh "+1 (223) 456-7890"
   [ "$status" -eq 0 ]
   [ "$output" == "2234567890" ]
 }
 
 @test "invalid when more than 11 digits" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash phone_number.sh "321234567890"
   [ "$status" -eq 1 ]
   [ "$output" == "Invalid number.  [1]NXX-NXX-XXXX N=2-9, X=0-9" ]
 }
 
 @test "invalid with letters" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash phone_number.sh "123-abc-7890"
   [ "$status" -eq 1 ]
   [ "$output" == "Invalid number.  [1]NXX-NXX-XXXX N=2-9, X=0-9" ]
 }
 
 @test "invalid with punctuations" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash phone_number.sh "123-@:!-7890"
   [ "$status" -eq 1 ]
   [ "$output" == "Invalid number.  [1]NXX-NXX-XXXX N=2-9, X=0-9" ]
 }
 
 @test "invalid if area code starts with 0" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash phone_number.sh "(023) 456-7890"
   [ "$status" -eq 1 ]
   [ "$output" == "Invalid number.  [1]NXX-NXX-XXXX N=2-9, X=0-9" ]
 }
 
 @test "invalid if area code starts with 1" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash phone_number.sh "(123) 456-7890"
   [ "$status" -eq 1 ]
   [ "$output" == "Invalid number.  [1]NXX-NXX-XXXX N=2-9, X=0-9" ]
 }
 
 @test "invalid if exchange code starts with 0" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash phone_number.sh "(223) 056-7890"
   [ "$status" -eq 1 ]
   [ "$output" == "Invalid number.  [1]NXX-NXX-XXXX N=2-9, X=0-9" ]
 }
 
 @test "invalid if exchange code starts with 1" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash phone_number.sh "(223) 156-7890"
   [ "$status" -eq 1 ]
   [ "$output" == "Invalid number.  [1]NXX-NXX-XXXX N=2-9, X=0-9" ]
diff --git a/exercises/pig-latin/README.md b/exercises/pig-latin/README.md
index 012be5af..74f9dc70 100644
--- a/exercises/pig-latin/README.md
+++ b/exercises/pig-latin/README.md
@@ -17,14 +17,19 @@ variants too.
 
 See <http://en.wikipedia.org/wiki/Pig_latin> for more details.
 
-
 Run the tests with:
 
 ```bash
 bats pig_latin_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
+
+To run all tests, including the ones with `skip` annotations, run:
+
+```bash
+BATS_RUN_SKIPPED=true bats pig_latin_test.sh
+```
 
 ## Source
 
diff --git a/exercises/pig-latin/pig_latin_test.sh b/exercises/pig-latin/pig_latin_test.sh
index dc546415..e64bf4b0 100644
--- a/exercises/pig-latin/pig_latin_test.sh
+++ b/exercises/pig-latin/pig_latin_test.sh
@@ -3,42 +3,42 @@
 # "ay" is added to words that start with vowels
 
 @test word_beginning_with_a {
-    #skip
+    #[[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash pig_latin.sh apple
     [[ $status -eq 0 ]]
     [[ $output == "appleay" ]]
 }
 
 @test word_beginning_with_e {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash pig_latin.sh ear
     [[ $status -eq 0 ]]
     [[ $output == "earay" ]]
 }
 
 @test word_beginning_with_i {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash pig_latin.sh igloo
     [[ $status -eq 0 ]]
     [[ $output == "iglooay" ]]
 }
 
 @test word_beginning_with_o {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash pig_latin.sh object
     [[ $status -eq 0 ]]
     [[ $output == "objectay" ]]
 }
 
 @test word_beginning_with_u {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash pig_latin.sh under
     [[ $status -eq 0 ]]
     [[ $output == "underay" ]]
 }
 
 @test word_beginning_with_equ {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash pig_latin.sh equal
     [[ $status -eq 0 ]]
     [[ $output == "equalay" ]]
@@ -47,28 +47,28 @@
 # first letter and ay are moved to the end of words that start with consonants
 
 @test word_beginning_with_p {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash pig_latin.sh pig
     [[ $status -eq 0 ]]
     [[ $output == "igpay" ]]
 }
 
 @test word_beginning_with_k {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash pig_latin.sh koala
     [[ $status -eq 0 ]]
     [[ $output == "oalakay" ]]
 }
 
 @test word_beginning_with_x {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash pig_latin.sh xenon
     [[ $status -eq 0 ]]
     [[ $output == "enonxay" ]]
 }
 
 @test word_beginning_with_q_no_u {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash pig_latin.sh qat
     [[ $status -eq 0 ]]
     [[ $output == "atqay" ]]
@@ -77,35 +77,35 @@
 # some letter clusters are treated like a single consonant
 
 @test word_beginning_with_ch {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash pig_latin.sh chair
     [[ $status -eq 0 ]]
     [[ $output == "airchay" ]]
 }
 
 @test word_beginning_with_squ {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash pig_latin.sh square
     [[ $status -eq 0 ]]
     [[ $output == "aresquay" ]]
 }
 
 @test word_beginning_with_th {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash pig_latin.sh therapy
     [[ $status -eq 0 ]]
     [[ $output == "erapythay" ]]
 }
 
 @test word_beginning_with_thr {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash pig_latin.sh thrush
     [[ $status -eq 0 ]]
     [[ $output == "ushthray" ]]
 }
 
 @test word_beginning_with_sch {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash pig_latin.sh school
     [[ $status -eq 0 ]]
     [[ $output == "oolschay" ]]
@@ -114,14 +114,14 @@
 # some letter clusters are treated like a single vowel
 
 @test word_beginning_with_yt {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash pig_latin.sh yttria
     [[ $status -eq 0 ]]
     [[ $output == "yttriaay" ]]
 }
 
 @test word_beginning_with_xr {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash pig_latin.sh xray
     [[ $status -eq 0 ]]
     [[ $output == "xrayay" ]]
@@ -130,21 +130,21 @@
 # position of y in a word determines if it is a consonant or a vowel
 
 @test word_beginning_with_y {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash pig_latin.sh yellow
     [[ $status -eq 0 ]]
     [[ $output == "ellowyay" ]]
 }
 
 @test word_rhythm {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash pig_latin.sh rhythm
     [[ $status -eq 0 ]]
     [[ $output == "ythmrhay" ]]
 }
 
 @test word_my {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash pig_latin.sh my
     [[ $status -eq 0 ]]
     [[ $output == "ymay" ]]
@@ -152,7 +152,7 @@
 
 # phrases are translated
 @test a_whole_phrase {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash pig_latin.sh quick fast run
     [[ $status -eq 0 ]]
     [[ $output == "ickquay astfay unray" ]]
diff --git a/exercises/prime-factors/README.md b/exercises/prime-factors/README.md
index 1dc1adee..af6d059b 100644
--- a/exercises/prime-factors/README.md
+++ b/exercises/prime-factors/README.md
@@ -29,14 +29,19 @@ You can check this yourself:
 - = 60
 - Success!
 
-
 Run the tests with:
 
 ```bash
 bats prime_factors_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
+
+To run all tests, including the ones with `skip` annotations, run:
+
+```bash
+BATS_RUN_SKIPPED=true bats prime_factors_test.sh
+```
 
 ## Source
 
diff --git a/exercises/prime-factors/prime_factors_test.sh b/exercises/prime-factors/prime_factors_test.sh
index 520cc44d..97df59ba 100644
--- a/exercises/prime-factors/prime_factors_test.sh
+++ b/exercises/prime-factors/prime_factors_test.sh
@@ -1,7 +1,7 @@
 #!/usr/bin/env bash
 
 @test "no factors" {
-    #skip
+    #[[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=""
     run bash prime_factors.sh 1
     [[ $status -eq 0 ]]
@@ -9,7 +9,7 @@
 }
 
 @test "prime number" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="2"
     run bash prime_factors.sh 2
     [[ $status -eq 0 ]]
@@ -17,7 +17,7 @@
 }
 
 @test "square of a prime" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="3 3"
     run bash prime_factors.sh 9
     [[ $status -eq 0 ]]
@@ -25,7 +25,7 @@
 }
 
 @test "cube of a prime" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="2 2 2"
     run bash prime_factors.sh 8
     [[ $status -eq 0 ]]
@@ -33,7 +33,7 @@
 }
 
 @test "product of primes and non-primes" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="2 2 3"
     run bash prime_factors.sh 12
     [[ $status -eq 0 ]]
@@ -41,7 +41,7 @@
 }
 
 @test "product of primes" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="5 17 23 461"
     run bash prime_factors.sh 901255
     [[ $status -eq 0 ]]
@@ -49,7 +49,7 @@
 }
 
 @test "factors include a large prime" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="11 9539 894119"
     run bash prime_factors.sh 93819012551
     [[ $status -eq 0 ]]
diff --git a/exercises/protein-translation/README.md b/exercises/protein-translation/README.md
index 6e56607d..f3652f46 100644
--- a/exercises/protein-translation/README.md
+++ b/exercises/protein-translation/README.md
@@ -41,14 +41,19 @@ UAA, UAG, UGA         | STOP
 
 Learn more about [protein translation on Wikipedia](http://en.wikipedia.org/wiki/Translation_(biology))
 
