Changelog#

-
-

1.8.3.9xxx (under development)#

+
+

1.8.4 (2024-05-06)#

    -

  • …

    • +

  • [BUILD TIME] [BUGFIX] #508: Fixed build errors on Windows +(thanks to @jeoren and @kalibera).

-
-

1.8.3 (2023-12-10)#

+
+

1.8.3 (2023-12-10)#

  • [BUILD TIME] [BUGFIX] Fixed the format string is not a string literal (potentially insecure) warnings.

-
-

1.8.2 (2023-11-22)#

+
+

1.8.2 (2023-11-22)#

  • [BUILD TIME] [BUGFIX] #501: Fixed failing build on 32-bit Windows (Windows API ResolveLocaleName function not available).

    • @@ -372,8 +373,8 @@

    1.8.2 (2023-11-22) -

    1.8.1 (2023-11-09)#

    +
    +

    1.8.1 (2023-11-09)#

    • [GENERAL] ICU bundle updated to version 74.1 (Unicode 15.1, CLDR 44).

    • [BACKWARD INCOMPATIBILITY] [BUILD TIME] Support for Solaris has now been @@ -405,8 +406,8 @@

      1.8.1 (2023-11-09) -

      1.7.12 (2023-01-09)#

      +
      +

      1.7.12 (2023-01-09)#

      -
      -

      1.7.8 (2022-07-11)#

      +
      +

      1.7.8 (2022-07-11)#

      • [DOCUMENTATION] Paper on stringi has been published in the Journal of Statistical Software; @@ -429,16 +430,16 @@

        1.7.8 (2022-07-11) -

        1.7.6 (2021-11-29)#

        +
        +

        1.7.6 (2021-11-29)#

        • [BUILD TIME] #463: Added Loongarch support in ICU’s double conversion (@liuxiang88).

        • [BUGFIX] #467: The UCRT build on Windows was not marking strings as latin1.

        -
        -

        1.7.5 (2021-10-04)#

        +
        +

        1.7.5 (2021-10-04)#

        • [DOCUMENTATION] Paper on stringi has been accepted for publication in the Journal of Statistical Software, @@ -454,29 +455,29 @@

          1.7.5 (2021-10-04) -

          1.7.4 (2021-08-12)#

          +
          +

          1.7.4 (2021-08-12)#

          • [BUGFIX] #449: Fixed segfaults generated by stri_sprintf.

          • [BUILD TIME] No longer defining USE_RINTERNALS and R_NO_REMAP.

          -
          -

          1.7.3 (2021-07-15)#

          +
          +

          1.7.3 (2021-07-15)#

          • [BUGFIX] Fixed the previous patch of ICU55 causing a build failure on, amongst others, CRAN’s Solaris-based target.

          -
          -

          1.7.2 (2021-07-14)#

          +
          +

          1.7.2 (2021-07-14)#

          • [BUGFIX] Workaround for a bug in tools::checkFF failing when NA_character_ is passed to .Call.

          -
          -

          1.7.1 (2021-07-14)#

          +
          +

          1.7.1 (2021-07-14)#

          • [BACKWARD INCOMPATIBILITY] %s$% and %stri$% now use the new stri_sprintf (see below) function instead of base::sprintf.

            • @@ -534,8 +535,8 @@

            1.7.1 (2021-07-14) -

            1.6.2 (2021-05-14)#

            +
            +

            1.6.2 (2021-05-14)#

            • [BACKWARD INCOMPATIBILITY] In stri_enc_list(), simplify now defaults to TRUE.

              • @@ -553,8 +554,8 @@

              1.6.2 (2021-05-14) -

              1.6.1 (2021-05-05)#

              +
              +

              1.6.1 (2021-05-05)#

              • [GENERAL] #401: stringi is now bundled with ICU4C 69.1 (upgraded from 61.1), which is used on most Windows and OS X builds as well as on *nix systems @@ -581,8 +582,8 @@

                1.6.1 (2021-05-05) -

                1.5.3 (2020-09-04)#

                +
                +

                1.5.3 (2020-09-04)#

                -
                -

                1.4.6 (2020-02-17)#

                +
                +

                1.4.6 (2020-02-17)#

                • [BACKWARD INCOMPATIBILITY] #369: stri_c() now returns an empty string when input is empty and collapse is set.

                  • @@ -641,14 +642,14 @@

                  1.4.6 (2020-02-17)stri_datetime_format: ...

                -
                -

                1.4.5 (2020-01-11)#

                +
                +

                1.4.5 (2020-01-11)#

                • [BUGFIX] #366: fix for #363 required ICU >= 55 .

                -
                -

                1.4.4 (2020-01-06)#

                +
                +

                1.4.4 (2020-01-06)#

                • [BUGFIX] #348: Avoid copying 0 bytes to a nil-buffer in stri_sub_all().

                • [BUGFIX] #362: Removed configure variable CXXCPP as it is now deprecated.

                  • @@ -657,8 +658,8 @@

                  1.4.4 (2020-01-06)RegexMatcher is now checked after its use.

                -
                -

                1.4.3 (2019-03-12)#

                +
                +

                1.4.3 (2019-03-12)#

                -
                -

                1.3.1 (2019-02-10)#

                +
                +

                1.3.1 (2019-02-10)#

                • [BACKWARD INCOMPATIBILITY] #335: A fix to #314 prevented (by design) the use of the system ICU if the library had been compiled with U_CHARSET_IS_UTF8=1. @@ -702,8 +703,8 @@

                  1.3.1 (2019-02-10) -

                  1.2.4 (2018-07-20)#

                  +
                  +

                  1.2.4 (2018-07-20)#

                  • [BUGFIX] #314: Testing U_CHARSET_IS_UTF8 in configure when using pkg-build.

                    • @@ -713,15 +714,15 @@

                    1.2.4 (2018-07-20) -

                    1.2.3 (2018-05-16)#

                    +
                    +

                    1.2.3 (2018-05-16)#

                    • [BUGFIX] #296: Fixed the behaviour of the configure script on CentOS 6.

                    • [BUGFIX] Fixed broken Windows build by updating the icudt mirror list.

                    -
                    -

                    1.2.2 (2018-05-01)#

                    +
                    +

                    1.2.2 (2018-05-01)#

                    -
                    -

                    1.1.7 (2018-03-06)#

                    +
                    +

                    1.1.7 (2018-03-06)#

                    • [BUGFIX] Fixed ICU4C 55.1 generating some significant warnings (icu55/i18n/winnmfmt.cpp) and suppressing important diagnostics (src/icu55/i18n/decNumber.c).

                    -
                    -

                    1.1.6 (2017-11-10)#

                    +
                    +

                    1.1.6 (2017-11-10)#

                    • [WINDOWS SPECIFIC] #270: Strings marked with latin1 encoding are now converted internally to UTF-8 using the WINDOWS-1252 codec. @@ -762,8 +763,8 @@

                      1.1.6 (2017-11-10)rchk.

                    -
                    -

                    1.1.5 (2017-04-07)#

                    +
                    +

                    1.1.5 (2017-04-07)#

                    • [GENERAL] stringi now requires ICU4C >= 52.

                    • [BUGFIX] Fixed errors pointed out by clang-UBSAN in stri_brkiter.h.

                      • @@ -774,8 +775,8 @@

                      1.1.5 (2017-04-07)dir.exists() is R >= 3.2.

                    -
                    -

                    1.1.3 (2017-03-21)#

                    +
                    +

                    1.1.3 (2017-03-21)#

                    • [REMOVE DEPRECATED] stri_install_check() and stri_install_icudt() marked as deprecated in stringi 0.5-5 are no longer being exported.

                      • @@ -794,14 +795,14 @@

                      1.1.3 (2017-03-21) -

                      1.1.2 (2016-09-30)#

                      +
                      +

                      1.1.2 (2016-09-30)#

                      • [BUGFIX] round(), snprintf() is not C++98.

                      -
                      -

                      1.1.1 (2016-05-25)#

                      +
                      +

                      1.1.1 (2016-05-25)#

                      -
                      -

                      1.0-1 (2015-10-22)#

                      +
                      +

                      1.0-1 (2015-10-22)#

                      • [GENERAL] #88: C API is now available for use in, e.g., Rcpp packages, see https://github.com/gagolews/ExampleRcppStringi for an example.

                        • @@ -829,8 +830,8 @@

                        1.0-1 (2015-10-22) -

                        0.5-5 (2015-06-28)#

                        +
                        +

                        0.5-5 (2015-06-28)#

                        • [BACKWARD INCOMPATIBILITY] stri_install_check() and stri_install_icudt() are now deprecated. From now on they are supposed to be used only @@ -852,8 +853,8 @@

                          0.5-5 (2015-06-28) -

                          0.5-2 (2015-06-21)#

                          +
                          +

                          0.5-2 (2015-06-21)#

                          • [BACKWARD INCOMPATIBILITY] The second argument to stri_pad_*() has been renamed width.

                            • @@ -920,8 +921,8 @@

                            0.5-2 (2015-06-21) -

                            0.4-1 (2014-12-11)#

                            +
                            +

                            0.4-1 (2014-12-11)#

                            • [IMPORTANT CHANGE] n_max argument in stri_split_*() has been renamed n.

                            • [IMPORTANT CHANGE] simplify=FALSE in stri_extract_all_*() and @@ -974,8 +975,8 @@

                              0.4-1 (2014-12-11) -

                              0.3-1 (2014-11-06)#

                              +
                              +

                              0.3-1 (2014-11-06)#

                              • [IMPORTANT CHANGE] #87: %>% overlapped with the pipe operator from the magrittr package; now each operator like %>% has been renamed %s>%.

                                • @@ -1021,22 +1022,22 @@

                                0.3-1 (2014-11-06) -

                                0.2-5 (2014-05-16)#

                                +
                                +

                                0.2-5 (2014-05-16)#

                                • Some examples are no longer run if icudt is not available (this was reverted in a future version though).

                                -
                                -

                                0.2-4 (2014-05-15)#

                                +
                                +

                                0.2-4 (2014-05-15)#

                                • [BUGFIX] Fixed issues with loading of misaligned addresses in stri_*_fixed().

                                -
                                -

                                0.2-3 (2014-05-14)#

                                +
                                +

                                0.2-3 (2014-05-14)#

                                -
                                -

                                0.1-25 (2014-03-12)#

                                +
                                +

                                0.1-25 (2014-03-12)#

                                • LICENSE tweaks.

                                • First CRAN release.

                                -
                                -

                                0.1-24 (2014-03-11)#

                                +
                                +

                                0.1-24 (2014-03-11)#

                                • Fixed bugs detected with ASAN and UBSAN, e.g., fixed CharClass::gcmask type (enum -> uint32_t) @@ -1141,8 +1142,8 @@

                                  0.1-24 (2014-03-11)valgrind).

                                -
                                -

                                0.1-23 (2014-03-11)#

                                +
                                +

                                0.1-23 (2014-03-11)#

                                -
                                -

                                0.1-22 (2014-02-20)#

                                +
                                +

                                0.1-22 (2014-02-20)#

                                • System ICU is used on systems which do have one (version >= 50 needed). ICU is auto-detected with pkg-config in configure. @@ -1161,23 +1162,23 @@

                                  0.1-22 (2014-02-20) -

                                  0.1-21 (2014-02-19)#

                                  +
                                  +

                                  0.1-21 (2014-02-19)#

                                  • Fixed some issues on Solaris while preparing stringi for CRAN submission.

                                  -
                                  -

                                  0.1-20 (2014-02-17)#

                                  +
                                  +

                                  0.1-20 (2014-02-17)#

                                  • ICU4C 52.1 sources included (common, i18n, stubdata + icu52dt.dat loaded dynamically). Compilation via Makevars.

                                  • stringi does not depend on any external libraries anymore.

                                  -
                                  -

                                  0.1-11 (2013-11-16)#

                                  +
                                  +

                                  0.1-11 (2013-11-16)#

                                  • ICU4C is now statically linked on Windows.

                                  • First OS X binary build.

                                    • @@ -1185,14 +1186,14 @@

                                    0.1-11 (2013-11-16) -

                                    0.1-10 (2013-11-13)#

                                    +
                                    +

                                    0.1-10 (2013-11-13)#

                                    • Using pkg-config via configure to look for ICU4C libs.

                                    -
                                    -

                                    0.1-6 (2013-07-05)#

                                    +
                                    +

                                    0.1-6 (2013-07-05)#

                                    • First Windows binary build.

                                    • Compilation passed on Oracle Sun Studio compiler collection.

                                      • @@ -1200,8 +1201,8 @@

                                      0.1-6 (2013-07-05) -

                                      0.1-1 (2013-01-05)#

                                      +
                                      +

                                      0.1-1 (2013-01-05)#

                                      • The stringi project has been started.

                                      @@ -1243,7 +1244,7 @@

                                      0.1-1 (2013-01-05)Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -1265,53 +1266,53 @@

                                      0.1-1 (2013-01-05) @@ -1323,7 +1324,7 @@

                                      0.1-1 (2013-01-05) + diff --git a/docs/rapi.html b/docs/rapi.html index 0efbc5f2..cb95d16e 100644 --- a/docs/rapi.html +++ b/docs/rapi.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -490,7 +490,7 @@

                                      R Package stringi ReferenceSphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -505,7 +505,7 @@

                                      R Package stringi Reference + diff --git a/docs/rapi/about_arguments.html b/docs/rapi/about_arguments.html index e3347ec6..5c5c42c6 100644 --- a/docs/rapi/about_arguments.html +++ b/docs/rapi/about_arguments.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -420,7 +420,7 @@

                                      See Also Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -460,7 +460,7 @@

                                      See Also - + diff --git a/docs/rapi/about_encoding.html b/docs/rapi/about_encoding.html index 8b52e02a..6a0e82ca 100644 --- a/docs/rapi/about_encoding.html +++ b/docs/rapi/about_encoding.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -461,7 +461,7 @@

                                      See Also Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -503,7 +503,7 @@

                                      See Also - + diff --git a/docs/rapi/about_locale.html b/docs/rapi/about_locale.html index afdddc34..174f7663 100644 --- a/docs/rapi/about_locale.html +++ b/docs/rapi/about_locale.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -431,7 +431,7 @@

                                      See Also Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -472,7 +472,7 @@

                                      See Also - + diff --git a/docs/rapi/about_search.html b/docs/rapi/about_search.html index 70a397cf..8cdee911 100644 --- a/docs/rapi/about_search.html +++ b/docs/rapi/about_search.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -432,7 +432,7 @@

                                      See Also Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -469,7 +469,7 @@

                                      See Also - + diff --git a/docs/rapi/about_search_boundaries.html b/docs/rapi/about_search_boundaries.html index 8a08f841..64c53799 100644 --- a/docs/rapi/about_search_boundaries.html +++ b/docs/rapi/about_search_boundaries.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -424,7 +424,7 @@

                                      See Also Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -462,7 +462,7 @@

                                      See Also - + diff --git a/docs/rapi/about_search_charclass.html b/docs/rapi/about_search_charclass.html index 484fecbd..49cde732 100644 --- a/docs/rapi/about_search_charclass.html +++ b/docs/rapi/about_search_charclass.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -638,7 +638,7 @@

                                      See Also Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -681,7 +681,7 @@

                                      See Also - + diff --git a/docs/rapi/about_search_coll.html b/docs/rapi/about_search_coll.html index a7b20980..275d8a0e 100644 --- a/docs/rapi/about_search_coll.html +++ b/docs/rapi/about_search_coll.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -412,7 +412,7 @@

                                      See Also Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -450,7 +450,7 @@

                                      See Also - + diff --git a/docs/rapi/about_search_fixed.html b/docs/rapi/about_search_fixed.html index fa3382a0..8d60b724 100644 --- a/docs/rapi/about_search_fixed.html +++ b/docs/rapi/about_search_fixed.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -412,7 +412,7 @@

                                      See Also Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -449,7 +449,7 @@

                                      See Also - + diff --git a/docs/rapi/about_search_regex.html b/docs/rapi/about_search_regex.html index 2d8b5e73..2df5de21 100644 --- a/docs/rapi/about_search_regex.html +++ b/docs/rapi/about_search_regex.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -593,7 +593,7 @@

                                      See Also Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -635,7 +635,7 @@

                                      See Also - + diff --git a/docs/rapi/about_stringi.html b/docs/rapi/about_stringi.html index 2928763a..74540c6e 100644 --- a/docs/rapi/about_stringi.html +++ b/docs/rapi/about_stringi.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -447,7 +447,7 @@

                                      See Also Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -486,7 +486,7 @@

                                      See Also - + diff --git a/docs/rapi/operator_add.html b/docs/rapi/operator_add.html index 06549bb4..a5b0b759 100644 --- a/docs/rapi/operator_add.html +++ b/docs/rapi/operator_add.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -444,7 +444,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -485,7 +485,7 @@

                                      Examples - + diff --git a/docs/rapi/operator_compare.html b/docs/rapi/operator_compare.html index f3a6905e..96f61c82 100644 --- a/docs/rapi/operator_compare.html +++ b/docs/rapi/operator_compare.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -470,7 +470,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -511,7 +511,7 @@

                                      Examples - + diff --git a/docs/rapi/operator_dollar.html b/docs/rapi/operator_dollar.html index 16503014..b7e71674 100644 --- a/docs/rapi/operator_dollar.html +++ b/docs/rapi/operator_dollar.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -458,7 +458,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -499,7 +499,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_compare.html b/docs/rapi/stri_compare.html index 74d97953..a3748d7c 100644 --- a/docs/rapi/stri_compare.html +++ b/docs/rapi/stri_compare.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -506,7 +506,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -548,7 +548,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_count.html b/docs/rapi/stri_count.html index a1d972b9..d3ea1c72 100644 --- a/docs/rapi/stri_count.html +++ b/docs/rapi/stri_count.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -487,7 +487,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -528,7 +528,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_count_boundaries.html b/docs/rapi/stri_count_boundaries.html index e6eee061..d4ec9a97 100644 --- a/docs/rapi/stri_count_boundaries.html +++ b/docs/rapi/stri_count_boundaries.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -467,7 +467,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -508,7 +508,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_datetime_add.html b/docs/rapi/stri_datetime_add.html index b5609dad..74ebdadb 100644 --- a/docs/rapi/stri_datetime_add.html +++ b/docs/rapi/stri_datetime_add.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -423,9 +423,9 @@

                                      Examples 
                                      x <- stri_datetime_now()
 stri_datetime_add(x, units='months') <- 2
 print(x)
-## [1] "2024-07-06 11:01:45 CEST"
+## [1] "2024-07-06 14:48:12 CEST"
 stri_datetime_add(x, -2, units='months')
-## [1] "2024-05-06 11:01:45 CEST"
+## [1] "2024-05-06 14:48:12 CEST"
 stri_datetime_add(stri_datetime_create(2014, 4, 20), 1, units='years')
 ## [1] "2015-04-20 CEST"
 stri_datetime_add(stri_datetime_create(2014, 4, 20), 1, units='years', locale='@calendar=hebrew')
@@ -472,7 +472,7 @@ 
                                      Examples
               Some rights reserved. Licensed under CC BY-NC-ND 4.0.
               Built with Sphinx
               and a customised Furo theme.
-              Last updated on 2024-05-06T11:02:01+0200.
+              Last updated on 2024-05-06T14:48:28+0200.
               This site will never display any ads: it is a non-profit project.
               It does not collect any data.
                                      @@ -514,7 +514,7 @@

                                      Examples

                                      - + diff --git a/docs/rapi/stri_datetime_create.html b/docs/rapi/stri_datetime_create.html index 0774b26f..e498de89 100644 --- a/docs/rapi/stri_datetime_create.html +++ b/docs/rapi/stri_datetime_create.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -478,7 +478,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -519,7 +519,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_datetime_fields.html b/docs/rapi/stri_datetime_fields.html index bc2dd8d8..6157e674 100644 --- a/docs/rapi/stri_datetime_fields.html +++ b/docs/rapi/stri_datetime_fields.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -418,14 +418,14 @@

                                      See Also

                                      Examples#

                                      stri_datetime_fields(stri_datetime_now())
 ##   Year Month Day Hour Minute Second Millisecond WeekOfYear WeekOfMonth
-## 1 2024     5   6   11      1     46          92         19           2
+## 1 2024     5   6   14     48     12         810         19           2
 ##   DayOfYear DayOfWeek Hour12 AmPm Era
-## 1       127         2     11    1   2
+## 1       127         2      2    2   2
 stri_datetime_fields(stri_datetime_now(), locale='@calendar=hebrew')
 ##   Year Month Day Hour Minute Second Millisecond WeekOfYear WeekOfMonth
-## 1 5784     8  28   11      1     46          97         35           5
+## 1 5784     8  28   14     48     12         814         35           5
 ##   DayOfYear DayOfWeek Hour12 AmPm Era
-## 1       234         2     11    1   1
+## 1       234         2      2    2   1
 stri_datetime_symbols(locale='@calendar=hebrew')$Month[
    stri_datetime_fields(stri_datetime_now(), locale='@calendar=hebrew')$Month
 ]
@@ -470,7 +470,7 @@ 
                                      Examples
               Some rights reserved. Licensed under CC BY-NC-ND 4.0.
               Built with Sphinx
               and a customised Furo theme.
-              Last updated on 2024-05-06T11:02:01+0200.
+              Last updated on 2024-05-06T14:48:28+0200.
               This site will never display any ads: it is a non-profit project.
               It does not collect any data.
                                      @@ -511,7 +511,7 @@

                                      Examples

                                      - + diff --git a/docs/rapi/stri_datetime_format.html b/docs/rapi/stri_datetime_format.html index 33f1e582..43d6ec94 100644 --- a/docs/rapi/stri_datetime_format.html +++ b/docs/rapi/stri_datetime_format.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -940,7 +940,7 @@

                                      Examples stri_datetime_parse('19 lipca 2015', 'date_long', locale='pl_PL') ## [1] "2015-07-19 CEST" stri_datetime_format(stri_datetime_now(), 'datetime_relative_medium') -## [1] "today, 11:01:46 am" +## [1] "today, 2:48:12 pm"

                                      @@ -981,7 +981,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -1023,7 +1023,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_datetime_fstr.html b/docs/rapi/stri_datetime_fstr.html index 2f942260..881ed8e1 100644 --- a/docs/rapi/stri_datetime_fstr.html +++ b/docs/rapi/stri_datetime_fstr.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -440,7 +440,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -481,7 +481,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_datetime_now.html b/docs/rapi/stri_datetime_now.html index 8717e400..549358dd 100644 --- a/docs/rapi/stri_datetime_now.html +++ b/docs/rapi/stri_datetime_now.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -412,7 +412,7 @@

                                      See Also Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -451,7 +451,7 @@

                                      See Also - + diff --git a/docs/rapi/stri_datetime_symbols.html b/docs/rapi/stri_datetime_symbols.html index 3a9a4fed..57688355 100644 --- a/docs/rapi/stri_datetime_symbols.html +++ b/docs/rapi/stri_datetime_symbols.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -791,7 +791,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -833,7 +833,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_detect.html b/docs/rapi/stri_detect.html index 5755c8e1..95e58ace 100644 --- a/docs/rapi/stri_detect.html +++ b/docs/rapi/stri_detect.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -508,7 +508,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -549,7 +549,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_dup.html b/docs/rapi/stri_dup.html index 5808a1c3..05348219 100644 --- a/docs/rapi/stri_dup.html +++ b/docs/rapi/stri_dup.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -450,7 +450,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -491,7 +491,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_duplicated.html b/docs/rapi/stri_duplicated.html index 8717a1dd..03588a12 100644 --- a/docs/rapi/stri_duplicated.html +++ b/docs/rapi/stri_duplicated.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -485,7 +485,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -527,7 +527,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_enc_detect.html b/docs/rapi/stri_enc_detect.html index 5df471c9..7c63a797 100644 --- a/docs/rapi/stri_enc_detect.html +++ b/docs/rapi/stri_enc_detect.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -563,7 +563,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -605,7 +605,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_enc_detect2.html b/docs/rapi/stri_enc_detect2.html index 718d7fb4..eacd1846 100644 --- a/docs/rapi/stri_enc_detect2.html +++ b/docs/rapi/stri_enc_detect2.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -443,7 +443,7 @@

                                      See Also Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -483,7 +483,7 @@

                                      See Also - + diff --git a/docs/rapi/stri_enc_fromutf32.html b/docs/rapi/stri_enc_fromutf32.html index 8d4557d1..238b8d0c 100644 --- a/docs/rapi/stri_enc_fromutf32.html +++ b/docs/rapi/stri_enc_fromutf32.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -432,7 +432,7 @@

                                      See Also Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -472,7 +472,7 @@

                                      See Also - + diff --git a/docs/rapi/stri_enc_info.html b/docs/rapi/stri_enc_info.html index efcb29b4..aaa87296 100644 --- a/docs/rapi/stri_enc_info.html +++ b/docs/rapi/stri_enc_info.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -439,7 +439,7 @@

                                      See Also Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -479,7 +479,7 @@

                                      See Also - + diff --git a/docs/rapi/stri_enc_isascii.html b/docs/rapi/stri_enc_isascii.html index d05934f6..4f46a539 100644 --- a/docs/rapi/stri_enc_isascii.html +++ b/docs/rapi/stri_enc_isascii.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -438,7 +438,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -479,7 +479,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_enc_isutf16.html b/docs/rapi/stri_enc_isutf16.html index acc8e502..08cad36c 100644 --- a/docs/rapi/stri_enc_isutf16.html +++ b/docs/rapi/stri_enc_isutf16.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -437,7 +437,7 @@

                                      See Also Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -477,7 +477,7 @@

                                      See Also - + diff --git a/docs/rapi/stri_enc_isutf8.html b/docs/rapi/stri_enc_isutf8.html index cdd8b3c1..43627220 100644 --- a/docs/rapi/stri_enc_isutf8.html +++ b/docs/rapi/stri_enc_isutf8.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -442,7 +442,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -483,7 +483,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_enc_list.html b/docs/rapi/stri_enc_list.html index cada66ae..10409fa2 100644 --- a/docs/rapi/stri_enc_list.html +++ b/docs/rapi/stri_enc_list.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -2596,7 +2596,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -2637,7 +2637,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_enc_mark.html b/docs/rapi/stri_enc_mark.html index 2c662b24..ee43d386 100644 --- a/docs/rapi/stri_enc_mark.html +++ b/docs/rapi/stri_enc_mark.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -432,7 +432,7 @@

                                      See Also Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -472,7 +472,7 @@

                                      See Also - + diff --git a/docs/rapi/stri_enc_set.html b/docs/rapi/stri_enc_set.html index a319ad58..d57ad08a 100644 --- a/docs/rapi/stri_enc_set.html +++ b/docs/rapi/stri_enc_set.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -435,7 +435,7 @@

                                      See Also Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -475,7 +475,7 @@

                                      See Also - + diff --git a/docs/rapi/stri_enc_toascii.html b/docs/rapi/stri_enc_toascii.html index 8bb8b71e..e331186a 100644 --- a/docs/rapi/stri_enc_toascii.html +++ b/docs/rapi/stri_enc_toascii.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -431,7 +431,7 @@

                                      See Also Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -471,7 +471,7 @@

                                      See Also - + diff --git a/docs/rapi/stri_enc_tonative.html b/docs/rapi/stri_enc_tonative.html index d72702ee..405c43ce 100644 --- a/docs/rapi/stri_enc_tonative.html +++ b/docs/rapi/stri_enc_tonative.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -430,7 +430,7 @@

                                      See Also Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -470,7 +470,7 @@

                                      See Also - + diff --git a/docs/rapi/stri_enc_toutf32.html b/docs/rapi/stri_enc_toutf32.html index a0205509..c995754b 100644 --- a/docs/rapi/stri_enc_toutf32.html +++ b/docs/rapi/stri_enc_toutf32.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -431,7 +431,7 @@

                                      See Also Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -471,7 +471,7 @@

                                      See Also - + diff --git a/docs/rapi/stri_enc_toutf8.html b/docs/rapi/stri_enc_toutf8.html index 72586fc0..df1e9bf3 100644 --- a/docs/rapi/stri_enc_toutf8.html +++ b/docs/rapi/stri_enc_toutf8.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -439,7 +439,7 @@

                                      See Also Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -479,7 +479,7 @@

                                      See Also - + diff --git a/docs/rapi/stri_encode.html b/docs/rapi/stri_encode.html index d82339c2..1e444cb4 100644 --- a/docs/rapi/stri_encode.html +++ b/docs/rapi/stri_encode.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -452,7 +452,7 @@

                                      See Also Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -493,7 +493,7 @@

                                      See Also - + diff --git a/docs/rapi/stri_escape_unicode.html b/docs/rapi/stri_escape_unicode.html index f9b150ae..88b6c478 100644 --- a/docs/rapi/stri_escape_unicode.html +++ b/docs/rapi/stri_escape_unicode.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -437,7 +437,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -478,7 +478,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_extract.html b/docs/rapi/stri_extract.html index 4fdf1da9..950afa23 100644 --- a/docs/rapi/stri_extract.html +++ b/docs/rapi/stri_extract.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -669,7 +669,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -710,7 +710,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_extract_boundaries.html b/docs/rapi/stri_extract_boundaries.html index 930b67e0..092d13b6 100644 --- a/docs/rapi/stri_extract_boundaries.html +++ b/docs/rapi/stri_extract_boundaries.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -480,7 +480,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -521,7 +521,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_flatten.html b/docs/rapi/stri_flatten.html index 65990b84..512c1bfd 100644 --- a/docs/rapi/stri_flatten.html +++ b/docs/rapi/stri_flatten.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -455,7 +455,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -496,7 +496,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_info.html b/docs/rapi/stri_info.html index 57c781c3..a9a88d4b 100644 --- a/docs/rapi/stri_info.html +++ b/docs/rapi/stri_info.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -434,7 +434,7 @@

                                      See Also Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -473,7 +473,7 @@

                                      See Also - + diff --git a/docs/rapi/stri_isempty.html b/docs/rapi/stri_isempty.html index 090fa50f..d92c70d4 100644 --- a/docs/rapi/stri_isempty.html +++ b/docs/rapi/stri_isempty.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -440,7 +440,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -481,7 +481,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_join.html b/docs/rapi/stri_join.html index 784a730e..515d762a 100644 --- a/docs/rapi/stri_join.html +++ b/docs/rapi/stri_join.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -467,7 +467,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -508,7 +508,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_join_list.html b/docs/rapi/stri_join_list.html index da25e401..2f2c88e6 100644 --- a/docs/rapi/stri_join_list.html +++ b/docs/rapi/stri_join_list.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -470,7 +470,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -511,7 +511,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_length.html b/docs/rapi/stri_length.html index dd2ee199..3e605779 100644 --- a/docs/rapi/stri_length.html +++ b/docs/rapi/stri_length.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -450,7 +450,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -491,7 +491,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_list2matrix.html b/docs/rapi/stri_list2matrix.html index 8a38249e..3c7d13e7 100644 --- a/docs/rapi/stri_list2matrix.html +++ b/docs/rapi/stri_list2matrix.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -489,7 +489,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -530,7 +530,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_locale_info.html b/docs/rapi/stri_locale_info.html index c26c0a55..252f4a95 100644 --- a/docs/rapi/stri_locale_info.html +++ b/docs/rapi/stri_locale_info.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -459,7 +459,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -500,7 +500,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_locale_list.html b/docs/rapi/stri_locale_list.html index 09314f8e..60364d01 100644 --- a/docs/rapi/stri_locale_list.html +++ b/docs/rapi/stri_locale_list.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -590,7 +590,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -630,7 +630,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_locale_set.html b/docs/rapi/stri_locale_set.html index c95526aa..80be557c 100644 --- a/docs/rapi/stri_locale_set.html +++ b/docs/rapi/stri_locale_set.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -400,13 +400,13 @@

                                      See Also

                                      Examples#

                                      ## Not run: 
 oldloc <- stri_locale_set('pt_BR')
-## You are now working with stringi_1.8.3.9001 (pt_BR.UTF-8; ICU4C 74.1 [bundle]; Unicode 15.1)
+## You are now working with stringi_1.8.4 (pt_BR.UTF-8; ICU4C 74.1 [bundle]; Unicode 15.1)
 # ... some locale-dependent operations
 # ... note that you may always modify a locale per-call
 # ... changing the default locale is convenient if you perform
 # ... many operations
 stri_locale_set(oldloc) # restore the previous default locale
-## You are now working with stringi_1.8.3.9001 (en_AU.UTF-8; ICU4C 74.1 [bundle]; Unicode 15.1)
+## You are now working with stringi_1.8.4 (en_AU.UTF-8; ICU4C 74.1 [bundle]; Unicode 15.1)
 ## End(Not run)
                                      @@ -448,7 +448,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -489,7 +489,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_locate.html b/docs/rapi/stri_locate.html index 00230d39..19abbf46 100644 --- a/docs/rapi/stri_locate.html +++ b/docs/rapi/stri_locate.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -709,7 +709,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -750,7 +750,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_locate_boundaries.html b/docs/rapi/stri_locate_boundaries.html index 496ed573..de6b35ca 100644 --- a/docs/rapi/stri_locate_boundaries.html +++ b/docs/rapi/stri_locate_boundaries.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -501,7 +501,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -542,7 +542,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_match.html b/docs/rapi/stri_match.html index a664bbd6..68759a75 100644 --- a/docs/rapi/stri_match.html +++ b/docs/rapi/stri_match.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -571,7 +571,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -612,7 +612,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_na2empty.html b/docs/rapi/stri_na2empty.html index e8908618..2ef20e4a 100644 --- a/docs/rapi/stri_na2empty.html +++ b/docs/rapi/stri_na2empty.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -432,7 +432,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -472,7 +472,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_numbytes.html b/docs/rapi/stri_numbytes.html index 2c5a43eb..1e657a0e 100644 --- a/docs/rapi/stri_numbytes.html +++ b/docs/rapi/stri_numbytes.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -448,7 +448,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -489,7 +489,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_opts_brkiter.html b/docs/rapi/stri_opts_brkiter.html index b45d70db..569a962b 100644 --- a/docs/rapi/stri_opts_brkiter.html +++ b/docs/rapi/stri_opts_brkiter.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -477,7 +477,7 @@

                                      See Also Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -518,7 +518,7 @@

                                      See Also - + diff --git a/docs/rapi/stri_opts_collator.html b/docs/rapi/stri_opts_collator.html index 27b6207a..97875a64 100644 --- a/docs/rapi/stri_opts_collator.html +++ b/docs/rapi/stri_opts_collator.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -497,7 +497,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -539,7 +539,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_opts_fixed.html b/docs/rapi/stri_opts_fixed.html index 862415ef..ea15d2d0 100644 --- a/docs/rapi/stri_opts_fixed.html +++ b/docs/rapi/stri_opts_fixed.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -448,7 +448,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -490,7 +490,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_opts_regex.html b/docs/rapi/stri_opts_regex.html index 29e1a740..29597101 100644 --- a/docs/rapi/stri_opts_regex.html +++ b/docs/rapi/stri_opts_regex.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -493,7 +493,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -535,7 +535,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_order.html b/docs/rapi/stri_order.html index 0f87ce09..b4c8dfc3 100644 --- a/docs/rapi/stri_order.html +++ b/docs/rapi/stri_order.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -463,7 +463,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -505,7 +505,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_pad.html b/docs/rapi/stri_pad.html index 9cdc7097..cb6d4fdf 100644 --- a/docs/rapi/stri_pad.html +++ b/docs/rapi/stri_pad.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -493,7 +493,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -534,7 +534,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_rand_lipsum.html b/docs/rapi/stri_rand_lipsum.html index 2b0f5cfd..6988d636 100644 --- a/docs/rapi/stri_rand_lipsum.html +++ b/docs/rapi/stri_rand_lipsum.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -554,7 +554,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -595,7 +595,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_rand_shuffle.html b/docs/rapi/stri_rand_shuffle.html index 056020df..861f627e 100644 --- a/docs/rapi/stri_rand_shuffle.html +++ b/docs/rapi/stri_rand_shuffle.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -444,7 +444,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -485,7 +485,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_rand_strings.html b/docs/rapi/stri_rand_strings.html index ca116d32..5847200f 100644 --- a/docs/rapi/stri_rand_strings.html +++ b/docs/rapi/stri_rand_strings.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -461,7 +461,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -502,7 +502,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_rank.html b/docs/rapi/stri_rank.html index 0a05d005..d6a592c5 100644 --- a/docs/rapi/stri_rank.html +++ b/docs/rapi/stri_rank.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -467,7 +467,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -509,7 +509,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_read_lines.html b/docs/rapi/stri_read_lines.html index 1e2b6364..e8761bec 100644 --- a/docs/rapi/stri_read_lines.html +++ b/docs/rapi/stri_read_lines.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -437,7 +437,7 @@

                                      See Also Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -477,7 +477,7 @@

                                      See Also - + diff --git a/docs/rapi/stri_read_raw.html b/docs/rapi/stri_read_raw.html index 576d5f01..b379b91d 100644 --- a/docs/rapi/stri_read_raw.html +++ b/docs/rapi/stri_read_raw.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -432,7 +432,7 @@

                                      See Also Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -472,7 +472,7 @@

                                      See Also - + diff --git a/docs/rapi/stri_remove_empty.html b/docs/rapi/stri_remove_empty.html index db606603..d4b09dc0 100644 --- a/docs/rapi/stri_remove_empty.html +++ b/docs/rapi/stri_remove_empty.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -453,7 +453,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -493,7 +493,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_replace.html b/docs/rapi/stri_replace.html index d3328239..d22add03 100644 --- a/docs/rapi/stri_replace.html +++ b/docs/rapi/stri_replace.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -588,7 +588,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -629,7 +629,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_replace_na.html b/docs/rapi/stri_replace_na.html index 9ad35f41..106a245f 100644 --- a/docs/rapi/stri_replace_na.html +++ b/docs/rapi/stri_replace_na.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -444,7 +444,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -485,7 +485,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_replace_rstr.html b/docs/rapi/stri_replace_rstr.html index 6f5a18d5..347d6583 100644 --- a/docs/rapi/stri_replace_rstr.html +++ b/docs/rapi/stri_replace_rstr.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -425,7 +425,7 @@

                                      See Also Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -464,7 +464,7 @@

                                      See Also - + diff --git a/docs/rapi/stri_reverse.html b/docs/rapi/stri_reverse.html index 8415614a..b9730baa 100644 --- a/docs/rapi/stri_reverse.html +++ b/docs/rapi/stri_reverse.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -440,7 +440,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -481,7 +481,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_sort.html b/docs/rapi/stri_sort.html index 17908ebf..8bf1fa8a 100644 --- a/docs/rapi/stri_sort.html +++ b/docs/rapi/stri_sort.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -465,7 +465,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -507,7 +507,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_sort_key.html b/docs/rapi/stri_sort_key.html index eb7802c7..86ddfe2a 100644 --- a/docs/rapi/stri_sort_key.html +++ b/docs/rapi/stri_sort_key.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -449,7 +449,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -491,7 +491,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_split.html b/docs/rapi/stri_split.html index e6c22006..930f01f6 100644 --- a/docs/rapi/stri_split.html +++ b/docs/rapi/stri_split.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -612,7 +612,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -653,7 +653,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_split_boundaries.html b/docs/rapi/stri_split_boundaries.html index c8464678..1b7287ea 100644 --- a/docs/rapi/stri_split_boundaries.html +++ b/docs/rapi/stri_split_boundaries.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -514,7 +514,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -555,7 +555,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_split_lines.html b/docs/rapi/stri_split_lines.html index 92a14627..11ead535 100644 --- a/docs/rapi/stri_split_lines.html +++ b/docs/rapi/stri_split_lines.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -444,7 +444,7 @@

                                      See Also Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -485,7 +485,7 @@

                                      See Also - + diff --git a/docs/rapi/stri_sprintf.html b/docs/rapi/stri_sprintf.html index 9c28de3f..0e9e678b 100644 --- a/docs/rapi/stri_sprintf.html +++ b/docs/rapi/stri_sprintf.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -503,14 +503,14 @@

                                      Examples ## 💩 ## <NA> stri_sprintf("UNIX time %1$f is %1$s.", Sys.time()) -## [1] "UNIX time 1714986115.773750 is 2024-05-06 11:01:55.77375." +## [1] "UNIX time 1714999701.996432 is 2024-05-06 14:48:21.996432." # the following do not work in sprintf() stri_sprintf("%1$#- *2$.*3$f", 1.23456, 10, 3) # two asterisks ## [1] " 1.235 " stri_sprintf(c("%s", "%f"), pi) # re-coercion needed ## [1] "3.14159265358979" "3.141593" stri_sprintf("%1$s is %1$f UNIX time.", Sys.time()) # re-coercion needed -## [1] "2024-05-06 11:01:55.77546 is 1714986115.775460 UNIX time." +## [1] "2024-05-06 14:48:21.998135 is 1714999701.998135 UNIX time." stri_sprintf(c("%d", "%s"), factor(11:12)) # re-coercion needed ## [1] "1" "12" stri_sprintf(c("%s", "%d"), factor(11:12)) # re-coercion needed @@ -555,7 +555,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -597,7 +597,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_startsendswith.html b/docs/rapi/stri_startsendswith.html index 52c938c4..f5b7d4fe 100644 --- a/docs/rapi/stri_startsendswith.html +++ b/docs/rapi/stri_startsendswith.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -517,7 +517,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -558,7 +558,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_stats_general.html b/docs/rapi/stri_stats_general.html index 337bdd62..e1bc7304 100644 --- a/docs/rapi/stri_stats_general.html +++ b/docs/rapi/stri_stats_general.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -449,7 +449,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -490,7 +490,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_stats_latex.html b/docs/rapi/stri_stats_latex.html index af51d4f0..22243c0d 100644 --- a/docs/rapi/stri_stats_latex.html +++ b/docs/rapi/stri_stats_latex.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -451,7 +451,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -492,7 +492,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_sub.html b/docs/rapi/stri_sub.html index 39bef148..2b0e23a9 100644 --- a/docs/rapi/stri_sub.html +++ b/docs/rapi/stri_sub.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -499,7 +499,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -540,7 +540,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_sub_all.html b/docs/rapi/stri_sub_all.html index be288f8f..f84d3da5 100644 --- a/docs/rapi/stri_sub_all.html +++ b/docs/rapi/stri_sub_all.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -522,7 +522,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -563,7 +563,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_subset.html b/docs/rapi/stri_subset.html index c8cd2e1d..570529bb 100644 --- a/docs/rapi/stri_subset.html +++ b/docs/rapi/stri_subset.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -501,7 +501,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -542,7 +542,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_timezone_info.html b/docs/rapi/stri_timezone_info.html index a7d537df..050671ba 100644 --- a/docs/rapi/stri_timezone_info.html +++ b/docs/rapi/stri_timezone_info.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -517,7 +517,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -558,7 +558,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_timezone_list.html b/docs/rapi/stri_timezone_list.html index 783ddc06..c58c960d 100644 --- a/docs/rapi/stri_timezone_list.html +++ b/docs/rapi/stri_timezone_list.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -2716,7 +2716,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -2758,7 +2758,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_timezone_set.html b/docs/rapi/stri_timezone_set.html index c1978e22..f9535d59 100644 --- a/docs/rapi/stri_timezone_set.html +++ b/docs/rapi/stri_timezone_set.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -450,7 +450,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -492,7 +492,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_trans_casemap.html b/docs/rapi/stri_trans_casemap.html index 94bf851a..080d9d0e 100644 --- a/docs/rapi/stri_trans_casemap.html +++ b/docs/rapi/stri_trans_casemap.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -480,7 +480,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -522,7 +522,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_trans_char.html b/docs/rapi/stri_trans_char.html index 6bdb782e..6c4dddaa 100644 --- a/docs/rapi/stri_trans_char.html +++ b/docs/rapi/stri_trans_char.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -449,7 +449,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -490,7 +490,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_trans_general.html b/docs/rapi/stri_trans_general.html index f8539c4c..a70a1916 100644 --- a/docs/rapi/stri_trans_general.html +++ b/docs/rapi/stri_trans_general.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -493,7 +493,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -535,7 +535,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_trans_list.html b/docs/rapi/stri_trans_list.html index 7b3d68a9..9b67124c 100644 --- a/docs/rapi/stri_trans_list.html +++ b/docs/rapi/stri_trans_list.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -1174,7 +1174,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -1214,7 +1214,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_trans_nf.html b/docs/rapi/stri_trans_nf.html index 13c44636..623d4878 100644 --- a/docs/rapi/stri_trans_nf.html +++ b/docs/rapi/stri_trans_nf.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -476,7 +476,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -518,7 +518,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_trim.html b/docs/rapi/stri_trim.html index fdbd392e..02e5ba57 100644 --- a/docs/rapi/stri_trim.html +++ b/docs/rapi/stri_trim.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -468,7 +468,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -509,7 +509,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_unescape_unicode.html b/docs/rapi/stri_unescape_unicode.html index 9eea10c6..8b048d2b 100644 --- a/docs/rapi/stri_unescape_unicode.html +++ b/docs/rapi/stri_unescape_unicode.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -438,7 +438,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -479,7 +479,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_unique.html b/docs/rapi/stri_unique.html index 1fb020de..621662d9 100644 --- a/docs/rapi/stri_unique.html +++ b/docs/rapi/stri_unique.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -452,7 +452,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -494,7 +494,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_width.html b/docs/rapi/stri_width.html index 430734f0..f20c7a90 100644 --- a/docs/rapi/stri_width.html +++ b/docs/rapi/stri_width.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -461,7 +461,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -503,7 +503,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_wrap.html b/docs/rapi/stri_wrap.html index 7185cbf5..89505887 100644 --- a/docs/rapi/stri_wrap.html +++ b/docs/rapi/stri_wrap.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -523,7 +523,7 @@