-
 Run the tests with:
 
 ```bash
 bats protein_translation_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
+
+To run all tests, including the ones with `skip` annotations, run:
+
+```bash
+BATS_RUN_SKIPPED=true bats protein_translation_test.sh
+```
 
 ## Source
 
diff --git a/exercises/protein-translation/protein_translation_test.sh b/exercises/protein-translation/protein_translation_test.sh
index c487f2fd..6c5939d4 100644
--- a/exercises/protein-translation/protein_translation_test.sh
+++ b/exercises/protein-translation/protein_translation_test.sh
@@ -3,168 +3,168 @@
 # Translate input RNA sequences into proteins
 
 @test "Methionine RNA sequence" {       
-    #skip
+    #[[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash protein_translation.sh "AUG"
     [[ $status -eq 0 ]]
     [[ $output == "Methionine" ]]
 }
 
 @test "Phenylalanine RNA sequence 1" {  
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash protein_translation.sh "UUU"
     [[ $status -eq 0 ]]
     [[ $output == "Phenylalanine" ]]
 }
 
 @test "Phenylalanine RNA sequence 2" {  
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash protein_translation.sh "UUC"
     [[ $status -eq 0 ]]
     [[ $output == "Phenylalanine" ]]
 }
 
 @test "Leucine RNA sequence 1" {        
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash protein_translation.sh "UUA"
     [[ $status -eq 0 ]]
     [[ $output == "Leucine" ]]
 }
 
 @test "Leucine RNA sequence 2" {        
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash protein_translation.sh "UUG"
     [[ $status -eq 0 ]]
     [[ $output == "Leucine" ]]
 }
 
 @test "Serine RNA sequence 1" { 
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash protein_translation.sh "UCU"
     [[ $status -eq 0 ]]
     [[ $output == "Serine" ]]
 }
 
 @test "Serine RNA sequence 2" { 
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash protein_translation.sh "UCC"
     [[ $status -eq 0 ]]
     [[ $output == "Serine" ]]
 }
 
 @test "Serine RNA sequence 3" { 
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash protein_translation.sh "UCA"
     [[ $status -eq 0 ]]
     [[ $output == "Serine" ]]
 }
 
 @test "Serine RNA sequence 4" { 
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash protein_translation.sh "UCG"
     [[ $status -eq 0 ]]
     [[ $output == "Serine" ]]
 }
 
 @test "Tyrosine RNA sequence 1" {       
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash protein_translation.sh "UAU"
     [[ $status -eq 0 ]]
     [[ $output == "Tyrosine" ]]
 }
 
 @test "Tyrosine RNA sequence 2" {       
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash protein_translation.sh "UAC"
     [[ $status -eq 0 ]]
     [[ $output == "Tyrosine" ]]
 }
 
 @test "Cysteine RNA sequence 1" {       
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash protein_translation.sh "UGU"
     [[ $status -eq 0 ]]
     [[ $output == "Cysteine" ]]
 }
 
 @test "Cysteine RNA sequence 2" {       
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash protein_translation.sh "UGC"
     [[ $status -eq 0 ]]
     [[ $output == "Cysteine" ]]
 }
 
 @test "Tryptophan RNA sequence" {       
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash protein_translation.sh "UGG"
     [[ $status -eq 0 ]]
     [[ $output == "Tryptophan" ]]
 }
 
 @test "STOP codon RNA sequence 1" {     
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash protein_translation.sh "UAA"
     [[ $status -eq 0 ]]
     [[ $output == "" ]]
 }
 
 @test "STOP codon RNA sequence 2" {     
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash protein_translation.sh "UAG"
     [[ $status -eq 0 ]]
     [[ $output == "" ]]
 }
 
 @test "STOP codon RNA sequence 3" {     
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash protein_translation.sh "UGA"
     [[ $status -eq 0 ]]
     [[ $output == "" ]]
 }
 
 @test "Translate RNA strand into correct protein list" {        
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash protein_translation.sh "AUGUUUUGG"
     [[ $status -eq 0 ]]
     [[ $output == "Methionine Phenylalanine Tryptophan" ]]
 }
 
 @test "Translation stops if STOP codon at beginning of sequence" {      
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash protein_translation.sh "UAGUGG"
     [[ $status -eq 0 ]]
     [[ $output == "" ]]
 }
 
 @test "Translation stops if STOP codon at end of two-codon sequence" {  
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash protein_translation.sh "UGGUAG"
     [[ $status -eq 0 ]]
     [[ $output == "Tryptophan" ]]
 }
 
 @test "Translation stops if STOP codon at end of three-codon sequence" {        
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash protein_translation.sh "AUGUUUUAA"
     [[ $status -eq 0 ]]
     [[ $output == "Methionine Phenylalanine" ]]
 }
 
 @test "Translation stops if STOP codon in middle of three-codon sequence" {     
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash protein_translation.sh "UGGUAGUGG"
     [[ $status -eq 0 ]]
     [[ $output == "Tryptophan" ]]
 }
 
 @test "Translation stops if STOP codon in middle of six-codon sequence" {       
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash protein_translation.sh "UGGUGUUAUUAAUGGUUU"
     [[ $status -eq 0 ]]
     [[ $output == "Tryptophan Cysteine Tyrosine" ]]
 }
 
 @test "Error case" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash protein_translation.sh "UGG---AUG"
     [[ $status -eq 1 ]]
     [[ $output == "Invalid codon" ]]
diff --git a/exercises/proverb/README.md b/exercises/proverb/README.md
index 09760806..3f0303dc 100644
--- a/exercises/proverb/README.md
+++ b/exercises/proverb/README.md
@@ -16,14 +16,19 @@ And all for the want of a nail.
 
 Note that the list of inputs may vary; your solution should be able to handle lists of arbitrary length and content. No line of the output text should be a static, unchanging string; all should vary according to the input given.
 
-
 Run the tests with:
 
 ```bash
 bats proverb_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
+
+To run all tests, including the ones with `skip` annotations, run:
+
+```bash
+BATS_RUN_SKIPPED=true bats proverb_test.sh
+```
 
 ## Source
 
diff --git a/exercises/proverb/proverb_test.sh b/exercises/proverb/proverb_test.sh
index 4335d9ad..df12f997 100644
--- a/exercises/proverb/proverb_test.sh
+++ b/exercises/proverb/proverb_test.sh
@@ -1,7 +1,7 @@
 #!/usr/bin/env bash
 
 @test "zero pieces" {
-    #skip
+    #[[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=""
     run bash proverb.sh
     [[ $status -eq 0 ]]
@@ -9,7 +9,7 @@
 }
 
 @test "one piece" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 And all for the want of a nail.
 END
@@ -20,7 +20,7 @@ END
 }
 
 @test "two pieces" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 For want of a nail the shoe was lost.
 And all for the want of a nail.
@@ -32,7 +32,7 @@ END
 }
 
 @test "three pieces" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 For want of a nail the shoe was lost.
 For want of a shoe the horse was lost.
@@ -46,7 +46,7 @@ END
 
 
 @test "full proverb" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 For want of a nail the shoe was lost.
 For want of a shoe the horse was lost.
@@ -63,7 +63,7 @@ END
 }
 
 @test "four pieces modernized" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 For want of a pin the gun was lost.
 For want of a gun the soldier was lost.
diff --git a/exercises/raindrops/raindrops_test.sh b/exercises/raindrops/raindrops_test.sh
index 2341cc0e..7f57c078 100755
--- a/exercises/raindrops/raindrops_test.sh
+++ b/exercises/raindrops/raindrops_test.sh
@@ -1,126 +1,126 @@
 #!/usr/bin/env bash
 
 @test "the sound for 1 is 1" {
-  #skip
+  #[[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash raindrops.sh 1
   [ "$status" -eq 0 ]
   [ "$output" == "1" ]
 }
 
 @test "the sound for 3 is Pling" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash raindrops.sh 3
   [ "$status" -eq 0 ]
   [ "$output" == "Pling" ]
 }
 
 @test "the sound for 5 is Plang" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash raindrops.sh 5
   [ "$status" -eq 0 ]
   [ "$output" == "Plang" ]
 }
 
 @test "the sound for 7 is Plong" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash raindrops.sh 7
   [ "$status" -eq 0 ]
   [ "$output" == "Plong" ]
 }
 
 @test "the sound for 6 is Pling as it has a factor 3" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash raindrops.sh 6
   [ "$status" -eq 0 ]
   [ "$output" == "Pling" ]
 }
 
 @test "2 to the power 3 does not make a raindrop sound as 3 is the exponent not the base" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash raindrops.sh 8
   [ "$status" -eq 0 ]
   [ "$output" == "8" ]
 }
 
 @test "the sound for 9 is Pling as it has a factor 3" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash raindrops.sh 9
   [ "$status" -eq 0 ]
   [ "$output" == "Pling" ]
 }
 
 @test "the sound for 10 is Plang as it has a factor 5" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash raindrops.sh 10
   [ "$status" -eq 0 ]
   [ "$output" == "Plang" ]
 }
 
 @test "the sound for 14 is Plong as it has a factor of 7" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash raindrops.sh 14
   [ "$status" -eq 0 ]
   [ "$output" == "Plong" ]
 }
 
 @test "the sound for 15 is PlingPlang as it has factors 3 and 5" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash raindrops.sh 15
   [ "$status" -eq 0 ]
   [ "$output" == "PlingPlang" ]
 }
 
 @test "the sound for 21 is PlingPlong as it has factors 3 and 7" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash raindrops.sh 21
   [ "$status" -eq 0 ]
   [ "$output" == "PlingPlong" ]
 }
 
 @test "the sound for 25 is Plang as it has a factor 5" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash raindrops.sh 25
   [ "$status" -eq 0 ]
   [ "$output" == "Plang" ]
 }
 
 @test "the sound for 27 is Pling as it has a factor 3" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash raindrops.sh 27
   [ "$status" -eq 0 ]
   [ "$output" == "Pling" ]
 }
 
 @test "the sound for 35 is PlangPlong as it has factors 5 and 7" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash raindrops.sh 35
   [ "$status" -eq 0 ]
   [ "$output" == "PlangPlong" ]
 }
 
 @test "the sound for 49 is Plong as it has a factor 7" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash raindrops.sh 49
   [ "$status" -eq 0 ]
   [ "$output" == "Plong" ]
 }
 
 @test "the sound for 52 is 52" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash raindrops.sh 52
   [ "$status" -eq 0 ]
   [ "$output" == "52" ]
 }
 
 @test "the sound for 105 is PlingPlangPlong as it has factors 3, 5 and 7" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash raindrops.sh 105
   [ "$status" -eq 0 ]
   [ "$output" == "PlingPlangPlong" ]
 }
 
 @test "the sound for 3125 is Plang as it has a factor 5" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash raindrops.sh 3125
   [ "$status" -eq 0 ]
   [ "$output" == "Plang" ]
diff --git a/exercises/rational-numbers/README.md b/exercises/rational-numbers/README.md
index 63212d09..8452b1c9 100644
--- a/exercises/rational-numbers/README.md
+++ b/exercises/rational-numbers/README.md
@@ -28,14 +28,19 @@ Your implementation of rational numbers should always be reduced to lowest terms
 
 Assume that the programming language you are using does not have an implementation of rational numbers.
 