                                      Examples Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -565,7 +565,7 @@

                                      Examples - + diff --git a/docs/rapi/stri_write_lines.html b/docs/rapi/stri_write_lines.html index c613f644..b935a248 100644 --- a/docs/rapi/stri_write_lines.html +++ b/docs/rapi/stri_write_lines.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -448,7 +448,7 @@

                                      See Also Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -488,7 +488,7 @@

                                      See Also - + diff --git a/docs/search.html b/docs/search.html index c2e8f6ae..758ca8c4 100644 --- a/docs/search.html +++ b/docs/search.html @@ -157,7 +157,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -362,7 +362,7 @@ Some rights reserved. Licensed under CC BY-NC-ND 4.0. Built with Sphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -377,7 +377,7 @@ - + diff --git a/docs/searchindex.js b/docs/searchindex.js index fb4a39fa..065f5b6c 100644 --- a/docs/searchindex.js +++ b/docs/searchindex.js @@ -1 +1 @@ -Search.setIndex({"docnames": ["index", "install", "news", "rapi", "rapi/about_arguments", "rapi/about_encoding", "rapi/about_locale", "rapi/about_search", "rapi/about_search_boundaries", "rapi/about_search_charclass", "rapi/about_search_coll", "rapi/about_search_fixed", "rapi/about_search_regex", "rapi/about_stringi", "rapi/operator_add", "rapi/operator_compare", "rapi/operator_dollar", "rapi/stri_compare", "rapi/stri_count", "rapi/stri_count_boundaries", "rapi/stri_datetime_add", "rapi/stri_datetime_create", "rapi/stri_datetime_fields", "rapi/stri_datetime_format", "rapi/stri_datetime_fstr", "rapi/stri_datetime_now", "rapi/stri_datetime_symbols", "rapi/stri_detect", "rapi/stri_dup", "rapi/stri_duplicated", "rapi/stri_enc_detect", "rapi/stri_enc_detect2", "rapi/stri_enc_fromutf32", "rapi/stri_enc_info", "rapi/stri_enc_isascii", "rapi/stri_enc_isutf16", "rapi/stri_enc_isutf8", "rapi/stri_enc_list", "rapi/stri_enc_mark", "rapi/stri_enc_set", "rapi/stri_enc_toascii", "rapi/stri_enc_tonative", "rapi/stri_enc_toutf32", "rapi/stri_enc_toutf8", "rapi/stri_encode", "rapi/stri_escape_unicode", "rapi/stri_extract", "rapi/stri_extract_boundaries", "rapi/stri_flatten", "rapi/stri_info", "rapi/stri_isempty", "rapi/stri_join", "rapi/stri_join_list", "rapi/stri_length", "rapi/stri_list2matrix", "rapi/stri_locale_info", "rapi/stri_locale_list", "rapi/stri_locale_set", "rapi/stri_locate", "rapi/stri_locate_boundaries", "rapi/stri_match", "rapi/stri_na2empty", "rapi/stri_numbytes", "rapi/stri_opts_brkiter", "rapi/stri_opts_collator", "rapi/stri_opts_fixed", "rapi/stri_opts_regex", "rapi/stri_order", "rapi/stri_pad", "rapi/stri_rand_lipsum", "rapi/stri_rand_shuffle", "rapi/stri_rand_strings", "rapi/stri_rank", "rapi/stri_read_lines", "rapi/stri_read_raw", "rapi/stri_remove_empty", "rapi/stri_replace", "rapi/stri_replace_na", "rapi/stri_replace_rstr", "rapi/stri_reverse", "rapi/stri_sort", "rapi/stri_sort_key", "rapi/stri_split", "rapi/stri_split_boundaries", "rapi/stri_split_lines", "rapi/stri_sprintf", "rapi/stri_startsendswith", "rapi/stri_stats_general", "rapi/stri_stats_latex", "rapi/stri_sub", "rapi/stri_sub_all", "rapi/stri_subset", "rapi/stri_timezone_info", "rapi/stri_timezone_list", "rapi/stri_timezone_set", "rapi/stri_trans_casemap", "rapi/stri_trans_char", "rapi/stri_trans_general", "rapi/stri_trans_list", "rapi/stri_trans_nf", "rapi/stri_trim", "rapi/stri_unescape_unicode", "rapi/stri_unique", "rapi/stri_width", "rapi/stri_wrap", "rapi/stri_write_lines", "weave/basic_operations", "weave/codepoint_comparing", "weave/collation", "weave/design_principles", "weave/example", "weave/input_output", "weave/other_operations", "weave/regular_expressions", "z_bibliography"], "filenames": ["index.md", "install.md", "news.md", "rapi.md", "rapi/about_arguments.md", "rapi/about_encoding.md", "rapi/about_locale.md", "rapi/about_search.md", "rapi/about_search_boundaries.md", "rapi/about_search_charclass.md", "rapi/about_search_coll.md", "rapi/about_search_fixed.md", "rapi/about_search_regex.md", "rapi/about_stringi.md", "rapi/operator_add.md", "rapi/operator_compare.md", "rapi/operator_dollar.md", "rapi/stri_compare.md", "rapi/stri_count.md", "rapi/stri_count_boundaries.md", "rapi/stri_datetime_add.md", "rapi/stri_datetime_create.md", "rapi/stri_datetime_fields.md", "rapi/stri_datetime_format.md", "rapi/stri_datetime_fstr.md", "rapi/stri_datetime_now.md", "rapi/stri_datetime_symbols.md", "rapi/stri_detect.md", "rapi/stri_dup.md", "rapi/stri_duplicated.md", "rapi/stri_enc_detect.md", "rapi/stri_enc_detect2.md", "rapi/stri_enc_fromutf32.md", "rapi/stri_enc_info.md", "rapi/stri_enc_isascii.md", "rapi/stri_enc_isutf16.md", "rapi/stri_enc_isutf8.md", "rapi/stri_enc_list.md", "rapi/stri_enc_mark.md", "rapi/stri_enc_set.md", "rapi/stri_enc_toascii.md", "rapi/stri_enc_tonative.md", "rapi/stri_enc_toutf32.md", "rapi/stri_enc_toutf8.md", "rapi/stri_encode.md", "rapi/stri_escape_unicode.md", "rapi/stri_extract.md", "rapi/stri_extract_boundaries.md", "rapi/stri_flatten.md", "rapi/stri_info.md", "rapi/stri_isempty.md", "rapi/stri_join.md", "rapi/stri_join_list.md", "rapi/stri_length.md", "rapi/stri_list2matrix.md", "rapi/stri_locale_info.md", "rapi/stri_locale_list.md", "rapi/stri_locale_set.md", "rapi/stri_locate.md", "rapi/stri_locate_boundaries.md", "rapi/stri_match.md", "rapi/stri_na2empty.md", "rapi/stri_numbytes.md", "rapi/stri_opts_brkiter.md", "rapi/stri_opts_collator.md", "rapi/stri_opts_fixed.md", "rapi/stri_opts_regex.md", "rapi/stri_order.md", "rapi/stri_pad.md", "rapi/stri_rand_lipsum.md", "rapi/stri_rand_shuffle.md", "rapi/stri_rand_strings.md", "rapi/stri_rank.md", "rapi/stri_read_lines.md", "rapi/stri_read_raw.md", "rapi/stri_remove_empty.md", "rapi/stri_replace.md", "rapi/stri_replace_na.md", "rapi/stri_replace_rstr.md", "rapi/stri_reverse.md", "rapi/stri_sort.md", "rapi/stri_sort_key.md", "rapi/stri_split.md", "rapi/stri_split_boundaries.md", "rapi/stri_split_lines.md", "rapi/stri_sprintf.md", "rapi/stri_startsendswith.md", "rapi/stri_stats_general.md", "rapi/stri_stats_latex.md", "rapi/stri_sub.md", "rapi/stri_sub_all.md", "rapi/stri_subset.md", "rapi/stri_timezone_info.md", "rapi/stri_timezone_list.md", "rapi/stri_timezone_set.md", "rapi/stri_trans_casemap.md", "rapi/stri_trans_char.md", "rapi/stri_trans_general.md", "rapi/stri_trans_list.md", "rapi/stri_trans_nf.md", "rapi/stri_trim.md", "rapi/stri_unescape_unicode.md", "rapi/stri_unique.md", "rapi/stri_width.md", "rapi/stri_wrap.md", "rapi/stri_write_lines.md", "weave/basic_operations.md", "weave/codepoint_comparing.md", "weave/collation.md", "weave/design_principles.md", "weave/example.md", "weave/input_output.md", "weave/other_operations.md", "weave/regular_expressions.md", "z_bibliography.md"], "titles": ["stringi: Fast and Portable Character String Processing in R", "Installing stringi", "Changelog", "R Package stringi Reference", "about_arguments:", "about_encoding:", "about_locale:", "about_search: String Searching", "about_search_boundaries:", "about_search_charclass:", "about_search_coll:", "about_search_fixed:", "about_search_regex:", "about_stringi: Fast and Portable Character String Processing in R", "operator_add: Concatenate Two Character Vectors", "operator_compare: Compare Strings with or without Collation", "operator_dollar: as a Binary Operator", "stri_compare: Compare Strings with or without Collation", "stri_count: Count the Number of Pattern Occurrences", "stri_count_boundaries: Count the Number of Text Boundaries", "stri_datetime_add: Date and Time Arithmetic", "stri_datetime_create: Create a Date-Time Object", "stri_datetime_fields: Get Values for Date and Time Fields", "stri_datetime_format: Date and Time Formatting and Parsing", "stri_datetime_fstr: -Style Format Strings", "stri_datetime_now: Get Current Date and Time", "stri_datetime_symbols: List Localizable Date-Time Formatting Data", "stri_detect: Detect Pattern Occurrences", "stri_dup: Duplicate Strings", "stri_duplicated: Determine Duplicated Elements", "stri_enc_detect: Detect Character Set and Language", "stri_enc_detect2: [DEPRECATED] Detect Locale-Sensitive Character Encoding", "stri_enc_fromutf32: Convert From UTF-32", "stri_enc_info: Query a Character Encoding", "stri_enc_isascii: Check If a Data Stream Is Possibly in ASCII", "stri_enc_isutf16: Check If a Data Stream Is Possibly in UTF-16 or UTF-32", "stri_enc_isutf8: Check If a Data Stream Is Possibly in UTF-8", "stri_enc_list: List Known Character Encodings", "stri_enc_mark: Get Declared Encodings of Each String", "stri_enc_set:", "stri_enc_toascii: Convert To ASCII", "stri_enc_tonative: Convert Strings To Native Encoding", "stri_enc_toutf32: Convert Strings To UTF-32", "stri_enc_toutf8: Convert Strings To UTF-8", "stri_encode: Convert Strings Between Given Encodings", "stri_escape_unicode: Escape Unicode Code Points", "stri_extract: Extract Pattern Occurrences", "stri_extract_boundaries: Extract Data Between Text Boundaries", "stri_flatten: Flatten a String", "stri_info:", "stri_isempty: Determine if a String is of Length Zero", "stri_join: Concatenate Character Vectors", "stri_join_list: Concatenate Strings in a List", "stri_length: Count the Number of Code Points", "stri_list2matrix: Convert a List to a Character Matrix", "stri_locale_info: Query Given Locale", "stri_locale_list: List Available Locales", "stri_locale_set:", "stri_locate: Locate Pattern Occurrences", "stri_locate_boundaries: Locate Text Boundaries", "stri_match: Extract Regex Pattern Matches, Together with Capture Groups", "stri_na2empty: Replace NAs with Empty Strings", "stri_numbytes: Count the Number of Bytes", "stri_opts_brkiter: Generate a List with BreakIterator Settings", "stri_opts_collator: Generate a List with Collator Settings", "stri_opts_fixed: Generate a List with Fixed Pattern Search Engine\u2019s Settings", "stri_opts_regex: Generate a List with Regex Matcher Settings", "stri_order: Ordering Permutation", "stri_pad: Pad (Center/Left/Right Align) a String", "stri_rand_lipsum: A Lorem Ipsum Generator", "stri_rand_shuffle: Randomly Shuffle Code Points in Each String", "stri_rand_strings: Generate Random Strings", "stri_rank: Ranking", "stri_read_lines: Read Text Lines from a Text File", "stri_read_raw: Read Text File as Raw", "stri_remove_empty: Remove All Empty Strings from a Character Vector", "stri_replace: Replace Pattern Occurrences", "stri_replace_na: Replace Missing Values in a Character Vector", "stri_replace_rstr: Convert gsub-Style Replacement Strings", "stri_reverse: Reverse Each String", "stri_sort: String Sorting", "stri_sort_key: Sort Keys", "stri_split: Split a String By Pattern Matches", "stri_split_boundaries: Split a String at Text Boundaries", "stri_split_lines: Split a String Into Text Lines", "stri_sprintf: Format Strings", "stri_startsendswith: Determine if the Start or End of a String Matches a Pattern", "stri_stats_general: General Statistics for a Character Vector", "stri_stats_latex: Statistics for a Character Vector Containing LaTeX Commands", "stri_sub: Extract a Substring From or Replace a Substring In a Character Vector", "stri_sub_all: Extract or Replace Multiple Substrings", "stri_subset: Select Elements that Match a Given Pattern", "stri_timezone_info: Query a Given Time Zone", "stri_timezone_list: List Available Time Zone Identifiers", "stri_timezone_set:", "stri_trans_casemap: Transform Strings with Case Mapping or Folding", "stri_trans_char: Translate Characters", "stri_trans_general: General Text Transforms, Including Transliteration", "stri_trans_list: List Available Text Transforms and Transliterators", "stri_trans_nf: Perform or Check For Unicode Normalization", "stri_trim: Trim Characters from the Left and/or Right Side of a String", "stri_unescape_unicode: Un-escape All Escape Sequences", "stri_unique: Extract Unique Elements", "stri_width: Determine the Width of Code Points", "stri_wrap: Word Wrap Text to Format Paragraphs", "stri_write_lines: Write Text Lines to a Text File", "Basic String Operations", "Code-Pointwise Comparing", "Collation", "General Design Principles", "Example Use Case: Data Preparation", "Input and Output", "Other Operations", "Regular Expressions", "References"], "terms": {"pronounc": 0, "ipa": [0, 98], "strin\u0261i": 0, "i": [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 24, 25, 26, 27, 30, 31, 32, 33, 37, 38, 39, 40, 42, 43, 44, 45, 46, 47, 48, 49, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 62, 63, 64, 65, 66, 67, 68, 69, 71, 72, 73, 74, 75, 76, 77, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113], "THE": [0, 13, 47, 82], "packag": [0, 1, 2, 5, 9, 13, 47, 57, 68, 94, 95, 108, 109, 110, 113, 114], "correct": [0, 2, 6, 10, 11, 13, 89, 108, 111], "consist": [0, 2, 4, 5, 9, 13, 17, 40, 47, 52, 60, 68, 69, 71, 90, 95, 96, 106, 107, 109, 113, 114], "conveni": [0, 2, 13, 18, 27, 32, 46, 57, 58, 60, 63, 64, 65, 66, 68, 76, 77, 82, 86, 91, 97, 100, 106, 107, 109, 110, 111, 112], "text": [0, 2, 3, 5, 7, 8, 9, 10, 12, 13, 23, 30, 31, 37, 63, 68, 69, 82, 85, 87, 88, 89, 95, 99, 103, 106, 108, 109, 110, 113, 114], "ani": [0, 2, 4, 5, 6, 9, 12, 13, 17, 23, 29, 32, 43, 45, 51, 55, 63, 76, 84, 89, 90, 92, 97, 98, 99, 103, 106, 107, 108, 109, 110, 111, 112], "local": [0, 2, 3, 7, 8, 9, 12, 13, 15, 17, 19, 20, 21, 22, 23, 26, 29, 37, 46, 47, 49, 57, 58, 59, 63, 64, 67, 72, 80, 81, 83, 85, 92, 93, 95, 97, 102, 104, 109, 111, 112, 113], "encod": [0, 2, 3, 9, 13, 30, 32, 34, 35, 36, 39, 40, 42, 43, 49, 53, 62, 73, 74, 81, 91, 99, 105, 109], "thank": [0, 2, 109, 111, 114], "icu": [0, 1, 2, 5, 6, 7, 8, 9, 10, 13, 17, 19, 20, 23, 24, 26, 29, 30, 31, 33, 37, 38, 39, 44, 46, 47, 49, 55, 56, 59, 60, 63, 64, 65, 66, 67, 72, 76, 80, 81, 83, 92, 93, 94, 95, 97, 98, 99, 101, 102, 104, 107, 108, 109, 111, 112, 113, 114], "intern": [0, 2, 5, 13, 30, 32, 37, 39, 44, 49, 62, 94], "compon": [0, 13, 26, 31, 33, 49, 92, 109], "unicod": [0, 1, 2, 3, 5, 6, 7, 8, 10, 11, 12, 13, 17, 19, 20, 23, 26, 29, 30, 32, 33, 37, 42, 43, 44, 49, 53, 57, 62, 63, 64, 65, 66, 67, 68, 70, 71, 72, 73, 79, 80, 81, 82, 84, 85, 87, 89, 93, 94, 95, 96, 97, 98, 100, 101, 102, 103, 104, 106, 107, 108, 109, 110, 112, 113, 114], "fulli": [0, 31, 109, 113], "support": [0, 2, 5, 6, 9, 23, 24, 37, 39, 44, 46, 49, 62, 82, 85, 92, 97, 99, 107, 108, 111, 112, 