-
 Run the tests with:
 
 ```bash
 bats rational_numbers_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
+
+To run all tests, including the ones with `skip` annotations, run:
+
+```bash
+BATS_RUN_SKIPPED=true bats rational_numbers_test.sh
+```
 
 ## Source
 
diff --git a/exercises/rational-numbers/rational_numbers_test.sh b/exercises/rational-numbers/rational_numbers_test.sh
index f2aea0ce..63e7cdb7 100644
--- a/exercises/rational-numbers/rational_numbers_test.sh
+++ b/exercises/rational-numbers/rational_numbers_test.sh
@@ -3,28 +3,28 @@
 # Addition
 
 @test "Add two positive rational numbers" {
-    #skip
+    #[[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "+" "1/2" "2/3"
     [[ $status -eq 0 ]]
     [[ $output == "7/6" ]]
 }
 
 @test "Add a positive rational number and a negative rational number" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "+" "1/2" "-2/3"
     [[ $status -eq 0 ]]
     [[ $output == "-1/6" ]]
 }
 
 @test "Add two negative rational numbers" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "+" "-1/2" "-2/3"
     [[ $status -eq 0 ]]
     [[ $output == "-7/6" ]]
 }
 
 @test "Add a rational number to its additive inverse" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "+" "1/2" "-1/2"
     [[ $status -eq 0 ]]
     [[ $output == "0/1" ]]
@@ -34,28 +34,28 @@
 # Subtraction
 
 @test "Subtract two positive rational numbers" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "-" "1/2" "2/3"
     [[ $status -eq 0 ]]
     [[ $output == "-1/6" ]]
 }
 
 @test "Subtract a positive rational number and a negative rational number" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "-" "1/2" "-2/3"
     [[ $status -eq 0 ]]
     [[ $output == "7/6" ]]
 }
 
 @test "Subtract two negative rational numbers" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "-" "-1/2" "-2/3"
     [[ $status -eq 0 ]]
     [[ $output == "1/6" ]]
 }
 
 @test "Subtract a rational number from itself" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "-" "1/2" "1/2"
     [[ $status -eq 0 ]]
     [[ $output == "0/1" ]]
@@ -64,42 +64,42 @@
 # Multiplication
 
 @test "Multiply two positive rational numbers" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "*" "1/2" "2/3"
     [[ $status -eq 0 ]]
     [[ $output == "1/3" ]]
 }
 
 @test "Multiply a negative rational number by a positive rational number" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "*" "-1/2" "2/3"
     [[ $status -eq 0 ]]
     [[ $output == "-1/3" ]]
 }
 
 @test "Multiply two negative rational numbers" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "*" "-1/2" "-2/3"
     [[ $status -eq 0 ]]
     [[ $output == "1/3" ]]
 }
 
 @test "Multiply a rational number by its reciprocal" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "*" "1/2" "2/1"
     [[ $status -eq 0 ]]
     [[ $output == "1/1" ]]
 }
 
 @test "Multiply a rational number by 1" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "*" "1/2" "1/1"
     [[ $status -eq 0 ]]
     [[ $output == "1/2" ]]
 }
 
 @test "Multiply a rational number by 0" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "*" "1/2" "0/1"
     [[ $status -eq 0 ]]
     [[ $output == "0/1" ]]
@@ -109,28 +109,28 @@
 # Division
 
 @test "Divide two positive rational numbers" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "/" "1/2" "2/3"
     [[ $status -eq 0 ]]
     [[ $output == "3/4" ]]
 }
 
 @test "Divide a positive rational number by a negative rational number" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "/" "1/2" "-2/3"
     [[ $status -eq 0 ]]
     [[ $output == "-3/4" ]]
 }
 
 @test "Divide two negative rational numbers" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "/" "-1/2" "-2/3"
     [[ $status -eq 0 ]]
     [[ $output == "3/4" ]]
 }
 
 @test "Divide a rational number by 1" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "/" "1/2" "1/1"
     [[ $status -eq 0 ]]
     [[ $output == "1/2" ]]
@@ -140,35 +140,35 @@
 # Absolute value"
 
 @test "Absolute value of a positive rational number" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "abs" "1/2"
     [[ $status -eq 0 ]]
     [[ $output ==  "1/2" ]]
 }
 
 @test "Absolute value of a positive rational number with negative numerator and denominator" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "abs" "-1/-2"
     [[ $status -eq 0 ]]
     [[ $output ==  "1/2" ]]
 }
 
 @test "Absolute value of a negative rational number" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "abs" "-1/2"
     [[ $status -eq 0 ]]
     [[ $output ==  "1/2" ]]
 }
 
 @test "Absolute value of a negative rational number with negative denominator" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "abs" "1/-2"
     [[ $status -eq 0 ]]
     [[ $output ==  "1/2" ]]
 }
 
 @test "Absolute value of zero" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "abs" "0/1"
     [[ $status -eq 0 ]]
     [[ $output ==  "0/1" ]]
@@ -178,42 +178,42 @@
 # Exponentiation of a rational number
 
 @test "Raise a positive rational number to a positive integer power" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "pow" "1/2" 3
     [[ $status -eq 0 ]]
     [[ $output == "1/8" ]]
 }
 
 @test "Raise a negative rational number to a positive integer power" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "pow" "-1/2" 3
     [[ $status -eq 0 ]]
     [[ $output == "-1/8" ]]
 }
 
 @test "Raise zero to an integer power" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "pow" "0/1" 5
     [[ $status -eq 0 ]]
     [[ $output == "0/1" ]]
 }
 
 @test "Raise one to an integer power" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "pow" "1/1" 4
     [[ $status -eq 0 ]]
     [[ $output == "1/1" ]]
 }
 
 @test "Raise a positive rational number to the power of zero" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "pow" "1/2" 0
     [[ $status -eq 0 ]]
     [[ $output == "1/1" ]]
 }
 
 @test "Raise a negative rational number to the power of zero" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "pow" "-1/2" 0
     [[ $status -eq 0 ]]
     [[ $output == "1/1" ]]
@@ -223,21 +223,21 @@
 # Exponentiation of a real number to a rational number
 
 @test "Raise a real number to a positive rational number" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "rpow" 8 "4/3"
     [[ $status -eq 0 ]]
     [[ $output == 16.0 ]]
 }
 
 @test "Raise a real number to a negative rational number" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "rpow" 9 "-1/2"
     [[ $status -eq 0 ]]
     [[ $output == 0.333333 ]]
 }
 
 @test "Raise a real number to a zero rational number" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "rpow" 2 "0/1"
     [[ $status -eq 0 ]]
     [[ $output == 1.0 ]]
@@ -247,49 +247,49 @@
 # Reduction to lowest terms
 
 @test "Reduce a positive rational number to lowest terms" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "reduce" "2/4"
     [[ $status -eq 0 ]]
     [[ $output ==  "1/2" ]]
 }
 
 @test "Reduce a negative rational number to lowest terms" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "reduce" "-4/6"
     [[ $status -eq 0 ]]
     [[ $output ==  "-2/3" ]]
 }
 
 @test "Reduce a rational number with a negative denominator to lowest terms" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "reduce" "3/-9"
     [[ $status -eq 0 ]]
     [[ $output ==  "-1/3" ]]
 }
 
 @test "Reduce zero to lowest terms" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "reduce" "0/6"
     [[ $status -eq 0 ]]
     [[ $output ==  "0/1" ]]
 }
 
 @test "Reduce an integer to lowest terms" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "reduce" "-14/7"
     [[ $status -eq 0 ]]
     [[ $output ==  "-2/1" ]]
 }
 
 @test "Reduce one to lowest terms" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "reduce" "13/13"
     [[ $status -eq 0 ]]
     [[ $output ==  "1/1" ]]
 }
 
 @test "Reduce zero to lowest terms" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash rational_numbers.sh "reduce" "0/13"
     [[ $status -eq 0 ]]
     [[ $output ==  "0/1" ]]
diff --git a/exercises/resistor-color-duo/README.md b/exercises/resistor-color-duo/README.md
index f8b82d7e..419bd552 100644
--- a/exercises/resistor-color-duo/README.md
+++ b/exercises/resistor-color-duo/README.md
@@ -21,14 +21,19 @@ The band colors are encoded as follows:
 - Grey: 8
 - White: 9
 
-
 Run the tests with:
 
 ```bash
 bats resistor_color_duo_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
+
+To run all tests, including the ones with `skip` annotations, run:
+
+```bash
+BATS_RUN_SKIPPED=true bats resistor_color_duo_test.sh
+```
 
 ## Source
 
diff --git a/exercises/resistor-color-duo/resistor_color_duo_test.sh b/exercises/resistor-color-duo/resistor_color_duo_test.sh
index f497caf2..1f8823aa 100644
--- a/exercises/resistor-color-duo/resistor_color_duo_test.sh
+++ b/exercises/resistor-color-duo/resistor_color_duo_test.sh
@@ -1,35 +1,35 @@
 #!/usr/bin/env bash
 
 @test "brown black" {
-    #skip
+    #[[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash resistor_color_duo.sh brown black
     [[ $status -eq 0 ]]
     [[ $output == "10" ]]
 }
 
 @test "blue grey" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash resistor_color_duo.sh blue grey
     [[ $status -eq 0 ]]
     [[ $output == "68" ]]
 }
 
 @test "yellow violet" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash resistor_color_duo.sh yellow violet
     [[ $status -eq 0 ]]
     [[ $output == "47" ]]
 }
 
 @test "orange orange" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash resistor_color_duo.sh orange orange
     [[ $status -eq 0 ]]
     [[ $output == "33" ]]
 }
 
 @test "invalid color" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash resistor_color_duo.sh foo
     [[ $status -eq 1 ]]
     [[ $output == "invalid color" ]]
diff --git a/exercises/reverse-string/reverse_string_test.sh b/exercises/reverse-string/reverse_string_test.sh
index 117cae41..22e4caf1 100755
--- a/exercises/reverse-string/reverse_string_test.sh
+++ b/exercises/reverse-string/reverse_string_test.sh
@@ -1,7 +1,7 @@
 #!/usr/bin/env bash
 
 @test "An empty string" {
-  #skip
+  #[[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash reverse_string.sh ""
 
   [ "$status" -eq 0 ]
@@ -9,7 +9,7 @@
 }
 
 @test "A word" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash reverse_string.sh "robot"
 
   [ "$status" -eq 0 ]
@@ -17,7 +17,7 @@
 }
 
 @test "A capitalised word" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash reverse_string.sh "Ramen"
 
   [ "$status" -eq 0 ]
@@ -25,7 +25,7 @@
 }
 
 @test "A sentence with punctuation" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash reverse_string.sh "I'm hungry!"
 