113], "wide": [0, 5, 26, 99, 112], "rang": [0, 5, 9, 12, 23, 89, 90, 97, 110, 112], "standard": [0, 2, 5, 6, 9, 12, 33, 37, 59, 62, 83, 84, 85, 92, 93, 99, 103, 108, 109, 111, 112, 113], "see": [0, 1, 2, 106, 107, 108, 109, 110, 111, 112, 113], "also": [0, 1, 2, 106, 107, 108, 109, 111, 112, 113], "thi": [0, 1, 2, 4, 5, 6, 7, 8, 9, 12, 17, 18, 19, 22, 23, 24, 27, 30, 31, 32, 33, 34, 36, 37, 38, 40, 41, 42, 43, 44, 46, 50, 51, 53, 54, 55, 58, 59, 60, 61, 62, 64, 66, 67, 68, 70, 71, 72, 73, 76, 77, 79, 80, 81, 83, 84, 85, 86, 87, 88, 90, 93, 95, 97, 99, 102, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113], "video": 0, "stri_extract_al": [0, 2, 7, 46, 47, 54, 60, 90, 106, 107], "regex": [0, 2, 3, 4, 7, 9, 18, 27, 46, 58, 76, 82, 86, 91, 107, 109, 113], "p": [0, 9, 11, 12, 18, 27, 46, 48, 51, 52, 56, 63, 71, 76, 80, 82, 83, 84, 85, 86, 97, 98, 100, 107, 109, 111, 112, 113], "emoji": [0, 2, 9, 46, 103, 106, 111, 113], "c": [0, 1, 2, 6, 9, 12, 14, 15, 16, 17, 18, 23, 24, 27, 28, 29, 32, 38, 46, 48, 49, 50, 51, 52, 53, 54, 56, 58, 60, 61, 62, 65, 67, 68, 70, 72, 75, 76, 77, 79, 80, 81, 82, 83, 85, 86, 87, 88, 89, 90, 91, 92, 95, 97, 98, 100, 102, 103, 106, 107, 108, 109, 110, 111, 112, 113, 114], "\u6b61\u8fce": 0, "\u6b22\u8fce": 0, "\u03c7\u03b1\u03af\u03c1\u03b5\u03c4\u03b5": 0, "bienvenido": 0, "spam": [0, 19, 52, 58, 59, 83, 89, 106, 109, 112, 113], "1": [0, 1, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114], "2": [0, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114], "stri_count_fix": [0, 2, 18, 65, 107, 109], "acatgaacgggtacacactg": 0, "aca": [0, 60, 107, 109], "overlap": [0, 2, 9, 46, 58, 60, 65, 76, 107, 113], "true": [0, 1, 2, 5, 9, 12, 15, 17, 19, 21, 23, 24, 27, 29, 34, 36, 37, 43, 44, 46, 47, 48, 49, 50, 51, 52, 54, 58, 59, 64, 65, 66, 67, 68, 69, 71, 72, 75, 76, 80, 82, 83, 84, 85, 86, 89, 90, 91, 92, 93, 97, 100, 104, 106, 107, 108, 109, 110, 111, 113], "3": [0, 9, 13, 14, 16, 18, 23, 26, 27, 29, 34, 36, 37, 46, 48, 50, 51, 53, 54, 57, 58, 59, 60, 62, 64, 67, 70, 72, 76, 80, 82, 83, 85, 87, 88, 90, 93, 98, 101, 104, 106, 107, 108, 109, 110, 111, 112, 113, 114], "stri_sort": [0, 2, 3, 6, 8, 10, 13, 15, 17, 19, 29, 31, 47, 59, 64, 67, 72, 81, 83, 95, 102, 104, 108], "cudn\u00fd": [0, 108], "chladn\u00fd": [0, 108], "hladn\u00fd": [0, 108], "\u010dudn\u00fd": [0, 108], "sk_sk": [0, 17, 46, 56, 58, 67, 72, 80, 81, 92, 108], "come": [0, 2, 8, 95, 106, 112, 113], "numer": [0, 2, 4, 5, 9, 12, 21, 23, 30, 31, 64, 67, 72, 80, 85, 93, 104, 106, 107, 110, 113], "function": [0, 2, 4, 5, 9, 10, 11, 13, 15, 17, 18, 19, 20, 23, 24, 27, 29, 30, 31, 32, 34, 35, 36, 38, 40, 41, 42, 43, 44, 46, 47, 51, 52, 53, 54, 55, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 72, 73, 76, 77, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 97, 99, 100, 102, 103, 104, 105, 107, 108, 109, 110, 111, 112, 113], "relat": [0, 13, 15, 17, 23, 106, 107, 110, 111], "data": [0, 2, 3, 5, 9, 11, 22, 23, 30, 31, 38, 44, 62, 64, 67, 69, 72, 82, 93, 105, 107, 108, 111, 112, 113, 114], "cleans": [0, 110], "inform": [0, 2, 5, 6, 10, 12, 13, 17, 19, 33, 37, 47, 49, 55, 56, 57, 59, 67, 72, 80, 81, 83, 92, 93, 94, 106, 110], "extract": [0, 2, 3, 7, 12, 13, 29, 58, 82, 83, 110], "natur": [0, 2, 5, 7, 11, 13, 17, 29, 64, 102, 104, 108, 109, 113], "languag": [0, 2, 3, 5, 6, 7, 8, 11, 13, 17, 29, 31, 55, 57, 64, 65, 95, 97, 102, 104, 108, 109, 111, 112, 113, 114], "concaten": [0, 2, 3, 5, 13, 28, 106, 109, 113], "pad": [0, 2, 3, 13, 85], "wrap": [0, 2, 3, 8, 13, 68, 90, 109, 110], "substr": [0, 2, 3, 12, 13, 46, 60, 64, 76, 82, 107, 108, 109, 113], "pattern": [0, 2, 3, 4, 7, 10, 11, 12, 13, 23, 30, 66, 71, 96, 100, 108, 109, 112, 113, 114], "search": [0, 1, 2, 3, 4, 5, 6, 9, 11, 12, 13, 18, 19, 27, 29, 46, 47, 58, 59, 60, 63, 64, 66, 71, 76, 82, 83, 86, 87, 91, 100, 103, 109, 112, 113], "e": [0, 1, 2, 4, 5, 6, 7, 9, 12, 13, 14, 17, 19, 20, 22, 23, 30, 33, 37, 38, 39, 40, 42, 43, 44, 46, 47, 48, 51, 53, 54, 55, 56, 57, 59, 60, 63, 64, 66, 77, 79, 80, 81, 82, 83, 85, 86, 87, 88, 89, 92, 93, 94, 95, 98, 99, 100, 101, 104, 106, 107, 108, 109, 110, 111, 112, 113, 114], "g": [0, 1, 2, 4, 5, 6, 7, 9, 12, 14, 17, 20, 22, 23, 24, 30, 33, 38, 42, 44, 46, 48, 51, 53, 54, 55, 57, 63, 64, 66, 77, 80, 81, 82, 83, 85, 87, 88, 97, 99, 100, 106, 107, 108, 109, 110, 111, 112, 113, 114], "java": [0, 10, 12, 13, 33, 98, 113], "like": [0, 1, 2, 4, 5, 9, 12, 13, 14, 19, 23, 24, 31, 47, 51, 59, 68, 76, 83, 90, 102, 106, 107, 108, 109, 110, 111, 112, 113], "regular": [0, 4, 5, 7, 9, 12, 13, 60, 66, 84, 100, 107, 109, 114], "express": [0, 4, 5, 7, 9, 12, 13, 60, 66, 84, 100, 107, 109, 114], "collat": [0, 2, 3, 6, 7, 10, 13, 29, 67, 72, 80, 81, 102, 107, 109], "sort": [0, 2, 3, 5, 6, 13, 37, 64, 67, 90], "rank": [0, 2, 3, 13, 81, 108], "random": [0, 2, 3, 9, 13, 69, 70, 79, 106], "gener": [0, 1, 2, 3, 4, 6, 7, 8, 12, 13, 18, 23, 27, 32, 39, 40, 42, 44, 45, 46, 53, 58, 59, 61, 70, 81, 85, 86, 89, 90, 93, 95, 98, 99, 100, 103, 106, 107, 108, 110, 113], "transliter": [0, 2, 3, 13, 108, 109, 110], "case": [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 17, 19, 24, 27, 30, 31, 43, 44, 46, 47, 51, 53, 55, 58, 60, 63, 64, 65, 66, 70, 76, 82, 83, 89, 97, 99, 104, 106, 107, 109, 111, 113], "map": [0, 2, 3, 5, 6, 13, 40, 43, 55, 65, 106, 113], "fold": [0, 2, 3, 13, 99], "normalis": [0, 2, 64, 104, 108, 109, 112], "date": [0, 2, 3, 13, 24, 85, 93, 94, 108, 109, 113], "time": [0, 2, 3, 5, 9, 11, 12, 13, 14, 24, 28, 29, 66, 82, 85, 94, 96, 106, 107, 108, 109, 113], "format": [0, 2, 3, 8, 9, 12, 13, 16, 30, 99, 106, 108, 111, 113], "pars": [0, 2, 3, 13, 108, 110, 113], "mani": [0, 2, 6, 7, 9, 12, 13, 55, 57, 58, 94, 99, 100, 104, 106, 107, 108, 109, 110, 111, 112, 113], "more": [0, 2, 4, 5, 6, 8, 9, 10, 12, 13, 17, 18, 19, 23, 24, 27, 30, 31, 33, 37, 43, 44, 46, 47, 48, 56, 57, 58, 59, 60, 64, 67, 72, 73, 76, 80, 81, 82, 83, 86, 91, 92, 94, 95, 99, 100, 104, 106, 107, 108, 109, 110, 111, 112, 113], "among": [0, 2, 5, 9, 13, 60, 68], "most": [0, 1, 2, 5, 9, 23, 24, 26, 30, 35, 36, 64, 66, 99, 103, 104, 106, 108, 109, 110, 111, 112, 113], "often": [0, 10, 30, 35, 62, 69, 97, 99, 107, 109, 113], "download": [0, 1, 2, 108, 110], "you": [0, 1, 2, 4, 5, 6, 9, 10, 11, 12, 17, 30, 31, 38, 39, 42, 43, 48, 51, 52, 55, 57, 58, 62, 66, 70, 76, 82, 86, 87, 99, 100, 104, 109, 114], "can": [0, 1, 2, 4, 5, 8, 9, 30, 32, 38, 41, 43, 44, 70, 74, 78, 95, 97, 98, 100, 104, 106, 107, 108, 109, 110, 111, 112, 113], "obtain": [0, 2, 5, 9, 30, 31, 55, 87, 88, 93, 106, 107, 109, 113], "from": [0, 1, 2, 3, 4, 5, 9, 12, 13, 17, 21, 23, 26, 29, 30, 37, 43, 44, 46, 51, 58, 59, 66, 67, 69, 71, 76, 80, 82, 84, 86, 90, 91, 93, 97, 99, 107, 108, 110, 111, 112, 113], "cran": [0, 1, 2, 108], "call": [0, 1, 2, 4, 5, 6, 11, 14, 15, 17, 18, 19, 20, 22, 23, 27, 30, 41, 42, 43, 44, 46, 47, 48, 55, 57, 58, 59, 60, 73, 76, 82, 83, 85, 86, 91, 93, 97, 104, 106, 107, 108, 109, 110, 111, 112, 113], "instal": [0, 2, 108, 109], "": [0, 1, 2, 3, 107, 108, 109, 110, 111, 112, 113, 114], "sourc": [0, 1, 2, 69, 108, 109, 110, 111], "code": [0, 2, 3, 5, 6, 8, 9, 12, 13, 15, 17, 19, 31, 32, 33, 40, 42, 43, 44, 62, 64, 65, 68, 71, 79, 85, 86, 87, 89, 93, 95, 96, 102, 104, 108, 109, 112], "host": 0, "github": [0, 1, 2, 5, 6, 8, 9, 10, 12, 13, 17, 20, 23, 26, 29, 30, 44, 63, 64, 65, 66, 67, 72, 80, 81, 93, 94, 95, 97, 98, 99, 102, 103, 110, 111, 113], "It": [0, 2, 5, 6, 11, 13, 18, 27, 38, 55, 72, 77, 81, 82, 95, 104, 105, 106, 107, 109, 110, 111, 112, 113], "distribut": [0, 2, 13, 69], "under": [0, 5, 13, 110], "open": [0, 2, 9, 73, 74, 105, 106, 107, 108, 109, 110, 111, 112, 113], "bsd": [0, 2, 13], "claus": [0, 2, 13], "licens": [0, 2, 13], "The": [0, 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114], "api": [0, 2, 9, 13, 24, 26, 32, 38, 63, 64, 66, 93, 94, 109], "wa": [0, 2, 13, 29, 46, 49, 60, 68, 99, 104, 106, 107, 108, 109, 110, 111, 112, 113], "inspir": [0, 12, 31, 113], "earli": [0, 2, 109], "pre": [0, 1, 2, 108, 113], "tidyvers": 0, "v0": 0, "6": [0, 14, 16, 18, 22, 26, 30, 37, 47, 48, 51, 56, 58, 59, 67, 72, 76, 83, 85, 93, 98, 106, 108, 109, 110, 112, 113, 114], "version": [0, 2, 20, 32, 37, 44, 49, 75, 80, 89, 90, 101, 102, 106, 107, 108, 109, 111, 112, 113], "hadlei": [0, 114], "wickham": [0, 114], "stringr": [0, 2, 109, 114], "sinc": [0, 9, 12, 25, 46, 76, 93, 109, 113], "2015": [0, 20, 21, 23, 109, 110, 114], "v1": 0, "0": [0, 9, 12, 17, 18, 21, 22, 23, 27, 29, 30, 31, 32, 37, 44, 51, 52, 54, 58, 59, 64, 66, 67, 68, 71, 72, 73, 76, 80, 82, 85, 89, 90, 91, 92, 93, 99, 103, 104, 106, 107, 108, 109, 110, 111, 112, 113, 114], "power": [0, 12, 109], "moreov": [0, 2, 5, 9, 19, 24, 27, 38, 51, 53, 54, 58, 76, 84, 85, 91, 104, 106, 107, 108, 110, 111, 112, 113], "suggest": [0, 2, 104, 105], "quit": [0, 1, 5, 12, 66, 107, 109, 110, 113], "few": [0, 1, 2, 12, 23, 30, 31, 85, 111, 112, 113], "new": [0, 2, 12, 14, 83, 93, 104, 106, 109, 113], "featur": [0, 1, 2, 12, 19, 59, 60, 68, 83, 85, 109, 112, 113], "contribut": [0, 13], "bart\u0142omiej": 0, "tartanu": [0, 13], "other": [0, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 113, 114], "greatli": 0, "appreci": 0, "stringx": [0, 109, 114], "set": [0, 1, 2, 3, 4, 5, 6, 9, 11, 12, 17, 18, 19, 20, 21, 22, 23, 27, 29, 32, 39, 42, 43, 44, 46, 47, 49, 51, 53, 58, 59, 60, 67, 69, 71, 72, 76, 80, 81, 82, 83, 84, 86, 91, 94, 95, 102, 106, 107, 108, 109, 110, 111, 112], "wrapper": [0, 60, 100, 109, 113], "around": [0, 109, 110, 113], "base": [0, 1, 2, 5, 7, 9, 10, 12, 13, 15, 21, 22, 23, 24, 29, 31, 64, 69, 72, 85, 86, 89, 90, 97, 102, 103, 104, 106, 107, 108, 110, 111, 112, 113], "compat": [0, 2, 12, 23, 85, 99, 103, 104, 109, 111, 112, 113], "To": [0, 1, 3, 17, 97, 107, 108, 109, 110, 111, 112, 113], "learn": [0, 106, 107, 108, 109, 110, 111, 112, 113], "about": [0, 2, 106, 107, 108, 109, 110, 111, 112, 113], "check": [0, 1, 2, 3, 5, 6, 9, 17, 30, 31, 38, 46, 64, 68, 85, 86, 106, 107, 108, 109, 110, 111, 112, 113], "out": [0, 1, 2, 5, 9, 46, 50, 68, 69, 89, 100, 106, 107, 108, 109, 110, 111, 112, 113], "marek": [0, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113], "access": [0, 2, 9, 16, 42, 106, 107, 108, 109, 110, 111, 112, 113], "free": [0, 12, 95, 106, 107, 108, 109, 110, 111, 112, 113], "textbook": [0, 106, 107, 108, 109, 110, 111, 112, 113], "deep": [0, 4, 106, 107, 108, 109, 110, 111, 112, 113, 114], "program": [0, 5, 6, 104, 106, 107, 108, 109, 110, 111, 112, 113, 114], "citat": [0, 110], "gagolewski": [0, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 108, 114], "m": [0, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 112, 113, 114], "journal": [0, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114], "statist": [0, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114], "softwar": [0, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114], "103": [0, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 114], "2022": [0, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 114], "59": [0, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 111, 113, 114], "doi": [0, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 114], "10": [0, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 108, 109, 110, 111, 113, 114], "18637": [0, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 114], "jss": [0, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 114], "v103": [0, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 114], "i02": [0, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 114], "In": [1, 2, 3, 4, 5, 6, 9, 12, 13, 19, 23, 29, 38, 44, 46, 47, 51, 55, 58, 69, 76, 78, 82, 83, 90, 91, 93, 97, 104, 107, 108, 109, 111, 112, 113], "simpl": [1, 2, 5, 38, 65, 69, 104, 107, 108], "howev": [1, 2, 5, 6, 9, 12, 14, 30, 35, 36, 44, 54, 55, 60, 62, 76, 97, 107, 108, 109, 112, 113], "due": [1, 4, 5, 37, 106, 107, 108, 109, 111, 113], "overwhelm": 1, "complex": [1, 5, 10, 11, 64, 96, 104, 107], "librari": [1, 2, 17, 31, 49, 100, 108, 109, 110, 111, 113], "upon": [1, 111], "which": [1, 2, 4, 5, 6, 8, 9, 10, 13, 19, 29, 30, 40, 44, 51, 58, 62, 64, 67, 68, 73, 78, 80, 81, 82, 83, 85, 93, 99, 104, 106, 107, 108, 109, 110, 111, 112, 113], "divers": 1, "environ": [1, 2, 41, 88, 113], "oper": [1, 2, 3, 4, 5, 7, 8, 9, 13, 14, 15, 17, 21, 29, 30, 32, 42, 57, 62, 66, 68, 70, 71, 79, 89, 90, 94, 97, 102, 104, 107, 108, 109, 110, 111], "might": [1, 2, 9, 11, 17, 19, 23, 27, 30, 37, 44, 85, 89, 93, 103, 106, 107, 108, 109, 111, 113], "still": [1, 2, 6, 111, 113], "experi": [1, 104, 114], "issu": [1, 2, 4, 13, 42, 44, 109, 113], "hopefulli": 1, "thei": [1, 2, 5, 9, 12, 13, 15, 17, 23, 32, 43, 44, 46, 58, 60, 63, 65, 67, 76, 80, 86, 91, 97, 107, 108, 109, 111, 112, 113], "resolv": [1, 2, 108], "short": [1, 2, 9, 11, 23, 49, 92, 110], "manual": [1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105], "below": [1, 2, 4, 5, 8, 9, 12, 17, 33, 46, 58, 64, 67, 76, 80, 87, 97, 106, 107, 108, 110, 111, 112, 113, 114], "we": [1, 2, 4, 5, 6, 9, 29, 33, 38, 39, 44, 45, 53, 54, 87, 88, 103, 105, 106, 107, 108, 109, 110, 111, 112, 113], "describ": [1, 9, 10, 11, 12, 54, 106, 108, 113], "some": [1, 2, 4, 5, 9, 11, 12, 13, 23, 24, 30, 33, 37, 44, 48, 55, 56, 57, 58, 63, 66, 85, 88, 89, 92, 97, 101, 106, 107, 109, 110, 111, 112, 113], "avail": [1, 2, 3, 6, 7, 9, 12, 23, 37, 46, 65, 66, 76, 85, 92, 97, 107, 108, 109, 111, 112, 113], "tweak": [1, 2, 11, 107], "ar": [1, 2, 4, 5, 6, 7, 9, 10, 12, 13, 15, 16, 17, 19, 21, 23, 24, 25, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 42, 43, 44, 45, 46, 47, 49, 50, 51, 52, 53, 54, 56, 57, 58, 59, 60, 62, 63, 64, 66, 67, 69, 71, 76, 80, 82, 83, 84, 85, 86, 87, 89, 90, 91, 93, 96, 97, 98, 99, 100, 101, 102, 103, 104, 106, 107, 108, 109, 110, 111, 112, 113], "strongli": [1, 9, 113], "encourag": [1, 103, 109], "reli": [1, 2, 5, 86, 100, 107, 108, 109, 110, 111, 113], "our": [1, 2, 4, 5, 100, 107, 109, 110, 113], "custom": [1, 2, 63, 85, 97, 109, 112], "74": [1, 2, 37, 57, 93, 98, 110, 112], "bundl": [1, 2, 6, 26, 57, 108], "configur": [1, 2, 30, 89, 108, 109, 110], "arg": [1, 2, 108, 109], "disabl": [1, 2, 12, 108, 109], "pkg": [1, 2, 108, 109], "config": [1, 2, 108, 109], "ensur": [1, 111], "maximum": [1, 108], "portabl": [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 108, 109, 111, 113, 114], "across": [1, 2, 109, 111], "all": [1, 2, 3, 4, 5, 6, 7, 9, 10, 12, 13, 15, 17, 18, 19, 22, 23, 26, 27, 28, 29, 30, 31, 33, 34, 36, 38, 40, 43, 44, 45, 46, 47, 52, 56, 57, 58, 59, 60, 61, 64, 76, 82, 83, 85, 93, 94, 99, 100, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114], "platform": [1, 2, 5, 6, 13, 38, 84, 94, 105, 108, 109, 111], "window": [1, 2, 5, 30, 33, 36, 37, 62, 92, 93, 101, 105, 108, 109, 111], "maco": [1, 37, 108, 111], "user": [1, 2, 5, 6, 8, 9, 10, 12, 17, 20, 23, 26, 29, 30, 39, 44, 63, 64, 65, 66, 67, 72, 80, 81, 93, 95, 97, 98, 99, 102, 108, 109, 112, 113], "fetch": [1, 92, 93, 110], "compil": [1, 2, 108, 109], "binari": [1, 2, 3, 7, 14, 18, 73, 74, 87, 100, 105, 106, 109, 112, 113], "built": [1, 2, 49, 51, 54, 85, 106, 109, 111, 112], "precis": [1, 2, 5, 6, 66, 93, 106, 107, 111], "wai": [1, 2, 5, 10, 11, 12, 16, 23, 34, 35, 36, 44, 50, 64, 73, 77, 82, 97, 104, 105, 106, 107, 108, 111, 112, 113], "depend": [1, 2, 5, 6, 8, 9, 12, 15, 17, 18, 22, 23, 27, 29, 46, 57, 58, 66, 67, 72, 76, 80, 81, 82, 84, 86, 91, 94, 95, 97, 102, 104, 108, 111, 113], "61": [1, 2, 26, 37, 46, 56, 93, 98, 110, 111], "togeth": [1, 3, 6, 49, 97, 111], "ship": [1, 2, 108], "one": [1, 2, 4, 5, 6, 8, 9, 12, 18, 20, 23, 26, 27, 32, 33, 38, 42, 44, 46, 48, 53, 54, 55, 58, 60, 62, 63, 64, 68, 71, 76, 87, 90, 92, 93, 95, 97, 99, 105, 106, 107, 108, 109, 110, 113], "follow": [1, 2, 4, 5, 6, 7, 9, 12, 13, 19, 22, 26, 29, 30, 31, 33, 45, 47, 49, 55, 59, 63, 69, 84, 85, 87, 88, 92, 95, 97, 99, 101, 103, 104, 106, 107, 108, 109, 110, 111, 112, 113], "requir": [1, 2, 11, 12, 23, 63, 107, 108, 109, 110, 112], "met": [1, 93], "http": [1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 110, 111, 113, 114], "org": [1, 2, 5, 6, 8, 9, 10, 12, 13, 17, 20, 23, 26, 29, 30, 44, 63, 64, 65, 66, 67, 72, 80, 81, 84, 85, 93, 94, 95, 97, 98, 99, 100, 102, 103, 110, 111, 113, 114], "libicu": [1, 2, 108], "devel": [1, 108], "fedora": [1, 108], "cento": [1, 2], "opensus": [1, 2, 108], "dev": [1, 2, 9, 13, 26, 37, 63, 64, 66, 93, 94, 108], "ubuntu": [1, 2, 108, 109], "debian": [1, 108], "etc": [1, 2, 4, 5, 12, 21, 22, 26, 42, 46, 63, 82, 93, 108, 109, 111, 112, 113], "fail": [1, 2, 5, 12, 30, 31, 39, 41, 43, 62, 66], "find": [1, 4, 8, 9, 50, 58, 67, 107, 109, 110, 112, 113], "appropri": [1, 8, 44, 46, 64, 82, 108], "project": [1, 2, 10, 100, 109], "r": [1, 2, 4, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 110, 111, 112, 113, 114], "cmd": [1, 88], "argument": [1, 2, 5, 6, 13, 106, 107, 108, 109], "stringi_disable_pkg_config": [1, 2], "variabl": [1, 2, 64, 106, 108, 113], "non": [1, 2, 4, 5, 9, 10, 12, 17, 19, 20, 21, 22, 23, 27, 29, 45, 47, 59, 64, 67, 69, 70, 71, 79, 80, 83, 87, 89, 91, 101, 102, 104, 106, 108, 109, 111, 112], "zero": [1, 2, 3, 5, 9, 12, 23, 58, 82, 103, 104, 106, 109], "execut": [1, 45, 109], "addit": [1, 2, 17, 18, 19, 23, 27, 29, 46, 47, 58, 59, 60, 67, 72, 76, 80, 81, 82, 83, 86, 91, 93, 95, 102, 110, 113], "option": [1, 2, 6, 15, 17, 29, 30, 43, 51, 52, 67, 72, 80, 81, 102, 106, 109, 112, 113], "script": [1, 2, 9, 12, 68, 71, 97, 112, 113], "enforc": [1, 109], "system": [1, 2, 5, 6, 8, 9, 38, 39, 49, 85, 107, 108, 109, 111, 113], "extra": [1, 64, 96, 108], "cxxflag": 1, "flag": [1, 2, 12, 23, 49, 66, 85], "cppflag": [1, 2], "preprocessor": 1, "ldflag": [1, 2], "linker": 1, "lib": [1, 2, 49], "link": [1, 2, 9, 13, 109, 110], "against": [1, 2, 30, 107, 109], "pkg_config_path": 1, "an": [1, 2, 4, 5, 6, 9, 12, 14, 17, 18, 19, 20, 21, 22, 23, 25, 26, 28, 30, 32, 33, 37, 38, 39, 40, 42, 43, 44, 45, 46, 47, 50, 51, 52, 53, 58, 59, 62, 63, 64, 66, 67, 77, 80, 81, 82, 83, 85, 86, 87, 88, 89, 93, 100, 101, 102, 103, 104, 106, 107, 108, 109, 111, 112, 113], "list": [1, 2, 3, 4, 5, 6, 8, 9, 12, 13, 16, 17, 18, 19, 27, 29, 30, 31, 32, 33, 34, 35, 36, 39, 42, 44, 46, 47, 49, 55, 58, 59, 60, 67, 72, 76, 80, 81, 82, 83, 84, 86, 90, 91, 92, 95, 97, 102, 103, 104, 107, 109, 110, 111, 112, 113], "directori": 1, "pc": [1, 9, 37], "file": [1, 2, 3, 5, 13, 30, 63, 84, 85, 87, 88, 107, 108, 110, 112, 113], "r_home": 1, "overrid": 1, "usr": 1, "lib64": 1, "note": [1, 2, 5, 8, 9, 10, 11, 12, 13, 14, 17, 18, 19, 20, 22, 23, 30, 32, 35, 36, 39, 40, 41, 43, 44, 46, 47, 51, 53, 56, 57, 58, 63, 64, 66, 68, 76, 79, 82, 83, 85, 86, 89, 93, 95, 97, 99, 100, 101, 103, 104, 106, 107, 109, 110, 112], "bin": [1, 2], "point": [1, 2, 3, 5, 8, 9, 12, 13, 15, 17, 19, 31, 32, 33, 40, 42, 44, 62, 64, 65, 68, 71, 79, 85, 86, 87, 89, 93, 95, 96, 102, 104, 107, 108, 109, 112], "cat": [1, 5, 16, 68, 69, 85, 93, 103, 104, 112, 113], "command": [1, 3, 113], "us": [1, 2, 4, 5, 6, 7, 8, 9, 10, 12, 13, 15, 16, 17, 18, 19, 23, 24, 26, 27, 30, 31, 32, 33, 38, 39, 40, 42, 43, 44, 45, 46, 47, 48, 49, 51, 52, 53, 54, 55, 57, 58, 59, 60, 62, 63, 64, 65, 66, 67, 68, 69, 76, 77, 78, 80, 81, 82, 83, 84, 85, 86, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 103, 104, 105, 106, 107, 108, 109, 111, 112, 114], "pkg_config": [1, 2], "necessari": [1, 2, 4, 15, 18, 27, 46, 58, 60, 71, 76, 82, 85, 86, 91, 106, 107, 109], "exist": [1, 2, 5, 12, 109], "stringi_disable_icu_bundl": [1, 2], "stringi_cxxflag": [1, 2], "stringi_cppflag": [1, 2], "stringi_ldflag": [1, 2], "stringi_lib": [1, 2], "If": [1, 2, 3, 4, 6, 12, 18, 27, 30, 31, 32, 37, 39, 40, 42, 43, 44, 46, 48, 49, 51, 52, 53, 54, 58, 60, 64, 66, 67, 71, 76, 80, 82, 83, 84, 85, 86, 89, 90, 93, 96, 101, 104, 106, 107, 108, 109, 111, 113, 114], "do": [1, 2, 5, 12, 33, 37, 39, 55, 62, 63, 70, 85, 93, 109, 113], "manag": [1, 2, 13], "up": [1, 2, 5, 9, 10, 11, 12, 17, 18, 27, 46, 58, 65, 67, 72, 76, 80, 81, 82, 83, 86, 91, 106, 107, 109], "success": 1, "hesit": 1, "bug": [1, 2], "report": [1, 2, 9, 12, 19, 66, 84, 99, 103, 106, 111, 112, 114], "pleas": [1, 5, 9, 10, 17, 24, 44, 63, 100, 114], "archiv": [1, 114], "close": [1, 9, 113], "first": [1, 2, 4, 7, 8, 9, 10, 12, 17, 22, 23, 29, 31, 33, 46, 48, 51, 52, 58, 59, 60, 76, 86, 93, 95, 97, 100, 104, 106, 107, 108, 109, 110, 111, 112, 113], "solut": [1, 109], "your": [1, 4, 5, 6, 9, 38, 39, 62, 86], "problem": [1, 2, 99, 109, 114], "ha": [1, 2, 5, 30, 38, 39, 43, 48, 51, 52, 53, 56, 86, 89, 94, 98, 106, 107, 108, 109, 111, 113], "alreadi": [1, 29, 94, 108, 113], "been": [1, 2, 5, 9, 30, 53, 63, 86, 94, 107, 108, 109, 113], "post": 1, "diagnos": [1, 44], "error": [1, 2, 4, 9, 12, 33, 53, 66, 85, 87, 104, 109, 113], "further": [1, 5, 13, 107, 108, 110, 113], "run": [1, 2, 30, 46, 57, 62, 76, 86, 89, 94], "termin": [1, 12, 27, 63, 66, 113], "submit": 1, "output": [1, 2, 5, 23, 42, 43, 44, 47, 53, 58, 59, 67, 68, 70, 71, 73, 74, 79, 80, 81, 85, 89, 91, 99, 105, 106, 109, 112], "well": [1, 2, 4, 9, 13, 36, 45, 49, 64, 89, 91, 103, 106, 107, 108, 110, 111, 112, 113], "content": [1, 13, 84, 99, 106, 108, 111, 114], "log": [1, 67, 80], "cd": [1, 106, 111], "tmp": 1, "wget": 1, "com": [1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 110, 111, 114], "gagolew": [1, 2, 110, 111], "master": [1, 12, 103, 110, 111, 114], "zip": [1, 2], "unzip": 1, "build": [2, 108], "bugfix": 2, "fix": [2, 3, 10, 11, 12, 18, 27, 43, 46, 49, 58, 62, 66, 76, 82, 86, 91, 109, 113], "string": [2, 3, 4, 5, 6, 8, 9, 11, 12, 14, 16, 18, 19, 20, 21, 22, 23, 25, 26, 27, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 45, 46, 47, 49, 51, 53, 54, 55, 56, 57, 58, 59, 60, 62, 63, 64, 65, 66, 67, 69, 72, 73, 74, 76, 77, 81, 87, 88, 89, 90, 91, 92, 93, 94, 96, 97, 98, 99, 101, 102, 103, 104, 105, 109, 110, 114], "liter": [2, 12, 23, 66, 76, 109, 113], "potenti": [2, 69, 99, 110], "insecur": 2, "warn": [2, 4, 6, 9, 12, 18, 24, 26, 27, 32, 39, 40, 42, 44, 53, 66, 76, 85, 86, 91, 96, 101, 109], "501": [2, 37, 56, 93, 98], "32": [2, 3, 5, 37, 44, 46, 93, 98, 111, 112], "bit": [2, 5, 31, 32, 33, 36, 39, 40, 42, 43, 62, 93], "resolvelocalenam": 2, "502": [2, 37, 93, 98], "pkg_cppflag": 2, "now": [2, 57, 108, 109, 110, 111, 112], "consid": [2, 44, 64, 106, 108, 109, 112, 113], "befor": [2, 9, 12, 26, 30, 45, 64, 92, 104, 108, 110, 111, 113], "same": [2, 5, 6, 9, 13, 17, 29, 33, 38, 39, 50, 53, 54, 55, 57, 62, 64, 72, 81, 82, 91, 93, 99, 102, 103, 107, 108, 109, 113], "type": [2, 5, 8, 9, 19, 44, 53, 59, 63, 74, 82, 83, 89, 90, 95, 105, 106, 107, 108, 109, 111, 112, 113], "make": [2, 5, 8, 86, 90, 95, 99, 107, 108, 109], "what": [2, 5, 8, 9, 11, 12, 17, 39, 43, 58, 60, 107, 110, 113], "happen": [2, 108, 109, 113], "makevar": 2, "doubl": [2, 109], "convers": [2, 11, 13, 24, 30, 44, 74, 85, 97, 111], "loongarch": 2, "restor": [2, 57, 94], "463": [2, 37, 93, 98, 109], "updat": [2, 111], "cldr": 2, "44": [2, 9, 37, 93, 98, 110, 111, 113], "backward": [2, 64, 109], "incompat": 2, "solari": [2, 39], "drop": [2, 4, 110], "longer": [2, 36, 91, 96, 109], "veri": [2, 4, 5, 9, 11, 12, 19, 39, 59, 69, 83, 104, 106, 107, 108, 109, 110, 113], "outdat": 2, "icu55": 2, "A": [2, 3, 5, 9, 12, 13, 23, 26, 35, 36, 40, 43, 46, 47, 48, 63, 64, 65, 66, 71, 79, 80, 84, 90, 93, 95, 106, 107, 109, 111, 112, 113], "least": [2, 4, 12, 27, 30, 31, 68, 71, 87, 109, 112, 113], "469": [2, 37, 93, 98], "miss": [2, 3, 16, 27, 29, 38, 40, 42, 43, 44, 46, 47, 48, 50, 51, 53, 60, 61, 62, 64, 66, 67, 72, 75, 80, 82, 85, 87, 89, 90, 91, 106, 107, 111, 113], "field": [2, 3, 23, 82], "stri_datetime_pars": [2, 23, 24, 109, 112], "stri_datetime_cr": [2, 3, 20, 22, 23, 24, 25, 26, 92, 93, 94, 112], "default": [2, 5, 12, 15, 17, 18, 19, 20, 21, 22, 23, 26, 27, 29, 31, 33, 37, 38, 39, 43, 44, 46, 47, 49, 55, 57, 58, 59, 60, 63, 64, 65, 66, 67, 68, 72, 73, 76, 80, 81, 82, 83, 84, 85, 86, 89, 91, 92, 93, 94, 95, 97, 100, 102, 104, 105, 106, 107, 109, 111, 112, 113], "todai": [2, 23, 113], "midnight": [2, 23], "remov": [2, 3, 5, 9, 17, 30, 37, 43, 67, 76, 80, 82, 84, 97, 98, 99, 100, 102, 107, 108, 110, 111], "long": [2, 4, 23, 92, 93, 110, 112], "deprec": [2, 3, 9, 29, 69, 73, 74, 105], "defunct": 2, "fallback_encod": 2, "paramet": [2, 10, 84, 89, 90, 106, 107, 108], "stri_read_lin": [2, 3, 13, 74, 87, 105, 111], "ellipsi": [2, 36], "stri_opts_col": [2, 3, 6, 7, 8, 10, 13, 15, 17, 18, 19, 27, 29, 31, 46, 47, 58, 59, 67, 72, 76, 80, 81, 82, 83, 86, 91, 95, 102, 104, 108], "stri_opts_regex": [2, 3, 7, 12, 18, 27, 46, 58, 60, 76, 82, 91], "stri_opts_fix": [2, 3, 7, 11, 18, 27, 46, 58, 76, 82, 86, 91, 107], "stri_opts_brkit": [2, 3, 7, 8, 19, 47, 59, 83, 84, 95, 104, 112], "As": [2, 5, 15, 32, 45, 67, 80, 90, 91, 99, 102, 106, 107, 108, 109], "per": [2, 4, 6, 57, 69, 104, 107, 112], "prof": [2, 59, 83], "brian": 2, "riplei": 2, "icudt74l": 2, "littl": [2, 111], "endian": [2, 111], "includ": [2, 3, 6, 7, 8, 9, 12, 13, 18, 26, 27, 46, 58, 60, 62, 76, 82, 86, 88, 89, 91, 103, 107, 109, 110, 113], "tarbal": 2, "compress": 2, "xz": 2, "save": [2, 92, 93], "space": [2, 5, 8, 9, 12, 18, 23, 46, 66, 76, 85, 87, 88, 100, 103, 104, 106, 111, 112, 113], "allow": [2, 5, 9, 10, 12, 17, 18, 21, 27, 32, 46, 58, 60, 66, 85, 89, 104, 106, 108, 113], "stringi": [2, 4, 5, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114], "internet": 2, "476": [2, 37, 56, 93, 98], "break": [2, 8, 19, 47, 59, 63, 83, 95, 104, 112, 114], "iter": [2, 4, 8, 9, 19, 47, 59, 63, 83, 95, 104, 112], "emit": [2, 6, 91], "when": [2, 4, 5, 6, 8, 12, 17, 23, 43, 53, 58, 60, 64, 66, 68, 81, 84, 85, 92, 93, 95, 104, 106, 107, 108, 109, 111, 112, 113], "root": [2, 26], "resourc": [2, 6, 26, 56, 107, 108, 111], "return": [2, 5, 7, 12, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 68, 69, 70, 71, 73, 74, 75, 76, 77, 78, 79, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 112], "explicitli": [2, 6, 44, 89, 108], "request": [2, 5, 6, 24, 56, 108, 111], "pass": [2, 13, 16, 18, 27, 46, 55, 58, 60, 76, 82, 85, 86, 89, 90, 91, 107, 108, 109, 111], "unknown": [2, 5, 6, 30, 33, 38, 113], "null": [2, 6, 17, 18, 19, 20, 21, 22, 23, 26, 27, 29, 31, 32, 33, 39, 41, 42, 44, 46, 47, 51, 52, 55, 57, 58, 59, 60, 63, 64, 67, 72, 73, 76, 80, 81, 82, 83, 85, 86, 91, 92, 94, 95, 98, 102, 104, 105, 106, 108, 109], "stri_enc_get": [2, 5, 38, 39, 41, 43, 44], "amongst": [2, 106, 108, 109, 110, 112, 113], "those": [2, 5, 6, 10, 78, 113], "stri_enc_list": [2, 3, 5, 33, 38, 39, 44, 111], "recommend": [2, 99, 104, 113], "identifi": [2, 3, 9, 19, 20, 21, 22, 23, 24, 26, 31, 33, 37, 47, 55, 56, 59, 92, 94, 95, 97, 98, 104, 107, 108, 109, 112, 113], "en_us_posix": [2, 6, 56], "did": [2, 6], "reset": 2, "calendar": [2, 6, 20, 21, 22, 23, 26, 92, 108, 112], "object": [2, 3, 14, 15, 17, 19, 20, 22, 23, 25, 32, 38, 42, 46, 47, 50, 51, 53, 59, 62, 63, 64, 65, 66, 73, 74, 77, 82, 83, 89, 103, 105, 106, 107, 108, 109, 110, 112], "multipl": [2, 3, 23, 67, 68, 89, 91, 104, 106, 108, 109], "487": [2, 37, 93, 98], "accept": [2, 63], "ascii": [2, 3, 5, 9, 12, 23, 31, 33, 36, 37, 38, 39, 43, 44, 45, 66, 71, 97, 98, 103, 104, 106, 108, 110, 111, 112, 113], "than": [2, 4, 5, 8, 9, 10, 12, 14, 17, 23, 29, 38, 40, 44, 51, 52, 54, 58, 62, 64, 67, 70, 71, 89, 90, 91, 102, 104, 108, 109, 112, 113], "858993457": 2, "charact": [2, 3, 4, 6, 7, 8, 10, 11, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 32, 34, 35, 36, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 52, 53, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 76, 78, 79, 80, 81, 82, 83, 84, 85, 86, 90, 91, 92, 93, 94, 95, 97, 98, 99, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 114], "input": [2, 4, 5, 11, 12, 17, 30, 32, 38, 40, 44, 45, 51, 63, 64, 66, 67, 73, 76, 80, 82, 84, 89, 90, 95, 96, 97, 99, 104, 106, 107, 108, 109, 113], "rchk": 2, "chang": [2, 5, 6, 9, 12, 30, 39, 42, 57, 66, 68, 85, 89, 93, 94, 95, 104, 106, 107, 108, 112], "IF": 2, "72": [2, 37, 59, 93, 98], "word": [2, 3, 8, 9, 12, 19, 47, 59, 63, 66, 69, 76, 83, 88, 91, 95, 106, 108, 109], "detail": [2, 4, 106, 107, 108, 109, 113], "pull": 2, "2256": 2, "document": [2, 4, 8, 9, 13, 26, 63, 64, 66, 93, 94, 99, 113, 114], "paper": [2, 10, 106, 107, 108, 109, 110, 111, 112, 113], "publish": [2, 98, 106, 107, 108, 109, 110, 111, 112, 113], "473": [2, 37, 93, 98], "397": [2, 37, 93, 98], "buffer": 2, "overflow": 2, "stri_dup": [2, 3, 13, 14, 48, 51, 52, 106], "stri_past": [2, 51, 70, 71, 77, 85, 86, 104, 106], "gracious": 2, "attempt": 2, "length": [2, 3, 4, 9, 11, 12, 16, 29, 30, 31, 38, 46, 47, 48, 51, 52, 53, 54, 58, 59, 62, 67, 68, 69, 71, 76, 80, 81, 82, 83, 85, 89, 90, 91, 99, 103, 104, 107, 108, 109, 112, 113], "31": [2, 19, 20, 21, 23, 26, 37, 46, 56, 59, 83, 93, 98, 110], "each": [2, 3, 4, 5, 6, 7, 8, 9, 13, 14, 18, 24, 27, 28, 29, 30, 31, 32, 37, 40, 42, 46, 47, 51, 52, 53, 54, 58, 60, 62, 68, 71, 72, 73, 76, 77, 82, 