   [ "$status" -eq 0 ]
@@ -33,7 +33,7 @@
 }
 
 @test "A palindrome" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash reverse_string.sh "racecar"
 
   [ "$status" -eq 0 ]
diff --git a/exercises/rna-transcription/rna_transcription_test.sh b/exercises/rna-transcription/rna_transcription_test.sh
index 7c8531a7..85a0ebe5 100755
--- a/exercises/rna-transcription/rna_transcription_test.sh
+++ b/exercises/rna-transcription/rna_transcription_test.sh
@@ -1,63 +1,63 @@
 #!/usr/bin/env bash
 
 @test "Empty RNA sequence" {
-  #skip
+  #[[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash rna_transcription.sh
   [ "$status" -eq 0 ]
   [ "$output" == "" ]
 }
 
 @test "RNA complement of cytosine is guanine" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash rna_transcription.sh C
   [ "$status" -eq 0 ]
   [ "$output" == "G" ]
 }
 
 @test "RNA complement of guanine is cytosine" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash rna_transcription.sh G
   [ "$status" -eq 0 ]
   [ "$output" == "C" ]
 }
 
 @test "RNA complement of thymine is adenine" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash rna_transcription.sh T
   [ "$status" -eq 0 ]
   [ "$output" == "A" ]
 }
 
 @test "RNA complement of adenine is uracil" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash rna_transcription.sh A
   [ "$status" -eq 0 ]
   [ "$output" == "U" ]
 }
 
 @test "RNA complement" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash rna_transcription.sh ACGTGGTCTTAA
   [ "$status" -eq 0 ]
   [ "$output" == "UGCACCAGAAUU" ]
 }
 
 @test "Handles invalid character" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash rna_transcription.sh ACGTXCTTA
   [ "$status" -eq 1 ]
   [ "$output" == "Invalid nucleotide detected." ]
 }
 
 @test "Handles completely invalid string" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash rna_transcription.sh XXXX
   [ "$status" -eq 1 ]
   [ "$output" == "Invalid nucleotide detected." ]
 }
 
 @test "Handles partially invalid string" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash rna_transcription.sh ACGTXCTTAA
   [ "$status" -eq 1 ]
   [ "$output" == "Invalid nucleotide detected." ]
diff --git a/exercises/roman-numerals/roman_numerals_test.sh b/exercises/roman-numerals/roman_numerals_test.sh
index cbf47c0e..d6201ce8 100755
--- a/exercises/roman-numerals/roman_numerals_test.sh
+++ b/exercises/roman-numerals/roman_numerals_test.sh
@@ -1,133 +1,133 @@
 #!/usr/bin/env bash
 
 @test "1 is a single I" {
-  #skip
+  #[[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash roman_numerals.sh 1
   [ "$status" -eq 0 ]
   [ "$output" == "I" ]
 }
 
 @test "2 is two I's" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash roman_numerals.sh 2
   [ "$status" -eq 0 ]
   [ "$output" == "II" ]
 }
 
 @test "3 is three I's" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash roman_numerals.sh 3
   [ "$status" -eq 0 ]
   [ "$output" == "III" ]
 }
 
 @test "4, being 5 - 1, is IV" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash roman_numerals.sh 4
   [ "$status" -eq 0 ]
   [ "$output" == "IV" ]
 }
 
 @test "5 is a single V" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash roman_numerals.sh 5
   [ "$status" -eq 0 ]
   [ "$output" == "V" ]
 }
 
 @test "6, being 5 + 1, is VI" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash roman_numerals.sh 6
   [ "$status" -eq 0 ]
   [ "$output" == "VI" ]
 }
 
 @test "9, being 10 - 1, is IX" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash roman_numerals.sh 9
   [ "$status" -eq 0 ]
   [ "$output" == "IX" ]
 }
 
 @test "20 is two X's" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash roman_numerals.sh 27
   [ "$status" -eq 0 ]
   [ "$output" == "XXVII" ]
 }
 
 @test "48 is not 50 - 2 but rather 40 + 8" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash roman_numerals.sh 48
   [ "$status" -eq 0 ]
   [ "$output" == "XLVIII" ]
 }
 
 @test "49 is not 40 + 5 + 4 but rather 50 - 10 + 10 - 1" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash roman_numerals.sh 49
   [ "$status" -eq 0 ]
   [ "$output" == "XLIX" ]
 }
 
 @test "50 is a single L" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash roman_numerals.sh 59
   [ "$status" -eq 0 ]
   [ "$output" == "LIX" ]
 }
 
 @test "90, being 100 - 10, is XC" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash roman_numerals.sh 93
   [ "$status" -eq 0 ]
   [ "$output" == "XCIII" ]
 }
 
 @test "100 is a single C" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash roman_numerals.sh 141
   [ "$status" -eq 0 ]
   [ "$output" == "CXLI" ]
 }
 
 @test "60, being 50 + 10, is LX" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash roman_numerals.sh 163
   [ "$status" -eq 0 ]
   [ "$output" == "CLXIII" ]
 }
 
 @test "400, being 500 - 100, is CD" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash roman_numerals.sh 402
   [ "$status" -eq 0 ]
   [ "$output" == "CDII" ]
 }
 
 @test "500 is a single D" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash roman_numerals.sh 575
   [ "$status" -eq 0 ]
   [ "$output" == "DLXXV" ]
 }
 
 @test "900, being 1000 - 100, is CM" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash roman_numerals.sh 911
   [ "$status" -eq 0 ]
   [ "$output" == "CMXI" ]
 }
 
 @test "1000 is a single M" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash roman_numerals.sh 1024
   [ "$status" -eq 0 ]
   [ "$output" == "MXXIV" ]
 }
 
 @test "3000 is three M's" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash roman_numerals.sh 3000
   [ "$status" -eq 0 ]
   [ "$output" == "MMM" ]
diff --git a/exercises/rotational-cipher/README.md b/exercises/rotational-cipher/README.md
index 040e2bea..b1da09aa 100644
--- a/exercises/rotational-cipher/README.md
+++ b/exercises/rotational-cipher/README.md
@@ -30,14 +30,19 @@ Ciphertext is written out in the same formatting as the input including spaces a
 - ROT13 `The quick brown fox jumps over the lazy dog.` gives `Gur dhvpx oebja sbk whzcf bire gur ynml qbt.`
 - ROT13 `Gur dhvpx oebja sbk whzcf bire gur ynml qbt.` gives `The quick brown fox jumps over the lazy dog.`
 
-
 Run the tests with:
 
 ```bash
 bats rotational_cipher_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
+
+To run all tests, including the ones with `skip` annotations, run:
+
+```bash
+BATS_RUN_SKIPPED=true bats rotational_cipher_test.sh
+```
 
 ## Source
 
diff --git a/exercises/rotational-cipher/rotational_cipher_test.sh b/exercises/rotational-cipher/rotational_cipher_test.sh
index 3fa9942b..7131a1a5 100644
--- a/exercises/rotational-cipher/rotational_cipher_test.sh
+++ b/exercises/rotational-cipher/rotational_cipher_test.sh
@@ -1,7 +1,7 @@
 #!/usr/bin/env bash
 
 @test "rotate a by 0, same output as input" {
-    #skip
+    #[[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="a"
     run bash rotational_cipher.sh "a" 0
     [[ $status -eq 0 ]]
@@ -9,7 +9,7 @@
 }
 
 @test "rotate a by 1" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="b"
     run bash rotational_cipher.sh "a" 1
     [[ $status -eq 0 ]]
@@ -17,7 +17,7 @@
 }
 
 @test "rotate a by 26, same output as input" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="a"
     run bash rotational_cipher.sh "a" 26
     [[ $status -eq 0 ]]
@@ -25,7 +25,7 @@
 }
 
 @test "rotate m by 13" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="z"
     run bash rotational_cipher.sh "m" 13
     [[ $status -eq 0 ]]
@@ -33,7 +33,7 @@
 }
 
 @test "rotate n by 13 with wrap around alphabet" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="a"
     run bash rotational_cipher.sh "n" 13
     [[ $status -eq 0 ]]
@@ -41,7 +41,7 @@
 }
 
 @test "rotate capital letters" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="TRL"
     run bash rotational_cipher.sh "OMG" 5
     [[ $status -eq 0 ]]
@@ -49,7 +49,7 @@
 }
 
 @test "rotate spaces" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="T R L"
     run bash rotational_cipher.sh "O M G" 5
     [[ $status -eq 0 ]]
@@ -57,7 +57,7 @@
 }
 
 @test "rotate numbers" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="Xiwxmrk 1 2 3 xiwxmrk"
     run bash rotational_cipher.sh "Testing 1 2 3 testing" 4
     [[ $status -eq 0 ]]
@@ -65,7 +65,7 @@
 }
 
 @test "rotate punctuation" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="Gzo'n zvo, Bmviyhv!"
     run bash rotational_cipher.sh "Let's eat, Grandma!" 21
     [[ $status -eq 0 ]]
@@ -73,7 +73,7 @@
 }
 
 @test "rotate all letters" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="Gur dhvpx oebja sbk whzcf bire gur ynml qbt."
     run bash rotational_cipher.sh "The quick brown fox jumps over the lazy dog." 13
     [[ $status -eq 0 ]]
diff --git a/exercises/run-length-encoding/README.md b/exercises/run-length-encoding/README.md
index 5e24ba7a..7da06ef7 100644
--- a/exercises/run-length-encoding/README.md
+++ b/exercises/run-length-encoding/README.md
@@ -23,14 +23,19 @@ the letters A through Z (either lower or upper case) and whitespace. This way
 data to be encoded will never contain any numbers and numbers inside data to
 be decoded always represent the count for the following character.
 
-
 Run the tests with:
 
 ```bash
 bats run_length_encoding_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
+
+To run all tests, including the ones with `skip` annotations, run:
+
+```bash
+BATS_RUN_SKIPPED=true bats run_length_encoding_test.sh
+```
 
 ## Source
 
diff --git a/exercises/run-length-encoding/run_length_encoding_test.sh b/exercises/run-length-encoding/run_length_encoding_test.sh
index e101e7b7..22dcd5e7 100644
--- a/exercises/run-length-encoding/run_length_encoding_test.sh
+++ b/exercises/run-length-encoding/run_length_encoding_test.sh
@@ -3,7 +3,7 @@
 # run-length encode a string
 
 @test "encode empty string" {
-    #skip
+    #[[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=""
     run bash run_length_encoding.sh encode ""
     [[ $status -eq 0 ]]
@@ -11,7 +11,7 @@
 }
 
 @test "encode single characters only are encoded without count" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="XYZ"
     run bash run_length_encoding.sh encode "XYZ"
     [[ $status -eq 0 ]]
@@ -19,7 +19,7 @@
 }
 
 @test "encode string with no single characters" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="2A3B4C"
     run bash run_length_encoding.sh encode "AABBBCCCC"
     [[ $status -eq 0 ]]
@@ -27,7 +27,7 @@
 }
 
 @test "encode single characters mixed with repeated characters" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="12WB12W3B24WB"
     run bash run_length_encoding.sh encode "WWWWWWWWWWWWBWWWWWWWWWWWWBBBWWWWWWWWWWWWWWWWWWWWWWWWB"
     [[ $status -eq 0 ]]
@@ -35,7 +35,7 @@
 }
 