84, 86, 87, 88, 89, 90, 95, 96, 97, 98, 99, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113], "480": [2, 37, 93, 98], "rf_isnul": 2, "instead": [2, 58, 62, 68, 85, 104, 109], "isnul": 2, "462": [2, 37, 93, 98], "That": 2, "doe": [2, 4, 5, 6, 8, 9, 12, 17, 23, 24, 33, 55, 64, 89, 90, 93, 103, 104, 107, 108, 109, 113], "handl": [2, 5, 6, 8, 13, 30, 38, 50, 53, 62, 77, 89, 97, 101, 108, 109], "neg": [2, 12, 27, 29, 58, 64, 82, 83, 86, 89, 90, 104, 106, 107, 108, 113], "number": [2, 3, 5, 6, 7, 9, 12, 13, 16, 20, 22, 23, 25, 27, 28, 31, 33, 46, 54, 63, 64, 68, 69, 71, 76, 82, 83, 85, 87, 88, 91, 95, 96, 103, 104, 106, 107, 108, 110, 111, 112, 113], "correctli": [2, 5, 39, 108, 111], "mention": [2, 19, 59, 64, 83, 108, 109, 112, 113], "ad": [2, 20, 23, 26, 68, 69, 85, 109], "liuxiang88": 2, "467": [2, 37, 93, 98], "ucrt": [2, 111], "mark": [2, 5, 8, 9, 12, 27, 30, 32, 34, 35, 36, 38, 40, 41, 43, 44, 62, 73, 81, 89, 99, 108, 109, 111, 112, 113], "latin1": [2, 5, 37, 38, 44, 111], "public": [2, 9, 114], "_static": [2, 110, 111], "vignett": [2, 110, 111], "pdf": [2, 114], "draft": [2, 99], "websit": [2, 111], "comprehens": [2, 9, 109, 113], "tutori": [2, 12, 106, 107, 108, 109, 110, 111, 112, 113], "aforement": [2, 106, 109], "site": 2, "move": [2, 64, 108], "457": [2, 37, 93, 98], "autoconf": 2, "macro": 2, "ac_lang_cplusplu": 2, "ac_try_compil": 2, "were": [2, 5, 62, 97, 106, 108, 109, 111, 113], "obsolet": 2, "458": [2, 37, 93, 98], "altrep": 2, "yield": [2, 23, 46, 59, 67, 108, 109, 113], "embed": [2, 44], "nul": [2, 44, 62], "449": [2, 37, 93, 98], "segfault": 2, "stri_sprintf": [2, 3, 16, 50, 53, 62, 68, 103, 112], "No": [2, 9, 69, 95], "defin": [2, 9, 10, 12, 32, 39, 49, 64, 82, 84, 86, 89, 90, 93, 99, 101, 106, 107, 108, 110, 111, 112], "use_rintern": 2, "r_no_remap": 2, "previou": [2, 12, 57, 94, 109], "patch": 2, "caus": [2, 9, 43, 64, 108], "failur": [2, 12, 30, 31], "target": [2, 44], "workaround": [2, 107, 113], "tool": [2, 12, 113], "checkff": 2, "na_character_": [2, 32, 54, 60, 85, 93, 106, 109], "stri": [2, 14, 15, 16, 28], "sprintf": [2, 85, 112], "stri_sub": [2, 3, 13, 58, 59, 90, 106, 107, 109], "stri_sub_al": [2, 3, 58, 59, 89, 107, 109], "provid": [2, 5, 6, 9, 10, 11, 12, 13, 16, 17, 31, 33, 47, 49, 51, 55, 60, 64, 89, 92, 93, 96, 97, 104, 106, 108, 109, 111, 113], "result": [2, 4, 5, 6, 9, 11, 12, 13, 14, 15, 17, 18, 19, 23, 26, 27, 28, 29, 35, 36, 37, 41, 43, 46, 47, 49, 51, 52, 54, 55, 58, 60, 64, 65, 69, 70, 71, 72, 76, 79, 80, 81, 82, 83, 84, 85, 86, 89, 90, 91, 95, 101, 106, 107, 108, 109, 113], "correspond": [2, 4, 9, 15, 17, 27, 32, 34, 36, 42, 51, 53, 60, 72, 76, 84, 85, 89, 90, 93, 96, 106, 107, 108, 109, 111, 113], "being": [2, 5, 12, 23, 55, 64, 89, 104, 107, 108, 109], "alter": [2, 12, 89, 90, 113], "na": [2, 3, 5, 12, 18, 21, 23, 27, 28, 29, 30, 31, 32, 43, 46, 47, 48, 51, 52, 53, 54, 58, 60, 64, 67, 72, 75, 76, 77, 80, 82, 83, 84, 85, 86, 89, 90, 91, 93, 101, 106, 107, 108, 109], "ignore_negative_length": [2, 89, 90], "stri_subset": [2, 3, 7, 27, 107], "replac": [2, 3, 7, 13, 20, 23, 24, 40, 43, 44, 71, 72, 82, 85, 91, 96, 100, 104, 109, 110, 112], "valu": [2, 3, 5, 6, 9, 12, 106, 107, 108, 112, 113], "cannot": [2, 8, 44, 73, 91, 101, 112], "str": [2, 11, 18, 19, 23, 27, 28, 29, 30, 31, 34, 35, 36, 38, 40, 41, 42, 43, 44, 45, 46, 47, 48, 50, 53, 58, 59, 60, 62, 67, 68, 70, 72, 76, 77, 79, 80, 81, 82, 83, 84, 86, 87, 88, 89, 90, 91, 95, 96, 97, 99, 100, 101, 102, 103, 104, 105, 110, 112], "recycl": [2, 4, 15, 18, 27, 46, 58, 60, 71, 76, 82, 86, 90, 91, 106, 107], "matrix": [2, 3, 46, 47, 58, 59, 60, 82, 83, 89, 90, 106, 107, 109, 110, 113], "cbind": [2, 89, 90, 106], "unnam": [2, 89, 90], "column": [2, 22, 54, 58, 60, 67, 89, 90, 103, 106, 107, 108, 109, 110, 113], "name": [2, 4, 5, 9, 12, 17, 18, 19, 20, 21, 22, 23, 26, 27, 29, 30, 31, 33, 37, 39, 44, 46, 47, 55, 57, 58, 59, 60, 63, 64, 65, 66, 67, 72, 73, 74, 76, 80, 81, 82, 83, 86, 87, 88, 89, 90, 91, 92, 93, 95, 97, 98, 102, 105, 106, 107, 108, 110, 111, 113], "interpret": [2, 5, 23, 40, 43, 110, 111, 113], "use_matrix": [2, 89, 90], "special": [2, 5, 9, 24, 45, 63, 66, 113], "treatment": [2, 67, 80], "matric": [2, 58, 59, 60, 89, 90, 107, 109], "clarifi": 2, "syntax": [2, 9, 12, 16, 23, 63, 113], "_charclass": [2, 7, 9, 86], "stri_trim": [2, 3, 7, 13, 76, 112], "differ": [2, 5, 6, 8, 9, 12, 17, 18, 19, 30, 46, 48, 51, 58, 60, 66, 76, 95, 96, 97, 99, 100, 106, 107, 108, 109, 111, 112, 113], "slightli": [2, 12, 86, 88, 107], "class": [2, 7, 8, 13, 20, 21, 22, 23, 25, 26, 64, 69, 71, 93, 94, 100, 112], "420": [2, 37, 93, 98], "alia": [2, 17, 29, 44, 54, 64, 66, 69, 73, 74, 75, 76, 89, 90, 104, 105, 106], "stri_string_format": [2, 85], "awar": [2, 6, 11, 12, 13, 27, 64, 81, 85, 108, 112], "enhanc": [2, 81, 85, 109], "add": [2, 20, 44, 68, 109, 112], "customis": [2, 108], "demand": 2, "comput": [2, 5, 6, 22, 62, 81, 109, 110, 114], "size": [2, 33, 44, 66, 73, 106, 109, 113], "width": [2, 3, 9, 13, 16, 23, 26, 53, 68, 85, 104, 110, 112], "given": [2, 3, 4, 5, 7, 12, 17, 18, 23, 24, 27, 32, 33, 35, 36, 37, 38, 39, 46, 47, 49, 52, 53, 54, 60, 66, 67, 68, 69, 76, 77, 82, 83, 84, 86, 89, 93, 96, 97, 101, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113], "both": [2, 5, 17, 19, 20, 35, 43, 68, 75, 89, 100, 104, 106, 107, 109, 112], "stri_printf": [2, 85], "displai": [2, 5, 8, 9, 23, 69, 106, 108, 111], "153": [2, 37, 93, 98, 109], "stri_match_": [2, 60], "_regex": [2, 7, 12, 58, 60, 76, 113], "captur": [2, 3, 12, 46, 58, 76, 107], "group": [2, 3, 5, 6, 12, 30, 46, 58, 76, 106, 107, 112], "stri_locate_": [2, 7, 58, 59, 106], "have": [2, 5, 6, 8, 9, 12, 29, 31, 33, 39, 44, 54, 63, 68, 85, 103, 104, 106, 107, 108, 109, 110, 111, 112, 113], "capture_group": [2, 58, 113], "posit": [2, 5, 8, 9, 12, 35, 36, 58, 63, 64, 82, 83, 86, 89, 104, 106, 107, 108, 111, 113], "match": [2, 3, 6, 7, 8, 9, 10, 11, 12, 13, 27, 30, 31, 38, 39, 46, 47, 58, 59, 65, 66, 76, 84, 100, 106, 108, 109, 111, 112, 114], "parenthesis": [2, 113], "subexpress": [2, 58], "get_length": [2, 58, 59, 107, 113], "whose": [2, 51, 106, 108, 109, 111, 112, 113], "mai": [2, 4, 5, 6, 7, 8, 9, 11, 12, 17, 19, 20, 21, 22, 23, 24, 26, 30, 33, 35, 38, 39, 40, 42, 43, 44, 53, 54, 55, 56, 57, 58, 62, 63, 66, 68, 70, 71, 76, 77, 79, 82, 83, 85, 86, 87, 88, 89, 95, 98, 99, 100, 104, 106, 107, 108, 109, 110, 111, 112, 113], "ones": [2, 33, 58, 59, 64, 106, 108, 109, 111, 112, 113], "438": [2, 37, 93, 98], "stri_trans_gener": [2, 3, 13, 95, 96, 98, 99, 110, 112], "rule": [2, 4, 19, 47, 59, 63, 64, 84, 90, 93, 97, 99, 106, 107, 108, 109, 112], "revers": [2, 3, 13, 33, 68, 70, 97, 106], "direct": [2, 97], "434": [2, 37, 93, 98], "stri_datetime_format": [2, 3, 13, 20, 21, 22, 24, 25, 26, 92, 93, 94, 112], "vectoris": [2, 106, 107, 110], "respect": [2, 4, 9, 12, 18, 23, 27, 46, 47, 58, 59, 72, 76, 82, 83, 86, 89, 90, 91, 96, 106, 107, 108, 109, 111, 112, 113], "stri_datetime_fstr": [2, 3, 20, 21, 22, 23, 25, 26, 92, 93, 94, 112], "ignore_speci": [2, 24], "stri_datetime_add": [2, 3, 21, 22, 23, 24, 25, 26, 92, 93, 94, 112], "stri_datetime_field": [2, 3, 20, 21, 23, 24, 25, 26, 92, 93, 94], "posixct": [2, 20, 21, 22, 23, 25, 112], "eagerli": [2, 108], "negat": [2, 9, 12, 27, 86, 91, 100, 107, 108, 113], "stri_replace_rstr": [2, 3, 7, 76, 100], "convert": [2, 3, 4, 5, 9, 23, 24, 31, 37, 45, 97, 99, 106, 109, 110, 112], "gsub": [2, 3], "style": [2, 3, 9, 23, 30, 85, 109], "stri_replac": [2, 3, 7, 78, 100, 113], "stri_prepare_arg": 2, "refactor": 2, "overrun": 2, "except": [2, 9, 12, 23, 104, 109, 111, 113], "subsystem": 2, "avoid": [2, 6, 9, 99, 107, 109], "stri_length": [2, 3, 13, 16, 19, 50, 62, 68, 85, 96, 103, 106], "stri_enc_toutf32": [2, 3, 5, 32, 40, 41, 43, 44, 111], "throw": 2, "invalid": [2, 43], "utf": [2, 3, 13, 17, 30, 31, 33, 37, 38, 39, 40, 41, 44, 49, 51, 53, 57, 62, 73, 91, 99, 101, 105, 109, 111], "byte": [2, 3, 5, 7, 12, 13, 16, 30, 31, 32, 33, 34, 35, 36, 38, 40, 41, 42, 43, 44, 53, 66, 81, 89, 101, 111, 113], "sequenc": [2, 3, 5, 11, 12, 23, 30, 32, 34, 36, 40, 42, 43, 44, 45, 53, 58, 66, 84, 97, 99, 104, 106, 107, 108, 111, 112, 113], "mere": [2, 46, 60, 107, 109, 113], "honour": [2, 113], "y": [2, 23, 24, 46, 48, 51, 80, 83, 85, 106, 109, 111, 112, 114], "d": [2, 9, 12, 16, 23, 24, 26, 46, 48, 51, 54, 69, 76, 79, 80, 82, 83, 84, 85, 93, 104, 107, 108, 110, 111, 112, 113, 114], "complet": [2, 108, 109, 113], "rewritten": [2, 109], "stri_wrap": [2, 3, 6, 7, 8, 10, 13, 15, 17, 19, 29, 31, 47, 59, 63, 64, 67, 68, 69, 72, 80, 81, 83, 84, 95, 102, 112], "recognis": [2, 113], "certain": [2, 23, 45, 111, 113], "simplifi": [2, 30, 37, 46, 47, 69, 82, 83, 98, 104, 106, 107, 108, 109], "425": [2, 37, 93, 98], "stri_locale_list": [2, 3, 6, 55, 57, 108], "stri_timezone_list": [2, 3, 20, 21, 22, 23, 24, 25, 26, 92, 94], "stri_trans_list": [2, 3, 95, 96, 97, 99, 112], "428": [2, 37, 93, 98], "stri_flatten": [2, 3, 13, 14, 28, 30, 51, 52, 69, 106], "na_empti": [2, 48, 75], "omit": [2, 48, 63, 84], "431": [2, 37, 56, 93, 98], "9": [2, 9, 12, 19, 26, 27, 30, 37, 46, 51, 58, 59, 68, 70, 71, 76, 81, 83, 85, 89, 90, 91, 93, 98, 104, 107, 108, 109, 110, 111, 112, 113, 114], "gcc": 2, "max_align_t": 2, "std": [2, 85], "possibl": [2, 4, 5, 12, 31, 35, 36, 38, 65, 82, 83, 86, 99, 104, 106, 107, 108, 109, 111, 113], "429": [2, 37, 93, 98], "stri_width": [2, 3, 13, 16, 50, 53, 62, 68, 85, 104, 106, 112], "misclassifi": 2, "grave": 2, "accent": [2, 9, 10, 11, 97, 98, 108], "eszett": [2, 95], "categori": [2, 5, 7, 12, 18, 38, 39, 63, 100, 103, 111, 113], "sk": [2, 9, 56, 98], "symbol": [2, 9, 23, 103, 108, 113], "modifi": [2, 6, 9, 20, 23, 57, 85, 88, 90, 91, 106, 107], "uchar_east_asian_width": [2, 103], "u_ea_ambigu": 2, "354": [2, 37, 93, 98], "charsxp": 2, "copi": [2, 4, 89, 90, 91, 102], "thu": [2, 5, 23, 26, 82, 99, 105, 109], "could": [2, 6, 30], "garbag": 2, "collect": [2, 106, 109], "so": [2, 5, 8, 9, 12, 13, 17, 18, 27, 38, 42, 46, 56, 58, 59, 60, 66, 68, 76, 82, 83, 86, 89, 91, 103, 104, 106, 107, 108, 109, 110, 111, 112, 113], "meanwhil": 2, "jimhest": 2, "401": [2, 37, 56, 93, 98], "icu4c": [2, 9, 13, 26, 57, 63, 64, 66, 93, 94], "69": [2, 37, 46, 93, 98, 110, 111], "upgrad": 2, "o": [2, 5, 11, 12, 18, 23, 26, 48, 51, 56, 76, 80, 83, 94, 96, 105, 107, 113, 114], "x": [2, 4, 5, 12, 16, 20, 23, 24, 37, 48, 51, 52, 54, 58, 61, 66, 72, 75, 77, 78, 80, 85, 89, 90, 91, 97, 101, 106, 107, 108, 109, 110, 111, 112, 113], "nix": 2, "equip": [2, 58, 113], "battl": 2, "test": [2, 6, 9, 15, 17, 19, 27, 29, 30, 39, 59, 77, 83, 86, 102, 111, 113], "55": [2, 12, 26, 37, 46, 76, 85, 93, 98], "bring": 2, "39": [2, 37, 46, 83, 93, 98, 103, 109, 110], "cxx_std": 2, "cxx11": 2, "cxx1x": 2, "408": [2, 37, 93, 98], "stri_trans_casefold": [2, 95], "perform": [2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 15, 17, 19, 29, 47, 56, 57, 59, 62, 63, 64, 66, 67, 74, 80, 83, 85, 95, 97, 106, 107, 108, 109, 110, 111], "two": [2, 3, 5, 6, 9, 12, 15, 17, 23, 53, 58, 72, 84, 85, 89, 90, 93, 95, 96, 99, 106, 107, 108, 109, 111, 112, 113], "piec": [2, 9, 10, 19, 82, 83, 95, 112], "onli": [2, 4, 5, 9, 12, 23, 30, 31, 33, 38, 39, 46, 48, 51, 52, 58, 59, 60, 63, 66, 68, 76, 81, 82, 83, 84, 85, 89, 90, 91, 93, 95, 100, 104, 106, 107, 108, 109, 111, 113], "ident": [2, 93, 95, 106, 107, 108, 111], "handi": [2, 95, 106], "compar": [2, 3, 5, 6, 12, 13, 29, 60, 62, 76, 85, 95, 108, 109, 111, 112, 113, 114], "421": [2, 37, 56, 93, 98], "stri_rank": [2, 3, 6, 8, 10, 13, 15, 17, 19, 29, 31, 47, 59, 64, 67, 80, 81, 83, 95, 102, 104, 108], "vector": [2, 3, 5, 7, 13, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 27, 28, 29, 30, 31, 32, 34, 35, 36, 37, 38, 40, 41, 42, 43, 44, 45, 46, 47, 48, 50, 52, 53, 54, 56, 58, 59, 60, 61, 62, 67, 68, 69, 70, 71, 72, 73, 74, 76, 78, 79, 80, 81, 82, 83, 84, 85, 86, 90, 91, 93, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 107, 108, 109, 110, 111, 112], "order": [2, 3, 5, 6, 9, 12, 13, 17, 27, 30, 31, 43, 44, 64, 70, 72, 73, 79, 80, 81, 89, 99, 106, 107, 109, 110, 111, 113], "frame": [2, 22, 30, 31, 67, 72, 93, 108, 110], "regard": [2, 29, 67, 108, 109, 113], "criteria": [2, 67, 72, 106, 108], "219": [2, 37, 93, 98], "266": [2, 37, 56, 93, 98], "stri_sort_kei": [2, 3, 6, 8, 10, 15, 17, 19, 29, 31, 47, 59, 64, 67, 72, 80, 83, 95, 102, 104], "415": [2, 37, 93, 98], "equival": [2, 5, 9, 10, 12, 15, 16, 17, 19, 29, 38, 42, 48, 51, 59, 64, 65, 66, 76, 77, 81, 84, 91, 99, 102, 103, 107, 109, 110, 111, 112, 113], "414": [2, 37, 93, 98], "level": [2, 64, 106, 108], "sxpinfo": 2, "gp": 2, "directli": [2, 58, 81, 86, 113], "lukaszdaniel": 2, "home": [2, 13], "page": [2, 4, 5, 7, 13, 24, 45, 110, 111], "refer": [2, 18, 24, 27, 46, 58, 60, 76, 82, 86, 91, 107, 108, 109, 111], "400": [2, 37, 93, 98], "399": [2, 37, 93, 98], "purpos": [2, 5, 8, 84, 95, 107, 108, 112, 113], "355": [2, 37, 93, 98], "time_limit": [2, 66, 113], "stack_limit": [2, 66, 113], "prevent": [2, 63], "malform": [2, 9, 55], "malici": 2, "too": [2, 4, 58, 85, 108, 113], "345": [2, 37, 93, 98, 109], "stri_startswith": [2, 7, 27, 86, 107], "stri_endswith": [2, 27, 86, 107], "382": [2, 37, 93, 98], "incorrect": [2, 43, 44, 53, 67, 72, 80], "eas": 2, "debug": 2, "347": [2, 37, 93, 98], "futur": [2, 23, 85, 87, 88, 109, 111], "stri_dupl": [2, 3, 6, 8, 10, 13, 15, 17, 19, 31, 47, 59, 64, 67, 72, 80, 81, 83, 95, 102, 104, 108], "fromlast": [2, 29], "renam": 2, "from_last": [2, 29, 108], "its": [2, 4, 5, 6, 9, 12, 13, 15, 17, 29, 37, 85, 89, 90, 102, 106, 108, 109, 110, 112, 113], "schedul": 2, "stri_enc_detect2": [2, 3, 5, 6, 8, 10, 15, 17, 19, 29, 30, 34, 35, 36, 47, 59, 64, 67, 72, 80, 81, 83, 95, 102, 104], "stri_enc_detect": [2, 3, 5, 31, 34, 35, 36, 74, 111], "stri_enc_isutf8": [2, 3, 5, 30, 31, 34, 35, 111], "stri_enc_isascii": [2, 3, 5, 30, 31, 35, 36, 111], "stri_write_lin": [2, 3, 13, 73, 74, 111, 112], "stri_read_raw": [2, 3, 13, 73, 105, 111], "con": [2, 73, 74, 105, 106], "fname": [2, 73, 74, 105], "auto": 2, "anymor": 2, "nparagraph": [2, 69], "stri_rand_lipsum": [2, 3, 13, 70, 71, 112], "n_paragraph": [2, 69], "398": [2, 37, 93, 98], "altern": [2, 4, 9, 12, 58, 81, 85, 89, 90, 110, 111], "british": [2, 92, 93], "spell": [2, 108], "introduc": [2, 99, 108, 109, 113], "normal": [2, 3, 5, 9, 13, 17, 37, 53, 62, 64, 69, 70, 71, 79, 85, 89, 97, 100, 102, 103, 104], "393": [2, 37, 93, 98], "stri_read_bin": 2, "187": [2, 26, 37, 