 @test "encode multiple whitespace mixed in string" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="2 hs2q q2w2 "
     run bash run_length_encoding.sh encode "  hsqq qww  "
     [[ $status -eq 0 ]]
@@ -43,7 +43,7 @@
 }
 
 @test "encode lowercase characters" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="2a3b4c"
     run bash run_length_encoding.sh encode "aabbbcccc"
     [[ $status -eq 0 ]]
@@ -53,7 +53,7 @@
 # run-length decode a string
 
 @test "decode empty string" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=""
     run bash run_length_encoding.sh decode ""
     [[ $status -eq 0 ]]
@@ -61,7 +61,7 @@
 }
 
 @test "single characters only" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="XYZ"
     run bash run_length_encoding.sh decode "XYZ"
     [[ $status -eq 0 ]]
@@ -69,7 +69,7 @@
 }
 
 @test "decode string with no single characters" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="AABBBCCCC"
     run bash run_length_encoding.sh decode "2A3B4C"
     [[ $status -eq 0 ]]
@@ -77,7 +77,7 @@
 }
 
 @test "decode single characters with repeated characters" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="WWWWWWWWWWWWBWWWWWWWWWWWWBBBWWWWWWWWWWWWWWWWWWWWWWWWB"
     run bash run_length_encoding.sh decode "12WB12W3B24WB"
     [[ $status -eq 0 ]]
@@ -85,7 +85,7 @@
 }
 
 @test "decode multiple whitespace mixed in string" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="  hsqq qww  "
     run bash run_length_encoding.sh decode "2 hs2q q2w2 "
     [[ $status -eq 0 ]]
@@ -93,7 +93,7 @@
 }
 
 @test "decode lower case string" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="aabbbcccc"
     run bash run_length_encoding.sh decode "2a3b4c"
     [[ $status -eq 0 ]]
@@ -103,7 +103,7 @@
 # encode and then decode
 
 @test "encode followed by decode gives original string" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="zzz ZZ  zZ"
     run bash run_length_encoding.sh encode "zzz ZZ  zZ"
     [[ $status -eq 0 ]]
diff --git a/exercises/say/README.md b/exercises/say/README.md
index f5519a4d..bdd51d67 100644
--- a/exercises/say/README.md
+++ b/exercises/say/README.md
@@ -62,14 +62,19 @@ Use _and_ (correctly) when spelling out the number in English:
 - 1002 becomes "one thousand and two".
 - 1323 becomes "one thousand three hundred and twenty-three".
 
-
 Run the tests with:
 
 ```bash
 bats say_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
+
+To run all tests, including the ones with `skip` annotations, run:
+
+```bash
+BATS_RUN_SKIPPED=true bats say_test.sh
+```
 
 ## Source
 
diff --git a/exercises/say/say_test.sh b/exercises/say/say_test.sh
index bceb6733..a4c78598 100644
--- a/exercises/say/say_test.sh
+++ b/exercises/say/say_test.sh
@@ -1,105 +1,105 @@
 #!/usr/bin/env bash
 
 @test zero {
-    #skip
+    #[[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash say.sh 0
     [[ $status -eq 0 ]]
     [[ $output == "zero" ]]
 }
 
 @test one {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash say.sh 1
     [[ $status -eq 0 ]]
     [[ $output == "one" ]]
 }
 
 @test fourteen {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash say.sh 14
     [[ $status -eq 0 ]]
     [[ $output == "fourteen" ]]
 }
 
 @test twenty {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash say.sh 20
     [[ $status -eq 0 ]]
     [[ $output == "twenty" ]]
 }
 
 @test "twenty-two" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash say.sh 22
     [[ $status -eq 0 ]]
     [[ $output == "twenty-two" ]]
 }
 
 @test "one hundred" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash say.sh 100
     [[ $status -eq 0 ]]
     [[ $output == "one hundred" ]]
 }
 
 @test "one hundred twenty-three" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash say.sh 123
     [[ $status -eq 0 ]]
     [[ $output == "one hundred twenty-three" ]]
 }
 
 @test "one thousand" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash say.sh 1000
     [[ $status -eq 0 ]]
     [[ $output == "one thousand" ]]
 }
 
 @test "one thousand two hundred thirty-four" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash say.sh 1234
     [[ $status -eq 0 ]]
     [[ $output == "one thousand two hundred thirty-four" ]]
 }
 
 @test "one million" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash say.sh 1000000
     [[ $status -eq 0 ]]
     [[ $output == "one million" ]]
 }
 
 @test "one million two thousand three hundred forty-five" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash say.sh 1002345
     [[ $status -eq 0 ]]
     [[ $output == "one million two thousand three hundred forty-five" ]]
 }
 
 @test "one billion" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash say.sh 1000000000
     [[ $status -eq 0 ]]
     [[ $output == "one billion" ]]
 }
 
 @test "a big number" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash say.sh  987654321123
     [[ $status -eq 0 ]]
     [[ $output == "nine hundred eighty-seven billion six hundred fifty-four million three hundred twenty-one thousand one hundred twenty-three" ]]
 }
 
 @test "numbers below zero are out of range" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash say.sh -1
     [[ $status -eq 1 ]]
     [[ $output == "input out of range" ]]
 }
 
 @test "numbers above 999,999,999,999 are out of range" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash say.sh 1000000000000
     [[ $status -eq 1 ]]
     [[ $output == "input out of range" ]]
diff --git a/exercises/scrabble-score/scrabble_score_test.sh b/exercises/scrabble-score/scrabble_score_test.sh
index 269f8098..51513514 100755
--- a/exercises/scrabble-score/scrabble_score_test.sh
+++ b/exercises/scrabble-score/scrabble_score_test.sh
@@ -1,7 +1,7 @@
 #!/usr/bin/env bash
 
 @test 'lowercase letter' {
-  #skip
+  #[[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash scrabble_score.sh 'a'
   
   [ "$status" -eq 0 ]
@@ -9,7 +9,7 @@
 }
 
 @test 'uppercase letter' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash scrabble_score.sh 'A'
   
   [ "$status" -eq 0 ]
@@ -17,7 +17,7 @@
 }
 
 @test 'valuable letter' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash scrabble_score.sh 'f'
   
   [ "$status" -eq 0 ]
@@ -25,7 +25,7 @@
 }
 
 @test 'short word' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash scrabble_score.sh 'at'
   
   [ "$status" -eq 0 ]
@@ -33,7 +33,7 @@
 }
 
 @test 'short, valuable word' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash scrabble_score.sh 'zoo'
   
   [ "$status" -eq 0 ]
@@ -41,7 +41,7 @@
 }
 
 @test 'medium word' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash scrabble_score.sh 'street'
   
   [ "$status" -eq 0 ]
@@ -49,7 +49,7 @@
 }
 
 @test 'medium, valuable word' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash scrabble_score.sh 'quirky'
   
   [ "$status" -eq 0 ]
@@ -57,7 +57,7 @@
 }
 
 @test 'long, mixed-case word' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash scrabble_score.sh 'OxyphenButazone'
   
   [ "$status" -eq 0 ]
@@ -65,7 +65,7 @@
 }
 
 @test 'english-like word' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash scrabble_score.sh 'pinata'
   
   [ "$status" -eq 0 ]
@@ -73,7 +73,7 @@
 }
 
 @test 'empty input' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash scrabble_score.sh ''
   
   [ "$status" -eq 0 ]
@@ -81,7 +81,7 @@
 }
 
 @test 'entire alphabet available' {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash scrabble_score.sh 'abcdefghijklmnopqrstuvwxyz'
   
   [ "$status" -eq 0 ]
diff --git a/exercises/secret-handshake/README.md b/exercises/secret-handshake/README.md
index 8bb2ee96..31bf929e 100644
--- a/exercises/secret-handshake/README.md
+++ b/exercises/secret-handshake/README.md
@@ -28,14 +28,19 @@ Given the input 19, the function would return the array
 Notice that the addition of 16 (10000 in binary)
 has caused the array to be reversed.
 
-
 Run the tests with:
 
 ```bash
 bats secret_handshake_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
+
+To run all tests, including the ones with `skip` annotations, run:
+
+```bash
+BATS_RUN_SKIPPED=true bats secret_handshake_test.sh
+```
 
 ## Source
 
diff --git a/exercises/secret-handshake/secret_handshake_test.sh b/exercises/secret-handshake/secret_handshake_test.sh
index d9881063..608172d9 100644
--- a/exercises/secret-handshake/secret_handshake_test.sh
+++ b/exercises/secret-handshake/secret_handshake_test.sh
@@ -1,77 +1,77 @@
 #!/usr/bin/env bash
 
 @test "wink for 1" {
-    #skip
+    #[[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash secret_handshake.sh 1
     [[ $status -eq 0 ]]
     [[ $output == "wink" ]]
 }
 
 @test "double blink for 10" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash secret_handshake.sh 2
     [[ $status -eq 0 ]]
     [[ $output == "double blink" ]]
 }
 
 @test "close your eyes for 100" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash secret_handshake.sh 4
     [[ $status -eq 0 ]]
     [[ $output == "close your eyes" ]]
 }
 
 @test "jump for 1000" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash secret_handshake.sh 8
     [[ $status -eq 0 ]]
     [[ $output == "jump" ]]
 }
 
 @test "combine two actions" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash secret_handshake.sh 3
     [[ $status -eq 0 ]]
     [[ $output == "wink,double blink" ]]
 }
 
 @test "all possible actions" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash secret_handshake.sh 15
     [[ $status -eq 0 ]]
     [[ $output == "wink,double blink,close your eyes,jump" ]]
 }
 
 @test "do nothing for zero" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash secret_handshake.sh 0
     [[ $status -eq 0 ]]
     [[ $output == "" ]]
 }
 
 @test "reversing no actions still gives no actions" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash secret_handshake.sh 16
     [[ $status -eq 0 ]]
     [[ $output == "" ]]
 }
 
 @test "reversing one action gives the same action" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash secret_handshake.sh 24
     [[ $status -eq 0 ]]
     [[ $output == "jump" ]]
 }
 
 @test "reverse two actions" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash secret_handshake.sh 19
     [[ $status -eq 0 ]]
     [[ $output == "double blink,wink" ]]
 }
 
 @test "reverse all possible actions" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash secret_handshake.sh 31
     [[ $status -eq 0 ]]
     [[ $output == "jump,close your eyes,double blink,wink" ]]
diff --git a/exercises/series/README.md b/exercises/series/README.md
index 05037111..f8c682c5 100644
--- a/exercises/series/README.md
+++ b/exercises/series/README.md
@@ -20,14 +20,19 @@ whatever you get.
 Note that these series are only required to occupy *adjacent positions*
 in the input; the digits need not be *numerically consecutive*.
 
-
 Run the tests with:
 
 ```bash
 bats series_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
+
+To run all tests, including the ones with `skip` annotations, run:
+
+```bash
+BATS_RUN_SKIPPED=true bats series_test.sh
+```
 
 ## Source
 
diff --git a/exercises/series/series_test.sh b/exercises/series/series_test.sh
index 3b72add8..f01cb365 100644
--- a/exercises/series/series_test.sh
+++ b/exercises/series/series_test.sh
@@ -1,7 +1,7 @@
 #!/usr/bin/env bash
 
 @test "slices of one from one" {
-    #skip
+    #[[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=(1)
     run bash series.sh 1 1
     [[ $status -eq 0 ]]
@@ -9,7 +9,7 @@
 }
 
 @test "slices of one from two" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=(1 2)
     run bash series.sh 12 1
     [[ $status -eq 0 ]]
@@ -17,7 +17,7 @@
 }
 
 @test "slices of two" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=(35)
     run bash series.sh 35 2
     [[ $status -eq 0 ]]
@@ -25,7 +25,7 @@
 }
 
 @test "slices of two overlap" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=(91 14 42)
     run bash series.sh 9142 2
     [[ $status -eq 0 ]]
@@ -33,7 +33,7 @@
 }
 
 @test "slices can include duplicates" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=(777 777 777 777)
     run bash series.sh 777777 3
     [[ $status -eq 0 ]]
@@ -41,7 +41,7 @@
 }
 
 @test "slices of a long series" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=(91849 18493 84939 49390 93904 39042 90424 04243)
     run bash series.sh 918493904243 5
     [[ $status -eq 0 ]]
@@ -49,7 +49,7 @@
 }
 
 @test "slice length is too large" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="slice length cannot be greater than series length"
     run bash series.sh 12345 6
     [[ $status -eq 1 ]]
@@ -57,7 +57,7 @@
 }
 
 @test "slice length cannot be zero" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="slice length cannot be zero"
     run bash series.sh 12345 0
     [[ $status -eq 1 ]]
@@ -65,7 +65,7 @@
 }
 
 @test "slice length cannot be negative" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="slice length cannot be negative"
     run bash series.sh 123 -1
     [[ $status -eq 1 ]]
@@ -73,7 +73,7 @@
 }
 
 @test "empty series is invalid" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="series cannot be empty"
     run bash series.sh "" 1
     [[ $status -eq 1 ]]
diff --git a/exercises/sieve/README.md b/exercises/sieve/README.md
index 0903584a..aff4efc4 100644
--- a/exercises/sieve/README.md
+++ b/exercises/sieve/README.md
@@ -29,14 +29,19 @@ correct list of primes. A good first test is to check that you do not use
 division or remainder operations (div, /, mod or % depending on the
 language).
 
-
 Run the tests with:
 
 ```bash
 bats sieve_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
+
+To run all tests, including the ones with `skip` annotations, run:
+
+```bash
+BATS_RUN_SKIPPED=true bats sieve_test.sh
+```
 
 ## Source
 
diff --git a/exercises/sieve/sieve_test.sh b/exercises/sieve/sieve_test.sh
index 6a3acb92..44826386 100644
--- a/exercises/sieve/sieve_test.sh
+++ b/exercises/sieve/sieve_test.sh
@@ -1,7 +1,7 @@
 #!/usr/bin/env bash
 
 @test "no primes under two" {
-    #skip
+    #[[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=()
     run bash sieve.sh 1
     [[ $status -eq 0 ]]
@@ -9,7 +9,7 @@
 }
 
 @test "find first prime" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=(2)
     run bash sieve.sh 2
     [[ $status -eq 0 ]]
@@ -17,7 +17,7 @@
 }
 
 @test "find primes up to 10" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=(2 3 5 7)
     run bash sieve.sh 10
     [[ $status -eq 0 ]]
@@ -25,7 +25,7 @@
 }
 
 @test "limit is prime" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=(2 3 5 7 11 13)
     run bash sieve.sh 13
     [[ $status -eq 0 ]]
@@ -33,7 +33,7 @@
 }
 
 @test "find primes up to 1000" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=(
           2   3   5   7  11  13  17  19  23  29  31  37  41  43
          47  53  59  61  67  71  73  79  83  89  97 101 103 107
diff --git a/exercises/space-age/README.md b/exercises/space-age/README.md
index 99962eaa..84f6a30d 100644
--- a/exercises/space-age/README.md
+++ b/exercises/space-age/README.md
@@ -17,14 +17,19 @@ be able to say that they're 31.69 Earth-years old.
 If you're wondering why Pluto didn't make the cut, go watch [this
 youtube video](http://www.youtube.com/watch?v=Z_2gbGXzFbs).
 
-
 Run the tests with:
 
 ```bash
 bats space_age_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
+
+To run all tests, including the ones with `skip` annotations, run:
+
+```bash
+BATS_RUN_SKIPPED=true bats space_age_test.sh
+```
 
 ## Source
 
diff --git a/exercises/space-age/space_age_test.sh b/exercises/space-age/space_age_test.sh
index 8ca27e45..a6c153de 100644
--- a/exercises/space-age/space_age_test.sh
+++ b/exercises/space-age/space_age_test.sh
@@ -1,7 +1,7 @@
 #!/usr/bin/env bash
 
 @test "age on Earth" {
-    #skip
+    #[[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=31.69
     run bash space_age.sh "Earth" 1000000000
     [[ $status -eq 0 ]]
@@ -9,7 +9,7 @@
 }
 
 @test "age on Mercury" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=280.88
     run bash space_age.sh "Mercury" 2134835688
     [[ $status -eq 0 ]]
@@ -17,7 +17,7 @@
 }
 
 @test "age on Venus" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=9.78
     run bash space_age.sh "Venus" 189839836
     [[ $status -eq 0 ]]
@@ -25,7 +25,7 @@
 }
 
 @test "age on Mars" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=35.88
     run bash space_age.sh "Mars" 2129871239
     [[ $status -eq 0 ]]
@@ -33,7 +33,7 @@
 }
 
 @test "age on Jupiter" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=2.41
     run bash space_age.sh "Jupiter" 901876382
     [[ $status -eq 0 ]]
@@ -41,7 +41,7 @@
 }
 
 @test "age on Saturn" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=2.15
     run bash space_age.sh "Saturn" 2000000000
     [[ $status -eq 0 ]]
@@ -49,7 +49,7 @@
 }
 
 @test "age on Uranus" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=0.46
     run bash space_age.sh "Uranus" 1210123456
     [[ $status -eq 0 ]]
@@ -57,7 +57,7 @@
 }
 
 @test "age on Neptune" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=0.35
     run bash space_age.sh "Neptune" 1821023456
     [[ $status -eq 0 ]]
@@ -65,7 +65,7 @@
 }
 
 @test "not a planet" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="not a planet"
     run bash space_age.sh "Pluto" 1821023456
     [[ $status -eq 1 ]]
diff --git a/exercises/triangle/triangle_test.sh b/exercises/triangle/triangle_test.sh
index 602a1849..0f0ad119 100755
--- a/exercises/triangle/triangle_test.sh
+++ b/exercises/triangle/triangle_test.sh
@@ -3,28 +3,28 @@
 # Test returns true if the triangle is equilateral
 
 @test "true if all sides are equal" {
-  #skip
+  #[[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash triangle.sh equilateral 2 2 2
   [ "$status" -eq 0 ]
   [ "$output" == "true" ]
 }
 
 @test "false if any side is unequal" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash triangle.sh equilateral 2 3 2
   [ "$status" -eq 0 ]
   [ "$output" == "false" ]
 }
 
 @test "false if no sides are equal" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash triangle.sh equilateral 5 4 6
   [ "$status" -eq 0 ]
   [ "$output" == "false" ]
 }
 
 @test "All zero sides are illegal, so the triangle is not equilateral" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash triangle.sh equilateral 0 0 0
   [ "$status" -eq 0 ]
   [ "$output" == "false" ]
@@ -33,7 +33,7 @@
 # Bonus: deal with floats
 
 @test "sides may be floats" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash triangle.sh equilateral 0.5 0.5 0.5
   [ "$status" -eq 0 ]
   [ "$output" == "true" ]
@@ -42,42 +42,42 @@
 # Test returns true if the triangle is isosceles
 
 @test "true if last two sides are equal" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash triangle.sh isosceles 3 4 4
   [ "$status" -eq 0 ]
   [ "$output" == "true" ]
 }
 
 @test "true if first two sides are equal" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash triangle.sh isosceles 4 4 3
   [ "$status" -eq 0 ]
   [ "$output" == "true" ]
 }
 
 @test "true if first and last sides are equal" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash triangle.sh isosceles 4 3 4
   [ "$status" -eq 0 ]
   [ "$output" == "true" ]
 }
 
 @test "equilateral triangles are also isosceles" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash triangle.sh isosceles 4 4 4
   [ "$status" -eq 0 ]
   [ "$output" == "true" ]
 }
 
 @test "false if no sides are equal" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash triangle.sh isosceles 2 3 4
   [ "$status" -eq 0 ]
   [ "$output" == "false" ]
 }
 
 @test "Sides that violate triangle inequality are not isosceles, even if two are equal" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash triangle.sh isosceles 1 1 3
   [ "$status" -eq 0 ]
   [ "$output" == "false" ]
@@ -86,7 +86,7 @@
 # Bonus: deal with floats
 
 @test "sides may be floats" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash triangle.sh isosceles 0.5 0.4 0.5
   [ "$status" -eq 0 ]
   [ "$output" == "true" ]
@@ -95,28 +95,28 @@
 # Test returns true if the triangle is scalene
 
 @test "true if no sides are equal" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash triangle.sh scalene 5 4 6
   [ "$status" -eq 0 ]
   [ "$output" == "true" ]
 }
 
 @test "false if all sides are equal" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash triangle.sh scalene 4 4 4
   [ "$status" -eq 0 ]
   [ "$output" == "false" ]
 }
 
 @test "false if two sides are equal" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash triangle.sh scalene 4 4 3
   [ "$status" -eq 0 ]
   [ "$output" == "false" ]
 }
 
 @test "Sides that violate triangle inequality are not scalene, even if they are all different" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash triangle.sh scalene 7 3 2
   [ "$status" -eq 0 ]
   [ "$output" == "false" ]
@@ -125,7 +125,7 @@
 # Bonus: deal with floats
 
 @test "sides may be floats" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash triangle.sh scalene 0.5 0.4 0.6
   [ "$status" -eq 0 ]
   [ "$output" == "true" ]
diff --git a/exercises/twelve-days/README.md b/exercises/twelve-days/README.md
index d0372520..ce8817bc 100644
--- a/exercises/twelve-days/README.md
+++ b/exercises/twelve-days/README.md
@@ -28,14 +28,19 @@ On the eleventh day of Christmas my true love gave to me: eleven Pipers Piping,
 On the twelfth day of Christmas my true love gave to me: twelve Drummers Drumming, eleven Pipers Piping, ten Lords-a-Leaping, nine Ladies Dancing, eight Maids-a-Milking, seven Swans-a-Swimming, six Geese-a-Laying, five Gold Rings, four Calling Birds, three French Hens, two Turtle Doves, and a Partridge in a Pear Tree.
 ```
 