93, 98], "connect": [2, 9, 54, 73, 74, 85, 105, 111, 112], "386": [2, 37, 56, 93, 98], "kei": [2, 3, 5, 64, 108, 113], "origin": [2, 81, 88], "davisvaughan": 2, "138": [2, 37, 93, 98, 109], "stri_encod": [2, 3, 5, 30, 32, 40, 41, 42, 43, 73, 74, 111], "stri_rand_str": [2, 3, 9, 13, 69, 70, 109, 112], "much": [2, 10, 17, 29, 73, 97, 102, 109, 111, 113], "larger": [2, 5, 107], "indent": [2, 104, 112], "use_width": 2, "369": [2, 37, 93, 98], "stri_c": [2, 51, 106], "empti": [2, 3, 4, 6, 9, 12, 16, 18, 27, 31, 46, 47, 48, 50, 51, 82, 83, 84, 86, 89, 91, 106, 109], "collaps": [2, 4, 30, 48, 51, 52, 69, 70, 106, 109], "370": [2, 37, 93, 98], "stri_prepare_arg_posixct": 2, "372": [2, 37, 93, 98], "usag": [2, 9], "366": [2, 37, 56, 93, 98], "363": [2, 37, 93, 98], "348": [2, 37, 93, 98], "nil": 2, "362": [2, 37, 93, 98], "cxxcpp": 2, "318": [2, 37, 93, 98], "protect": 2, "gcing": 2, "344": [2, 37, 93, 98], "364": [2, 37, 93, 98], "icu61": 2, "common": [2, 40, 92, 109], "cstring": 2, "h": [2, 12, 17, 22, 23, 24, 48, 51, 63, 80, 82, 83, 107, 108, 109, 112, 113, 114], "statu": [2, 19, 47, 59], "regexmatch": 2, "after": [2, 12, 30, 64, 108, 111, 113], "friendli": [2, 5, 33, 39, 89, 90, 107, 109], "stri_sub_replace_al": [2, 90, 106], "stri_sub_replac": [2, 89, 106], "stri_remove_empti": [2, 3, 54, 61, 77], "stri_omit_empty_na": [2, 75], "stri_remove_empty_na": [2, 75], "stri_omit_empti": [2, 75], "stri_remove_na": [2, 75], "stri_omit_na": [2, 75, 106, 109], "343": [2, 37, 93, 98, 109], "stri_trans_char": [2, 3, 13, 95, 97, 98, 99, 112], "warnfix": 2, "205": [2, 26, 37, 93, 98], "ac": [2, 69, 103], "335": [2, 37, 93, 98], "314": [2, 37, 93, 98], "design": [2, 5, 23, 97, 111], "had": [2, 5, 108, 113], "u_charset_is_utf8": [2, 39, 49], "stri_enc_set": [2, 3, 5, 33, 37, 38], "state": [2, 9, 20, 68, 92, 104, 106, 108, 109, 113], "232": [2, 26, 37, 93, 98], "stri_detect_": [2, 7], "max_count": [2, 27, 107, 110], "stop": [2, 27, 66, 107, 113], "occurr": [2, 3, 7, 31, 44, 108, 109, 113], "338": [2, 37, 93, 98], "easili": [2, 42, 105, 110, 112], "pipabl": 2, "yutannihil": 2, "bastienfr": 2, "334": [2, 37, 93, 98], "icudt61b": 2, "dat": 2, "big": [2, 71], "dimitri": 2, "john": [2, 106, 109], "ledkov": 2, "xnox": 2, "296": [2, 37, 56, 93, 98, 109], "box": [2, 111], "stage": 2, "341": [2, 37, 56, 93, 98], "strncpy": 2, "within": [2, 4, 6, 8, 12, 18, 23, 27, 30, 46, 58, 60, 66, 89, 90, 91, 104, 108, 112, 113], "325": [2, 37, 93, 98], "made": 2, "work": [2, 5, 30, 31, 41, 57, 65, 85, 89, 99, 107, 111, 112], "dash": [2, 9], "319": [2, 37, 93, 98], "stri_rand_shuffl": [2, 3, 13, 69, 71, 79, 106], "337": [2, 37, 93, 98], "stri_split_regex": [2, 82], "rais": [2, 33], "317": [2, 37, 93, 98], "icudt61l": 2, "solv": 2, "frequent": [2, 30, 108], "icudt": [2, 108], "releas": [2, 87, 88, 109, 111], "oldrel": 2, "revert": 2, "winbuild": 2, "chain": [2, 69, 97, 109, 112], "behaviour": [2, 107, 108, 109, 113], "broken": 2, "mirror": 2, "193": [2, 26, 37, 93, 98], "288": [2, 37, 93, 98], "stri_match": [2, 3, 7, 12, 46], "188": [2, 37, 93, 98], "289": [2, 37, 93, 98], "how": [2, 4, 5, 6, 7, 9, 10, 13, 17, 55, 67, 72, 80, 81, 93, 106, 108, 109, 111, 112, 113], "omit_empti": [2, 48, 82, 84, 107], "stri_na2empti": [2, 3, 54, 75, 77], "285": [2, 37, 93, 98], "coercion": [2, 85], "trivial": [2, 109], "atom": [2, 4, 12, 16, 51, 54, 109, 110, 113], "wparenthes": 2, "38": [2, 37, 88, 93, 98, 110, 114], "63": [2, 37, 46, 93, 98], "i18n": [2, 13, 31], "windtfmt": 2, "cpp": [2, 31], "signific": [2, 6, 23, 108, 110], "winnmfmt": 2, "suppress": 2, "import": [2, 4, 109], "diagnost": 2, "src": [2, 103], "decnumb": 2, "specif": [2, 6, 8, 9, 10, 11, 13, 17, 20, 23, 31, 56, 86, 93, 99, 106, 113], "270": [2, 37, 93, 98], "1252": [2, 5, 30, 37], "codec": 2, "euro": [2, 6, 37], "sign": [2, 5, 9, 20, 25, 85, 110, 113], "263": [2, 37, 93, 98, 109], "267": [2, 37, 93, 98], "omit_na": [2, 89, 90, 91, 107], "ignor": [2, 5, 6, 9, 10, 11, 12, 17, 19, 23, 25, 30, 44, 47, 51, 52, 59, 64, 71, 82, 89, 90, 91, 93, 96, 99, 113], "unprotect": 2, "stack": [2, 66, 113], "imbal": 2, "52": [2, 23, 26, 37, 93, 98, 109, 110], "clang": 2, "ubsan": 2, "stri_brkit": 2, "238": [2, 37, 93, 98], "220": [2, 26, 37, 93, 98], "try": [2, 31, 113], "258": [2, 37, 93, 98, 109], "254": [2, 37, 93, 98], "dir": 2, "stri_install_check": 2, "stri_install_icudt": 2, "export": 2, "227": [2, 37, 93, 98], "231": [2, 37, 56, 93, 98], "linux": [2, 5, 108, 109, 111], "unix": [2, 5, 9, 66, 85, 108, 113], "read": [2, 3, 5, 13, 38, 41, 109, 112], "stringi_cflag": 2, "stringi_disable_cxx11": 2, "253": [2, 37, 93, 98], "r_usedynamicsymbol": 2, "230": [2, 37, 93, 98], "242": [2, 37, 93, 98], "_count": 2, "_limit": 2, "enum": [2, 66], "constant": [2, 12, 66], "58": [2, 23, 26, 37, 83, 93, 98], "accordingli": [2, 60], "round": [2, 60, 76, 113], "snprintf": [2, 85], "98": [2, 37, 93, 98, 109], "214": [2, 26, 37, 93, 98], "210": [2, 37, 93, 98], "stri_replace_all_fix": [2, 76, 107, 110], "199": [2, 26, 37, 93, 98], "locat": [2, 3, 7, 8, 10, 11, 19, 23, 44, 47, 83, 108, 110, 112], "207": [2, 37, 93, 98], "insert": [2, 106], "via": [2, 11, 12, 30, 38, 51, 65, 85, 106, 107, 108, 111, 113], "124": [2, 26, 37, 93, 98], "216": [2, 37, 56, 93, 98], "stri_detect": [2, 3, 7, 86, 91, 107, 109], "175": [2, 26, 37, 93, 98], "stri_join_list": [2, 3, 14, 28, 48, 51, 106], "conjunct": [2, 107], "stri_extract_all_regex": [2, 46, 52, 60, 109, 113], "stri_extract_all_word": [2, 8, 12, 19, 47, 52, 59, 112], "88": [2, 26, 37, 85, 93, 98, 109], "rcpp": 2, "examplercppstringi": 2, "exampl": [2, 5, 6, 8, 9, 11, 12, 106, 107, 108, 109, 111, 112, 113], "183": [2, 37, 93, 98, 109], "float": [2, 85], "180": [2, 37, 93, 98], "incorrectli": 2, "element": [2, 3, 4, 6, 13, 15, 17, 18, 27, 30, 31, 34, 36, 37, 42, 46, 47, 48, 50, 51, 53, 54, 58, 60, 67, 71, 76, 80, 82, 84, 86, 87, 88, 90, 105, 106, 107, 108, 109, 110], "suppos": 2, "176": [2, 37, 56, 93, 98, 109], "sy": [2, 5, 38, 39, 85, 109, 111], "feature_test": 2, "copyright": [2, 13], "sun": [2, 26], "microsystem": 2, "applic": [2, 5, 89, 90, 109, 111], "2001": [2, 37], "posix": [2, 65, 85, 109], "forc": [2, 64, 85, 108], "condition": 2, "_xpg6": 2, "conform": [2, 12, 73, 108, 113], "174": [2, 37, 93, 98], "violat": [2, 4], "sep": [2, 14, 16, 23, 48, 51, 52, 68, 69, 77, 85, 104, 105, 106, 109, 110, 112], "170": [2, 37, 93, 98], "setdatadirectori": 2, "169": [2, 26, 37, 93, 98], "tri": [2, 5, 8, 12, 31, 37, 39, 113], "switch": [2, 5, 107], "win": 2, "biarch": 2, "mimic": 2, "ac_subst": 2, "ac_config_fil": 2, "process": [2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 107, 108, 109, 110, 111, 113, 114], "similar": [2, 5, 6, 9, 12, 16, 43, 54, 55, 93, 108, 110, 111, 112, 113], "stri_info": [2, 3, 39], "give": [2, 5, 11, 12, 13, 23, 29, 37, 38, 49, 57, 58, 59, 60, 67, 68, 70, 71, 77, 79, 81, 82, 83, 86, 87, 88, 89, 90, 96, 104, 106, 107, 110, 111, 112, 113], "second": [2, 17, 20, 21, 22, 23, 25, 58, 60, 89, 90, 93, 106, 107, 108, 110, 113], "stri_pad_": [2, 68], "stri_extract_": [2, 7, 46, 47], "_boundari": [2, 7, 59], "between": [2, 3, 5, 9, 10, 12, 17, 24, 48, 64, 82, 100, 104, 106, 108, 113], "boundari": [2, 3, 7, 8, 12, 13, 63, 66, 82, 95, 104], "46": [2, 22, 23, 26, 37, 56, 93, 98, 110], "flavour": [2, 108, 112, 113], "chartr": 2, "approxim": [2, 13, 103, 106], "ish": [2, 107, 112], "fashion": [2, 17], "nchar": [2, 103, 110], "149": [2, 37, 93, 98, 109], "stri_pad": [2, 3, 13, 104, 112], "get": [2, 3, 4, 5, 6, 33, 45, 51, 52, 53, 55, 64, 75, 87, 94, 97, 100, 104, 107, 109], "rid": [2, 75], "133": [2, 26, 37, 93, 98], "silent": [2, 4, 5, 17, 43, 51, 52, 89, 111], "strwrap": [2, 104, 112], "139": [2, 26, 37, 93, 98], "gain": [2, 109], "whitespace_onli": [2, 104], "137": [2, 37, 93, 98], "known": [2, 3, 5, 31, 45, 56, 66, 101, 111, 113], "zone": [2, 3, 13, 20, 21, 22, 23, 94], "stri_timezone_set": [2, 3], "stri_timezone_get": [2, 20, 21, 22, 23, 24, 25, 26, 92, 93, 94], "current": [2, 3, 6, 9, 12, 21, 22, 23, 39, 41, 44, 49, 57, 62, 69, 73, 85, 92, 94, 97, 105, 108, 109, 111, 112, 113], "stri_timezone_info": [2, 3, 20, 21, 22, 23, 24, 25, 26, 93, 94], "basic": [2, 5, 8, 23, 33, 54, 55, 92], "stri_datetime_symbol": [2, 3, 20, 21, 22, 23, 24, 25, 92, 93, 94], "localiz": [2, 3], "strptime": [2, 23, 24, 112], "construct": [2, 21, 106, 113], "represent": [2, 5, 21, 33, 81, 92, 94, 108, 111, 114], "stri_datetime_now": [2, 3, 20, 21, 22, 23, 24, 26, 92, 93, 94, 112], "unit": [2, 5, 8, 9, 20, 92, 95, 108, 109, 110, 112], "144": [2, 37, 93, 98], "improv": 2, "affect": [2, 82, 83, 97], "stri_loc": [2, 3, 7, 59, 107], "index": [2, 29, 58, 59, 86, 89, 90, 107, 108, 110], "143": [2, 37, 93, 98], "stri_": [2, 4, 7, 9, 10, 12, 65, 86, 109], "_fix": [2, 7, 65, 86, 108, 113], "libc": [2, 81], "implement": [2, 6, 10, 11, 12, 44, 69, 73, 86, 88, 95, 107, 108, 109, 113], "strchr": 2, "strstr": 2, "fast": [2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 107, 108, 112, 114], "glibc": [2, 85], "sse2": 2, "instruct": 2, "141": [2, 37, 56, 93, 98], "165": [2, 37, 93, 98], "specifi": [2, 5, 6, 9, 12, 20, 21, 22, 23, 24, 37, 44, 63, 71, 76, 85, 97, 99, 100, 104, 109, 111, 112, 114], "intellig": 2, "gregorian": [2, 20, 21, 22, 23, 26, 92], "expand": [2, 109], "default_local": 2, "134": [2, 37, 93, 98], "132": [2, 37, 93, 98], "stri_locate_regex": 2, "73": [2, 26, 37, 46, 93, 98], "strsxp": 2, "fals": [2, 5, 15, 17, 21, 23, 24, 27, 29, 30, 34, 35, 36, 37, 43, 44, 46, 47, 48, 49, 50, 51, 54, 58, 59, 60, 63, 64, 65, 66, 67, 68, 69, 75, 76, 79, 80, 82, 83, 84, 85, 86, 89, 90, 91, 93, 95, 97, 100, 104, 107, 108, 109, 110, 111, 113], "164": [2, 37, 93, 98], "shall": [2, 106, 107], "168": [2, 37, 93, 98], "135": [2, 37, 93, 98, 113], "becaus": [2, 6, 11, 14, 30, 31, 36, 44, 65, 73, 99, 107, 108, 109, 113], "part": [2, 9, 38, 39, 76, 89, 90, 107, 113], "154": [2, 26, 37, 93, 98], "attribut": [2, 37, 58, 64, 102, 106, 109, 113], "coerc": [2, 37, 48, 54, 67, 80, 106], "u_init": 2, "dynlib": 2, "load": [2, 5, 30, 87, 88, 110], "157": [2, 26, 37, 93, 98, 109], "overful": 2, "hbox": 2, "n_max": 2, "stri_split_": [2, 7], "n": [2, 9, 11, 12, 16, 18, 23, 26, 30, 45, 48, 51, 67, 68, 69, 71, 76, 80, 81, 82, 83, 85, 87, 93, 97, 100, 101, 104, 105, 106, 107, 110, 111, 112, 113], "stri_extract_all_": [2, 46, 47], "stri_list2matrix": [2, 3, 46, 47, 61, 75, 77, 82, 83, 106], "fill": [2, 46, 47, 54, 82, 83, 106, 110], "120": [2, 37, 93, 98], "stri_extract_word": 2, "stri_locate_boundari": [2, 3], "stri_locate_all_boundari": [2, 6, 7, 8, 10, 15, 17, 19, 29, 31, 47, 58, 59, 63, 64, 67, 72, 80, 81, 83, 84, 89, 90, 95, 102, 104], "stri_locate_word": 2, "stri_locate_all_word": [2, 19, 59], "stri_locate_first_boundari": [2, 59], "stri_locate_last_boundari": [2, 59], "stri_locate_first_word": [2, 59], "stri_locate_last_word": [2, 59], "stri_extract_first_word": [2, 47], "stri_extract_last_word": [2, 47], "111": [2, 37, 56, 93, 98, 111], "opts_regex": [2, 18, 27, 46, 58, 60, 66, 76, 82, 91], "opts_col": [2, 17, 18, 27, 29, 46, 58, 64, 67, 72, 76, 80, 81, 82, 86, 91, 102], "opts_fix": [2, 18, 27, 46, 58, 65, 76, 82, 86, 91], "opts_brkit": [2, 19, 47, 59, 83, 95], "suppli": [2, 12, 30, 31, 76, 109], "individu": [2, 6, 13, 42, 46, 82, 109, 111, 112], "simpli": [2, 106], "stri_detect_regex": [2, 27, 66, 86, 113], "case_insensit": [2, 27, 46, 58, 65, 66, 76, 107, 110, 113], "110": [2, 37, 93, 98], "engin": [2, 3, 7, 9, 11, 12, 13, 18, 27, 30, 46, 58, 76, 82, 86, 91, 113], "suitabl": [2, 104, 107, 108, 109], "yet": [2, 99, 108, 111, 113], "again": [2, 9, 106, 107, 109], "stri_extract_all_fix": [2, 46, 65, 107], "stri_count": [2, 3, 7, 19, 107], "stri_locate_all_fix": [2, 58, 65, 107, 109], "look": [2, 12, 14, 15, 17, 30, 58, 82, 86, 109], "129": [2, 37, 93, 98], "cg_miss": [2, 60], "117": [2, 37, 93, 98, 109], "stri_locate_all_": [2, 58, 59], "stri_match_all_": [2, 60], "omit_no_match": [2, 46, 47, 52, 58, 59, 60, 90, 107, 109], "118": [2, 26, 37, 93, 98], "exdent": [2, 104, 112], "initi": [2, 5, 6, 9, 31, 104, 108, 109], "prefix": [2, 104, 109, 111, 112], "knuth": [2, 11, 104, 114], "dynam": [2, 104, 106, 112, 114], "algorithm": [2, 9, 10, 11, 13, 67, 80, 81, 88, 99, 104, 107, 108, 112, 113], "assum": [2, 4, 5, 38, 39, 40, 43, 44, 99, 107, 109, 110, 111], "cost": [2, 104], "print": [2, 5, 8, 9, 20, 53, 68, 85, 90, 91, 103, 104, 106, 107, 112, 113], "last": [2, 7, 12, 29, 46, 58, 59, 60, 76, 84, 86, 89, 96, 100, 104, 106, 107, 108, 109, 110], "line": [2, 3, 8, 9, 12, 13, 19, 30, 59, 63, 66, 68, 74, 83, 87, 88, 93, 104, 111, 112, 113, 114], "128": [2, 37, 93, 98], "122": [2, 37, 93, 98, 111], "n_min": [2, 54, 82, 83, 106], "126": [2, 37, 56, 93, 98], "stri_split": [2, 3, 7, 54, 83, 84, 107], "abl": [2, 7], "act": [2, 14, 35, 63, 68, 93, 104, 107], "just": [2, 5, 6, 8, 12, 19, 29, 31, 41, 47, 58, 59, 69, 76, 90, 102, 108, 109, 110, 112, 113], "str_split_fix": 2, "119": [2, 37, 93, 98], "stri_split_boundari": [2, 3, 6, 7, 8, 10, 15, 17, 19, 29, 31, 47, 59, 63, 64, 67, 72, 80, 81, 82, 84, 95, 102, 104, 112], "tokens_onli": [2, 82, 83], "addition": [2, 5, 13, 17, 37, 38, 60], "116": [2, 37, 56, 93, 98], "ignore_nul": [2, 51], "past": [2, 48, 51, 77, 106, 109], "123": [2, 14, 18, 27, 37, 47, 50, 51, 52, 53, 62, 76, 79, 83, 91, 93, 95, 96, 98], "usedynlib": 2, "speed": [2, 5, 66, 107, 109, 113], "114": [2, 37, 93, 98, 110, 111, 114], "94": [2, 26, 37, 85, 93, 98, 109], "du_disable_renam": 2, "memori": [2, 5, 62, 74], "alloc": 2, "unicodestr": 2, "asan": 2, "saniti": [2, 85], "87": [2, 37, 46, 93, 98, 109, 110], "pipe": [2, 89, 90, 107, 109], "magrittr": [2, 109], "108": [2, 37, 93, 98, 110], "breakiter": [2, 3, 8, 19, 47, 59, 83, 95, 104], "analysi": [2, 7, 8, 12, 13, 19, 47, 59, 63, 83, 104, 112], "control": [2, 8, 9, 12, 64, 66, 67, 80, 86, 101, 103, 106, 108, 113], "aim": [2, 9, 19, 44, 73, 91, 106, 107, 109, 112], "stri_trans_totitl": [2, 8, 95, 112], "109": [2, 26, 37, 93, 98, 109], "stri_count_boundari": [2, 3, 6, 7, 8, 10, 13, 15, 17, 18, 29, 31, 47, 53, 59, 63, 64, 67, 72, 80, 81, 83, 84, 95, 102, 104, 112], "stri_count_word": [2, 19, 47, 59, 112], "count": [2, 3, 7, 8, 13, 23, 86, 88, 89, 106, 109, 112], "41": [2, 37, 46, 56, 59, 93, 98, 109, 110, 111], "stri_startswith_": [2, 7], "stri_endswith_": [2, 7], "determin": [2, 3, 5, 9, 13, 17, 19, 27, 30, 40, 82, 84, 94, 99, 104, 106, 107, 108, 113], "whether": [2, 6, 17, 23, 27, 29, 31, 34, 35, 36, 38, 44, 46, 49, 