-
 Run the tests with:
 
 ```bash
 bats twelve_days_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
+
+To run all tests, including the ones with `skip` annotations, run:
+
+```bash
+BATS_RUN_SKIPPED=true bats twelve_days_test.sh
+```
 
 ## Source
 
diff --git a/exercises/twelve-days/twelve_days_test.sh b/exercises/twelve-days/twelve_days_test.sh
index 421e780e..0a8e0f54 100644
--- a/exercises/twelve-days/twelve_days_test.sh
+++ b/exercises/twelve-days/twelve_days_test.sh
@@ -1,7 +1,7 @@
 #!/usr/bin/env bash
 
 @test "first day a partridge in a pear tree" {
-    #skip
+    #[[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 On the first day of Christmas my true love gave to me: a Partridge in a Pear Tree.
 END
@@ -12,7 +12,7 @@ END
 }
 
 @test "second day two turtle doves" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 On the second day of Christmas my true love gave to me: two Turtle Doves, and a Partridge in a Pear Tree.
 END
@@ -23,7 +23,7 @@ END
     }
 
 @test "third day three french hens" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 On the third day of Christmas my true love gave to me: three French Hens, two Turtle Doves, and a Partridge in a Pear Tree.
 END
@@ -34,7 +34,7 @@ END
     }
 
 @test "fourth day four calling birds" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 On the fourth day of Christmas my true love gave to me: four Calling Birds, three French Hens, two Turtle Doves, and a Partridge in a Pear Tree.
 END
@@ -45,7 +45,7 @@ END
     }
 
 @test "fifth day five gold rings" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 On the fifth day of Christmas my true love gave to me: five Gold Rings, four Calling Birds, three French Hens, two Turtle Doves, and a Partridge in a Pear Tree.
 END
@@ -56,7 +56,7 @@ END
     }
 
 @test "sixth day six geese-a-laying" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 On the sixth day of Christmas my true love gave to me: six Geese-a-Laying, five Gold Rings, four Calling Birds, three French Hens, two Turtle Doves, and a Partridge in a Pear Tree.
 END
@@ -67,7 +67,7 @@ END
     }
 
 @test "seventh day seven swans-a-swimming" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 On the seventh day of Christmas my true love gave to me: seven Swans-a-Swimming, six Geese-a-Laying, five Gold Rings, four Calling Birds, three French Hens, two Turtle Doves, and a Partridge in a Pear Tree.
 END
@@ -78,7 +78,7 @@ END
     }
 
 @test "eighth day eight maids-a-milking" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 On the eighth day of Christmas my true love gave to me: eight Maids-a-Milking, seven Swans-a-Swimming, six Geese-a-Laying, five Gold Rings, four Calling Birds, three French Hens, two Turtle Doves, and a Partridge in a Pear Tree.
 END
@@ -89,7 +89,7 @@ END
     }
 
 @test "ninth day nine ladies dancing" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 On the ninth day of Christmas my true love gave to me: nine Ladies Dancing, eight Maids-a-Milking, seven Swans-a-Swimming, six Geese-a-Laying, five Gold Rings, four Calling Birds, three French Hens, two Turtle Doves, and a Partridge in a Pear Tree.
 END
@@ -100,7 +100,7 @@ END
     }
 
 @test "tenth day ten lords-a-leaping" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 On the tenth day of Christmas my true love gave to me: ten Lords-a-Leaping, nine Ladies Dancing, eight Maids-a-Milking, seven Swans-a-Swimming, six Geese-a-Laying, five Gold Rings, four Calling Birds, three French Hens, two Turtle Doves, and a Partridge in a Pear Tree.
 END
@@ -111,7 +111,7 @@ END
     }
 
 @test "eleventh day eleven pipers piping" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 On the eleventh day of Christmas my true love gave to me: eleven Pipers Piping, ten Lords-a-Leaping, nine Ladies Dancing, eight Maids-a-Milking, seven Swans-a-Swimming, six Geese-a-Laying, five Gold Rings, four Calling Birds, three French Hens, two Turtle Doves, and a Partridge in a Pear Tree.
 END
@@ -122,7 +122,7 @@ END
     }
 
 @test "twelfth day twelve drummers drumming" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 On the twelfth day of Christmas my true love gave to me: twelve Drummers Drumming, eleven Pipers Piping, ten Lords-a-Leaping, nine Ladies Dancing, eight Maids-a-Milking, seven Swans-a-Swimming, six Geese-a-Laying, five Gold Rings, four Calling Birds, three French Hens, two Turtle Doves, and a Partridge in a Pear Tree.
 END
@@ -133,7 +133,7 @@ END
     }
 
 @test "recites first three verses of the song" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 On the first day of Christmas my true love gave to me: a Partridge in a Pear Tree.
 On the second day of Christmas my true love gave to me: two Turtle Doves, and a Partridge in a Pear Tree.
@@ -146,7 +146,7 @@ END
 }
 
 @test "recites three verses from the middle of the song" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 On the fourth day of Christmas my true love gave to me: four Calling Birds, three French Hens, two Turtle Doves, and a Partridge in a Pear Tree.
 On the fifth day of Christmas my true love gave to me: five Gold Rings, four Calling Birds, three French Hens, two Turtle Doves, and a Partridge in a Pear Tree.
@@ -159,7 +159,7 @@ END
 }
 
 @test "recites the whole song" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected=$(cat <<END
 On the first day of Christmas my true love gave to me: a Partridge in a Pear Tree.
 On the second day of Christmas my true love gave to me: two Turtle Doves, and a Partridge in a Pear Tree.
diff --git a/exercises/two-bucket/README.md b/exercises/two-bucket/README.md
index a2b71ec9..f28817e6 100644
--- a/exercises/two-bucket/README.md
+++ b/exercises/two-bucket/README.md
@@ -29,14 +29,19 @@ To conclude, the only valid moves are:
 
 Written with <3 at [Fullstack Academy](http://www.fullstackacademy.com/) by Lindsay Levine.
 
-
 Run the tests with:
 
 ```bash
 bats two_bucket_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
+
+To run all tests, including the ones with `skip` annotations, run:
+
+```bash
+BATS_RUN_SKIPPED=true bats two_bucket_test.sh
+```
 
 ## Source
 
diff --git a/exercises/two-bucket/two_bucket_test.sh b/exercises/two-bucket/two_bucket_test.sh
index 5318120a..a1671d2a 100644
--- a/exercises/two-bucket/two_bucket_test.sh
+++ b/exercises/two-bucket/two_bucket_test.sh
@@ -1,7 +1,7 @@
 #!/usr/bin/env bash
 
 @test "Measure using bucket one of size 3 and bucket two of size 5 - start with bucket one" {
-    #skip
+    #[[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="moves: 4, goalBucket: one, otherBucket: 5"
     run bash two_bucket.sh 3 5 1 "one"
     [[ $status -eq 0 ]]
@@ -9,7 +9,7 @@
 }
 
 @test "Measure using bucket one of size 3 and bucket two of size 5 - start with bucket two" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="moves: 8, goalBucket: two, otherBucket: 3"
     run bash two_bucket.sh 3 5 1 "two"
     [[ $status -eq 0 ]]
@@ -17,7 +17,7 @@
 }
 
 @test "Measure using bucket one of size 7 and bucket two of size 11 - start with bucket one" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="moves: 14, goalBucket: one, otherBucket: 11"
     run bash two_bucket.sh 7 11 2 "one"
     [[ $status -eq 0 ]]
@@ -25,7 +25,7 @@
 }
 
 @test "Measure using bucket one of size 7 and bucket two of size 11 - start with bucket two" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="moves: 18, goalBucket: two, otherBucket: 7"
     run bash two_bucket.sh 7 11 2 "two"
     [[ $status -eq 0 ]]
@@ -33,7 +33,7 @@
 }
 
 @test "Measure one step using bucket one of size 1 and bucket two of size 3 - start with bucket two" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="moves: 1, goalBucket: two, otherBucket: 0"
     run bash two_bucket.sh 1 3 3 "two"
     [[ $status -eq 0 ]]
@@ -41,7 +41,7 @@
 }
 
 @test "Measure using bucket one of size 2 and bucket two of size 3 - start with bucket one and end with bucket two" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     expected="moves: 2, goalBucket: two, otherBucket: 2"
     run bash two_bucket.sh 2 3 3 "one"
     [[ $status -eq 0 ]]
@@ -50,14 +50,14 @@
 
 # error cases
 @test "goal is too big for the buckets" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash two_bucket.sh 1 2 3 "one"
     [[ $status -ne 0 ]]
     [[ $output == *"invalid goal"* ]]
 }
 
 @test "cannot satisfy the goal" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash two_bucket.sh 6 8 3 "one"
     [[ $status -ne 0 ]]
     [[ $output == *"invalid goal"* ]]
diff --git a/exercises/two-fer/README.md b/exercises/two-fer/README.md
index 506e568e..3e292eba 100644
--- a/exercises/two-fer/README.md
+++ b/exercises/two-fer/README.md
@@ -11,15 +11,19 @@ When X is a name or "you".
 If the given name is "Alice", the result should be "One for Alice, one for me."
 If no name is given, the result should be "One for you, one for me."
 
-
-
 Run the tests with:
 
 ```bash
 bats two_fer_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
+
+To run all tests, including the ones with `skip` annotations, run:
+
+```bash
+BATS_RUN_SKIPPED=true bats two_fer_test.sh
+```
 
 ## Source
 
diff --git a/exercises/two-fer/two_fer_test.sh b/exercises/two-fer/two_fer_test.sh
index f1e77399..2f2879df 100755
--- a/exercises/two-fer/two_fer_test.sh
+++ b/exercises/two-fer/two_fer_test.sh
@@ -1,28 +1,42 @@
 #!/usr/bin/env bash
 
 @test "no name given" {
-  #skip
+  # This is used to [[ $BATS_RUN_SKIPPED == true  ]] || skip the test
+  # normally, we [[ $BATS_RUN_SKIPPED == true  ]] || skip every test except for the first one
+  # (the first one is always commented out)
+  # this allows for a person to focus on solving a test at a time
+  # you can comment out or delete the
+  # `[[ $BATS_RUN_SKIPPED == true  ]] || [[ $BATS_RUN_SKIPPED == true  ]] || skip` to run the test
+  # when ready.
+  #
+  # You can also run the all the tests by setting the `$BATS_RUN_SKIPPED`
+  # environment variable, like this:
+  #
+  #     $ BATS_RUN_SKIPPED=true bats two_fer_test.sh
+  #
+
+  #[[ $BATS_RUN_SKIPPED == true  ]] || [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash two_fer.sh
   [ "$status" -eq 0 ]
   [ "$output" == "One for you, one for me." ]
 }
 
 @test "a name given" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash two_fer.sh Alice
   [ "$status" -eq 0 ]
   [ "$output" == "One for Alice, one for me." ]
 }
 
 @test "another name given" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash two_fer.sh Bob
   [ "$status" -eq 0 ]
   [ "$output" == "One for Bob, one for me." ]
 }
 
 @test "handle arg1 properly" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash two_fer.sh "John Smith" "Mary Ann"
   [ "$status" -eq 0 ]
   [ "$output" == "One for John Smith, one for me." ]
diff --git a/exercises/word-count/word_count_test.sh b/exercises/word-count/word_count_test.sh
index e1bd9237..9dfa37df 100644
--- a/exercises/word-count/word_count_test.sh
+++ b/exercises/word-count/word_count_test.sh
@@ -1,7 +1,7 @@
 #!/usr/bin/env bash
 
 @test "count one word" {
-  #skip
+  #[[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash word_count.sh "word"
   [ "$status" -eq 0 ]
   echo $output | grep "word: 1"
@@ -9,7 +9,7 @@
 }
 
 @test "count one of each word" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash word_count.sh "one of each"
   [ "$status" -eq 0 ]
   echo $output | grep "one: 1"
@@ -19,7 +19,7 @@
 }
 
 @test "multiple occurrences of a word" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash word_count.sh "one fish two fish red fish blue fish"
   [ "$status" -eq 0 ]
   echo $output | grep "one: 1"
@@ -31,7 +31,7 @@
 }
 
 @test "handles cramped lists" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash word_count.sh "one,two,three"
   [ "$status" -eq 0 ]
   echo $output | grep "one: 1"
@@ -41,7 +41,7 @@
 }
 
 @test "handles expanded lists" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash word_count.sh "one,\ntwo,\nthree"
   [ "$status" -eq 0 ]
   echo $output | grep "one: 1"
@@ -51,7 +51,7 @@
 }
 
 @test "ignore punctuation" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash word_count.sh "car: carpet as java: javascript!!&@$%^&"
   [ "$status" -eq 0 ]
   echo $output | grep "car: 1"
@@ -63,7 +63,7 @@
 }
 
 @test "include numbers" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash word_count.sh "testing, 1, 2 testing"
   [ "$status" -eq 0 ]
   echo $output | grep "testing: 2"
@@ -73,7 +73,7 @@
 }
 
 @test "normalize case" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash word_count.sh "go Go GO Stop stop"
   [ "$status" -eq 0 ]
   echo $output | grep "go: 3"
@@ -82,7 +82,7 @@
 }
 
 @test "with apostrophes" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash word_count.sh "First: don't laugh. Then: don't cry."
   [ "$status" -eq 0 ]
   echo $output | grep "first: 1"
@@ -94,7 +94,7 @@
 }
 
 @test "with quotations" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash word_count.sh "Joe can't tell between 'large' and large."
   [ "$status" -eq 0 ]
   echo $output | grep "joe: 1"
@@ -107,7 +107,7 @@
 }
 
 @test "multiple spaces not detected as a word" {
-  skip
+  [[ $BATS_RUN_SKIPPED == true  ]] || skip
   run bash word_count.sh " multiple   whitespaces"
   [ "$status" -eq 0 ]
   echo $output | grep "multiple: 1"
diff --git a/exercises/yacht/README.md b/exercises/yacht/README.md
index 6ea41260..36863fbf 100644
--- a/exercises/yacht/README.md
+++ b/exercises/yacht/README.md
@@ -36,14 +36,19 @@ of the category your solution should return 0. You can assume that five values
 will always be presented, and the value of each will be between one and six
 inclusively. You should not assume that the dice are ordered.
 
-
 Run the tests with:
 
 ```bash
 bats yacht_test.sh
 ```
 
-After the first test(s) pass, continue by commenting out or removing the `skip` annotations prepending other tests.
+After the first test(s) pass, continue by commenting out or removing the `[[ $BATS_RUN_SKIPPED == true  ]] || skip` annotations prepending other tests.
+
+To run all tests, including the ones with `skip` annotations, run:
+
+```bash
+BATS_RUN_SKIPPED=true bats yacht_test.sh
+```
 
 ## Source
 
diff --git a/exercises/yacht/yacht_test.sh b/exercises/yacht/yacht_test.sh
index db6cd7c1..fb985aa6 100644
--- a/exercises/yacht/yacht_test.sh
+++ b/exercises/yacht/yacht_test.sh
@@ -1,196 +1,196 @@
 #!/usr/bin/env bash
 
 @test "Yacht" {
-    #skip
+    #[[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash yacht.sh "yacht" 5 5 5 5 5
     [[ $status -eq 0 ]]
     [[ $output == "50" ]]
 }
 
 @test "Not Yacht" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash yacht.sh "yacht" 1 3 3 2 5
     [[ $status -eq 0 ]]
     [[ $output == "0" ]]
 }
 
 @test "Ones" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash yacht.sh "ones" 1 1 1 3 5
     [[ $status -eq 0 ]]
     [[ $output == "3" ]]
 }
 
 @test "Ones, out of order" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash yacht.sh "ones" 3 1 1 5 1
     [[ $status -eq 0 ]]
     [[ $output == "3" ]]
 }
 
 @test "No ones" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash yacht.sh "ones" 4 3 6 5 5
     [[ $status -eq 0 ]]
     [[ $output == "0" ]]
 }
 
 @test "Twos" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash yacht.sh "twos" 2 3 4 5 6
     [[ $status -eq 0 ]]
     [[ $output == "2" ]]
 }
 
 @test "Fours" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash yacht.sh "fours" 1 4 1 4 1
     [[ $status -eq 0 ]]
     [[ $output == "8" ]]
 }
 
 @test "Yacht counted as threes" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash yacht.sh "threes" 3 3 3 3 3
     [[ $status -eq 0 ]]
     [[ $output == "15" ]]
 }
 
 @test "Yacht of 3s counted as fives" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash yacht.sh "fives" 3 3 3 3 3
     [[ $status -eq 0 ]]
     [[ $output == "0" ]]
 }
 
 @test "Sixes" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash yacht.sh "sixes" 2 3 4 5 6
     [[ $status -eq 0 ]]
     [[ $output == "6" ]]
 }
 
 @test "Full house two small, three big" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash yacht.sh "full house" 2 2 4 4 4
     [[ $status -eq 0 ]]
     [[ $output == "16" ]]
 }
 
 @test "Full house three small, two big" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash yacht.sh "full house" 5 3 3 5 3
     [[ $status -eq 0 ]]
     [[ $output == "19" ]]
 }
 
 @test "Two pair is not a full house" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash yacht.sh "full house" 2 2 4 4 5
     [[ $status -eq 0 ]]
     [[ $output == "0" ]]
 }
 
 @test "Four of a kind is not a full house" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash yacht.sh "full house" 1 4 4 4 4
     [[ $status -eq 0 ]]
     [[ $output == "0" ]]
 }
 
 @test "Yacht is not a full house" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash yacht.sh "full house" 2 2 2 2 2
     [[ $status -eq 0 ]]
     [[ $output == "0" ]]
 }
 
 @test "Four of a Kind" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash yacht.sh "four of a kind" 6 6 4 6 6
     [[ $status -eq 0 ]]
     [[ $output == "24" ]]
 }
 
 @test "Yacht can be scored as Four of a Kind" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash yacht.sh "four of a kind" 3 3 3 3 3
     [[ $status -eq 0 ]]
     [[ $output == "12" ]]
 }
 
 @test "Full house is not Four of a Kind" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash yacht.sh "four of a kind" 3 3 3 5 5
     [[ $status -eq 0 ]]
     [[ $output == "0" ]]
 }
 
 @test "Little Straight" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash yacht.sh "little straight" 3 5 4 1 2
     [[ $status -eq 0 ]]
     [[ $output == "30" ]]
 }
 
 @test "Little Straight as Big Straight" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash yacht.sh "big straight" 1 2 3 4 5
     [[ $status -eq 0 ]]
     [[ $output == "0" ]]
 }
 
 @test "Four in order but not a little straight" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash yacht.sh "little straight" 1 1 2 3 4
     [[ $status -eq 0 ]]
     [[ $output == "0" ]]
 }
 
 @test "No pairs but not a little straight" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash yacht.sh "little straight" 1 2 3 4 6
     [[ $status -eq 0 ]]
     [[ $output == "0" ]]
 }
 
 @test "Minimum is 1, maximum is 5, but not a little straight" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash yacht.sh "little straight" 1 1 3 4 5
     [[ $status -eq 0 ]]
     [[ $output == "0" ]]
 }
 
 @test "Big Straight" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash yacht.sh "big straight" 4 6 2 5 3
     [[ $status -eq 0 ]]
     [[ $output == "30" ]]
 }
 
 @test "Big Straight as little straight" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash yacht.sh "little straight" 6 5 4 3 2
     [[ $status -eq 0 ]]
     [[ $output == "0" ]]
 }
 
 @test "No pairs but not a big straight" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash yacht.sh "big straight" 6 5 4 3 1
     [[ $status -eq 0 ]]
     [[ $output == "0" ]]
 }
 
 @test "Choice" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash yacht.sh "choice" 3 3 5 6 6
     [[ $status -eq 0 ]]
     [[ $output == "23" ]]
 }
 
 @test "Yacht as choice" {
-    skip
+    [[ $BATS_RUN_SKIPPED == true  ]] || skip
     run bash yacht.sh "choice" 2 2 2 2 2
     [[ $status -eq 0 ]]
     [[ $output == "10" ]]