50, 58, 64, 66, 82, 84, 86, 89, 90, 91, 92, 99, 102, 107, 108, 113], "start": [2, 3, 7, 8, 9, 27, 46, 58, 59, 66, 68, 69, 76, 89, 90, 100, 104, 106, 107, 112, 113], "end": [2, 3, 7, 8, 9, 12, 13, 27, 32, 46, 57, 58, 59, 62, 63, 66, 67, 76, 80, 84, 88, 89, 90, 93, 94, 100, 104, 106, 107, 108, 112], "102": [2, 37, 93, 98], "stri_replace_all_": [2, 76], "vectorize_al": [2, 76], "91": [2, 26, 37, 56, 93, 98], "stri_subset_": [2, 7, 91], "effici": [2, 4, 10, 12, 43, 107, 109, 111], "substitut": [2, 5, 40, 44, 73, 82, 89, 90, 104, 105, 107, 112], "100": [2, 12, 26, 37, 64, 67, 72, 80, 93, 98, 108, 109], "stri_split_fix": [2, 55, 82, 106, 107, 109], "stri_split_charclass": [2, 82], "stri_split_col": [2, 82], "105": [2, 37, 93, 98, 109], "stri_extract": [2, 3, 7, 58, 60, 107, 113], "107": [2, 37, 93, 98], "106": [2, 26, 37, 56, 93, 98], "byrow": [2, 46, 47, 54, 82, 83, 106, 109], "77": [2, 37, 46, 59, 83, 93, 98, 103, 112], "pseudo": [2, 13, 69, 70, 71], "dummi": [2, 69], "lorem": [2, 3, 18, 52, 76, 82, 87, 88, 104, 112], "ipsum": [2, 3, 18, 52, 76, 82, 87, 88, 104, 112], "indic": [2, 4, 7, 15, 17, 29, 31, 34, 36, 44, 46, 47, 49, 58, 59, 60, 83, 89, 90, 102, 106, 107, 108], "should": [2, 5, 6, 21, 23, 29, 30, 38, 39, 44, 48, 49, 54, 58, 63, 65, 67, 68, 69, 75, 76, 80, 82, 84, 85, 89, 90, 91, 104, 107, 108, 110, 113], "86": [2, 37, 56, 93, 98, 110], "_coll": [2, 7, 10, 86, 108], "99": [2, 23, 37, 93, 98, 109], "stri_replace_al": [2, 7, 76, 78, 100, 107], "112": [2, 26, 37, 93, 98], "led": 2, "spontan": 2, "servic": [2, 5, 6, 10, 56, 64, 93, 97, 109, 111, 112], "leak": 2, "detect": [2, 3, 7, 13, 35, 38, 39, 42, 53, 60, 65, 74, 87, 108, 112], "valgrind": 2, "memcheck": 2, "full": [2, 23, 65, 82, 83, 95, 97, 103, 112, 113], "extens": 2, "clean": 2, "though": [2, 12, 85, 89, 90, 108, 111, 113], "misalign": 2, "address": [2, 113], "stri_cmp": [2, 13, 17, 64], "stri_cmp_eq": [2, 17, 95, 107], "stri_cmp_neq": [2, 17, 107], "independ": [2, 7, 13, 15, 17, 34, 35, 36, 76, 95, 97, 107, 108], "comparison": [2, 5, 6, 15, 17, 64, 67, 80, 108, 109], "stri_cmp_equiv": [2, 15, 17, 108], "stri_cmp_nequiv": [2, 17, 108], "canon": [2, 10, 15, 17, 29, 33, 37, 99, 102, 108, 111, 113], "exact": [2, 12, 107], "wise": [2, 7, 13], "cours": [2, 4, 30, 31, 86], "routin": [2, 5, 113], "reason": [2, 4, 5, 43, 44, 109], "behind": [2, 12], "usearch": 2, "poor": 2, "task": [2, 7, 12, 13, 97, 98, 107, 109, 112], "suffici": 2, "anywai": 2, "morri": [2, 11, 114], "pratt": [2, 11, 114], "drastic": 2, "stri_enc_nf": 2, "stri_enc_isnf": 2, "famili": [2, 37, 63, 107, 111], "stri_trans_nf": [2, 3], "stri_trans_isnf": [2, 99], "deal": [2, 4, 5, 42, 53, 106, 109, 112, 113], "transform": [2, 3, 13, 96, 99, 110], "split": [2, 3, 7, 12, 13, 73, 74, 104, 111, 112], "stri_pad_left": [2, 68], "stri_pad_right": [2, 68], "stri_pad_both": [2, 16, 50, 53, 62, 68, 85, 103], "paragraph": [2, 3, 8, 9, 69, 84, 112, 114], "greedi": [2, 104, 112, 113], "minim": [2, 33, 54, 68, 104, 109], "ragged": [2, 104, 112], "sole": [2, 5], "unicodeset": [2, 97], "previous": [2, 39, 57, 94], "charclass": [2, 9, 18, 27, 46, 58, 71, 76, 82, 86, 87, 91, 100, 103, 112], "becam": 2, "familiar": 2, "observ": [2, 5, 6, 43, 71, 72, 93, 107, 108], "nice": 2, "none": [2, 87, 104], "preserv": [2, 100, 104, 109], "stri_uniqu": [2, 3, 6, 8, 10, 13, 15, 17, 19, 29, 31, 47, 59, 64, 67, 72, 80, 81, 83, 95, 104, 108], "uniqu": [2, 3, 6, 8, 29, 37, 96, 108, 113], "stri_duplicated_ani": [2, 29, 108], "duplic": [2, 3, 37, 102, 108], "stri_replace_na": [2, 3, 54, 61, 75, 109], "emul": 2, "permut": [2, 3, 70, 79, 108], "stri_cmp_lt": [2, 17, 108], "stri_cmp_l": [2, 15, 17, 108], "stri_cmp_gt": [2, 17], "stri_cmp_g": [2, 17], "stri_enc_mark": [2, 3, 5, 33, 37, 39, 40, 41, 43, 44, 111], "declar": [2, 3, 5, 39, 40, 41, 43, 44], "seen": [2, 38, 113], "stri_enc_ton": [2, 3, 5, 32, 40, 42, 43, 44], "stri_ord": [2, 3, 6, 8, 10, 13, 15, 17, 19, 29, 31, 47, 59, 64, 72, 80, 81, 83, 95, 102, 104, 108], "na_last": [2, 67, 80], "stri_replace_all_charclass": [2, 76], "stri_extract_all_charclass": [2, 46], "stri_locate_all_charclass": [2, 58], "merg": [2, 30, 46, 58, 76], "white": [2, 9, 12, 13, 18, 46, 66, 76, 87, 88, 100, 104, 113], "singl": [2, 5, 8, 9, 16, 19, 20, 21, 22, 23, 26, 27, 29, 30, 31, 32, 33, 37, 39, 40, 43, 44, 46, 47, 48, 49, 51, 52, 54, 55, 57, 58, 59, 60, 63, 64, 65, 67, 68, 69, 71, 73, 76, 77, 80, 81, 82, 83, 84, 85, 86, 89, 90, 91, 92, 93, 94, 95, 96, 97, 100, 104, 106, 107, 108, 109, 110, 113], "stri_enc_toutf8": [2, 3, 5, 32, 40, 41, 42, 44, 53, 77], "valid": [2, 5, 6, 17, 31, 34, 35, 36, 37, 43, 101], "rare": [2, 4, 5], "where": [2, 5, 12, 17, 23, 24, 32, 39, 42, 43, 45, 51, 58, 62, 63, 67, 76, 80, 84, 86, 87, 88, 91, 93, 100, 104, 106, 107, 108, 110, 113], "want": [2, 6, 42, 43], "alias": [2, 9, 37, 51, 52, 111], "stricontainerutf8": 2, "stricontainerutf16": 2, "stri_join": [2, 3, 4, 13, 14, 28, 48, 52, 106, 109, 113], "stri_trans_to": 2, "3rd": [2, 26, 106, 109, 112], "u_missing_resource_error": 2, "messag": [2, 12, 112], "striexcept": 2, "bom": [2, 5, 17, 37, 43, 44], "re": [2, 5, 27, 38, 39, 62, 73, 85, 105, 109, 110], "nativ": [2, 3, 5, 9, 13, 38, 39, 43, 44, 49, 62, 99, 109, 111], "rf_error": 2, "guarante": [2, 109, 111, 112, 113], "gcmask": 2, "uint32_t": 2, "arrai": 2, "over": [2, 5, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 27, 28, 30, 31, 46, 47, 51, 58, 59, 60, 68, 71, 76, 82, 83, 84, 85, 86, 89, 90, 91, 95, 96, 100, 104, 107, 109, 111], "string8": 2, "uninitialis": 2, "server": 2, "50": [2, 37, 59, 93, 98, 111], "need": [2, 4, 5, 12, 30, 62, 85, 89, 90, 93, 106, 107, 108, 109, 110, 111, 113], "icudt52b": 2, "subset": [2, 5, 7, 9, 27, 33, 91, 106, 113], "while": [2, 5, 6, 8, 17, 39, 109], "prepar": 2, "submiss": 2, "stubdata": 2, "icu52dt": 2, "extern": [2, 5, 111], "static": 2, "intens": 2, "student": 2, "warsaw": [2, 92, 93, 94, 112], "univers": [2, 5, 13, 93, 100, 111], "technologi": 2, "oracl": 2, "studio": 2, "By": [2, 3, 23, 68, 76, 89, 104, 106, 108, 112, 113], "mileston": 2, "about_argu": [3, 5, 6, 7, 8, 9, 10, 11, 12, 13], "about_encod": [3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44], "about_local": [3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 19, 29, 31, 47, 55, 56, 57, 59, 64, 67, 72, 80, 81, 83, 95, 102, 104], "about_search_boundari": [3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 15, 17, 19, 29, 31, 47, 59, 63, 64, 67, 72, 80, 81, 83, 84, 95, 102, 104], "about_search_charclass": [3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 100], "about_search_col": [3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 15, 17, 19, 29, 31, 47, 59, 64, 67, 72, 80, 81, 83, 95, 102, 104], "about_search_fix": [3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 65], "about_search_regex": [3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 66], "about_search": [3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 18, 19, 27, 46, 47, 58, 59, 60, 63, 64, 65, 66, 76, 78, 82, 83, 84, 86, 91, 95, 100, 104], "about_stringi": [3, 4, 5, 6, 7, 8, 9, 10, 11, 12], "operator_add": 3, "operator_compar": 3, "without": [3, 6, 21, 23, 66, 110, 113], "operator_dollar": 3, "stri_compar": [3, 6, 8, 10, 15, 19, 29, 31, 47, 59, 64, 67, 72, 80, 81, 83, 95, 102, 104], "arithmet": [3, 109], "creat": [3, 5, 14, 56, 112, 113], "sensit": [3, 7, 10, 13, 23, 57, 65, 66, 85, 95, 108, 112, 113], "stri_enc_fromutf32": [3, 5, 40, 41, 42, 43, 44, 46, 103, 111], "stri_enc_info": [3, 5, 37, 38, 39, 49], "queri": [3, 6, 56, 94, 107], "stream": [3, 40, 43], "possibli": [3, 12, 63, 106, 107, 112, 113], "stri_enc_isutf16": 3, "16": [3, 26, 33, 37, 44, 49, 56, 58, 93, 98, 110, 111], "8": [3, 13, 17, 18, 19, 21, 22, 23, 26, 30, 31, 32, 33, 37, 38, 39, 40, 41, 42, 44, 45, 49, 51, 53, 57, 59, 62, 68, 71, 72, 73, 81, 83, 91, 93, 98, 99, 101, 105, 106, 108, 109, 110, 111, 112, 114], "stri_enc_toascii": [3, 5, 32, 41, 42, 43, 44], "stri_escape_unicod": [3, 13, 101, 111], "escap": [3, 12, 13, 23, 66, 76, 111, 113], "stri_extract_boundari": 3, "flatten": 3, "stri_isempti": [3, 16, 53, 62, 68, 85, 103, 106], "stri_locale_info": [3, 6, 49, 56, 57], "stri_locale_set": [3, 6, 55, 56, 108], "stri_numbyt": [3, 16, 19, 50, 53, 68, 85, 103], "matcher": [3, 4, 113], "center": [3, 93], "left": [3, 9, 24, 46, 58, 64, 66, 76, 85, 104, 107, 108, 110, 112, 113], "right": [3, 9, 46, 58, 76, 108, 110, 112, 113], "align": [3, 85, 112], "randomli": [3, 69, 108], "shuffl": 3, "raw": [3, 5, 30, 31, 34, 35, 36, 42, 44, 92, 93, 110, 111], "stri_revers": [3, 13, 70, 106], "stri_split_lin": [3, 7, 8, 13, 19, 47, 59, 63, 82, 83, 95, 104, 112], "Into": 3, "stri_startsendswith": 3, "stri_stats_gener": [3, 13, 88], "stri_stats_latex": [3, 13, 87], "contain": [3, 9, 49, 63, 66, 76, 81, 87, 104, 107, 109, 113], "latex": 3, "select": [3, 5, 6, 22, 31, 33, 58, 69, 104, 106, 108, 109, 112], "stri_trans_casemap": 3, "translat": [3, 5, 13, 33, 112], "For": [3, 4, 5, 6, 8, 9, 10, 12, 17, 19, 23, 24, 30, 32, 36, 37, 43, 44, 45, 46, 47, 53, 58, 59, 60, 62, 63, 66, 67, 72, 76, 80, 81, 83, 85, 86, 89, 90, 92, 94, 95, 97, 100, 101, 106, 107, 108, 109, 110, 111, 112, 113], "trim": [3, 13, 86], "side": [3, 68, 85, 104, 109, 112, 113], "stri_unescape_unicod": [3, 45, 62], "un": [3, 93], "write": [3, 8, 13, 107, 109, 112, 113], "explain": [4, 5, 6, 7, 107], "clearli": 4, "discuss": [4, 5, 39, 44, 55, 108, 111, 113], "expect": [4, 6, 9, 66, 108, 109, 111, 113], "factor": [4, 20, 22, 23, 85, 109], "coercibl": [4, 14, 15, 17, 19, 32, 38, 42, 47, 50, 51, 53, 59, 62, 77, 83, 85, 103], "otherwis": [4, 23, 27, 29, 44, 45, 46, 47, 49, 51, 52, 54, 58, 59, 66, 71, 82, 83, 87, 92, 93, 100, 104, 113], "logic": [4, 15, 17, 21, 23, 27, 29, 30, 34, 35, 36, 37, 43, 44, 46, 47, 48, 49, 50, 51, 54, 58, 59, 60, 63, 64, 65, 66, 67, 68, 69, 76, 80, 82, 83, 84, 85, 86, 89, 90, 91, 99, 104, 106, 107, 108, 109, 113], "integ": [4, 5, 17, 18, 19, 20, 21, 27, 28, 29, 32, 42, 53, 54, 58, 59, 62, 64, 66, 67, 68, 69, 71, 80, 82, 83, 85, 86, 87, 88, 89, 90, 103, 104, 106, 108, 111, 113], "almost": [4, 5, 93, 109], "appli": [4, 9, 12, 14, 82, 84, 85, 90, 93, 103, 104, 106, 108, 109, 111, 113], "whenev": [4, 5, 65, 111], "properti": [4, 7, 12, 18, 87, 100, 103, 113], "instanc": [4, 5, 18, 23, 27, 36, 37, 46, 58, 60, 85, 86, 89, 100, 106, 107, 108, 109, 110, 111, 112, 113], "th": [4, 18, 27, 34, 36, 46, 56, 58, 60, 82, 83, 90, 106], "took": 4, "great": 4, "care": [4, 89, 109, 110], "reus": 4, "establish": [4, 57, 64, 94], "onc": [4, 27, 74, 107, 108, 109, 113], "behavior": [4, 6, 8, 12, 43, 51, 63, 64, 65, 66, 67, 80, 93], "man": [4, 7, 9, 13, 26, 45, 85, 113], "particular": [4, 5, 6, 8, 9, 12, 13, 63, 78, 89, 97, 106, 108, 109, 110, 111, 112, 113], "interest": [4, 13, 27, 86, 91, 107], "dim": [4, 110], "notat": [4, 111, 113], "sometim": [4, 35, 53, 84, 113], "contributor": [4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105], "offici": [4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105], "onlin": [4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105], "stringi_general_top": [4, 5, 6, 7, 8, 9, 10, 11, 12, 13], "variou": [5, 68, 85, 104, 106, 108, 111], "let": [5, 106, 107, 108, 109, 110, 113], "coexist": [5, 111], "consol": [5, 53, 68, 85, 104, 112], "ever": [5, 109], "even": [5, 8, 12, 23, 30, 54, 55, 107, 108, 109, 111, 112, 113], "alwai": [5, 9, 17, 31, 39, 40, 44, 51, 54, 56, 57, 71, 73, 85, 93, 99, 104, 107, 109, 111, 113], "regardless": [5, 109], "optim": 5, "competit": 5, "better": [5, 12, 29, 65, 70, 102], "especi": [5, 10, 30, 89, 108], "best": [5, 6, 30, 31, 108], "cascad": 5, "quot": [5, 9, 12, 23, 45, 109, 113], "guid": [5, 6, 8, 9, 10, 12, 17, 20, 23, 26, 29, 30, 44, 63, 64, 65, 66, 67, 72, 80, 81, 93, 95, 97, 98, 99, 102, 108, 112, 113], "hundr": [5, 30, 31], "develop": [5, 13, 113, 114], "year": [5, 20, 21, 22, 23, 92, 93, 110, 111], "small": [5, 71, 88, 95, 97, 108], "storag": [5, 66, 113], "knowledg": 5, "written": [5, 30, 66, 113], "either": [5, 9, 12, 18, 23, 24, 26, 27, 44, 45, 46, 63, 82, 86, 91, 93, 95, 100, 106, 107, 108, 109, 113], "them": [5, 6, 17, 30, 33, 85, 98, 108, 110, 113], "cover": [5, 12, 31, 112], "major": [5, 109, 110], "world": [5, 99, 107, 110], "machin": [5, 39, 113], "form": [5, 6, 9, 12, 16, 23, 24, 36, 40, 42, 49, 55, 57, 60, 64, 76, 84, 89, 99, 101, 106, 108, 111, 113], "scheme": [5, 9, 33, 107], "fit": [5, 8, 63, 109], "protocol": 5, "interoper": [5, 99, 109], "iso": [5, 6, 9, 13, 23, 30, 37, 93, 108, 111, 113], "8859": [5, 30, 37, 111], "easier": [5, 91, 109, 111], "Such": [5, 29, 85, 89, 90, 102, 106, 107, 108, 111], "store": [5, 62, 108, 110, 111, 113], "somehow": 5, "u": [5, 6, 9, 23, 24, 37, 44, 48, 51, 66, 80, 83, 84, 93, 103, 106, 107, 108, 109, 110, 111, 113], "0000": [5, 9, 92, 111], "10ffff": [5, 9, 111], "amount": [5, 20, 30, 93], "21": [5, 21, 37, 46, 51, 56, 58, 93, 98, 106, 110, 111], "repres": [5, 9, 17, 23, 25, 30, 32, 33, 36, 37, 46, 58, 60, 66, 84, 85, 87, 88, 93, 108, 109, 111, 113], "four": [5, 106, 108, 112], "faq": 5, "thought": [5, 111, 113], "superset": [5, 39, 111], "spectrum": 5, "choic": [5, 111], "127": [5, 22, 26, 34, 37, 38, 40, 43, 93, 98, 109], "multi": [5, 9, 30], "4": [5, 12, 18, 20, 23, 26, 28, 37, 45, 46, 51, 54, 58, 59, 60, 62, 64, 67, 72, 76, 82, 83, 85, 87, 89, 90, 93, 98, 101, 106, 107, 108, 109, 110, 111, 112, 113, 114], "unfortun": 5, "realli": [5, 55, 109], "mind": [5, 109], "therefor": [5, 9, 17, 84, 106, 108, 109, 110, 111, 113], "decid": [5, 111], "ambigu": 5, "ogonek": [5, 36, 79, 99, 108, 111, 113], "graphem": [5, 12], "semant": 5, "stri_trans_nfc": [5, 13, 53, 89, 95, 96, 97, 98, 99, 103, 104, 111], "denorm": 5, "appear": [5, 6, 23, 63, 71, 82, 84, 87, 88, 108], "typic": [5, 14, 15, 86, 93, 99, 108], "activ": [5, 9, 62, 99, 108, 113], "incident": 5, "utf8": [5, 37, 49, 111], "en": [5, 6, 26, 56, 85, 97, 99, 108, 110], "understand": [5, 55], "central": [5, 92, 93, 111], "european": [5, 6, 92, 93, 111], "177": [5, 37, 93, 98], "polish": [5, 6, 17, 30, 108, 109, 112, 113], "western": [5, 93, 111], "denot": [5, 9, 12, 22, 48, 58, 76, 86, 89, 104, 106, 111, 113], "plu": [5, 9, 12, 112], "minu": [5, 85, 110], "commun": [5, 6, 108, 111], "overal": [5, 12, 108], "mechan": [5, 38], "There": [5, 106, 107, 108, 109, 113], "implicit": [5, 9, 38], "assumpt": [5, 38, 40], "extend": [5, 9, 23, 36, 38, 40, 43, 111, 113], "automat": [5, 9, 38, 44, 99, 108, 111], "manipul": [5, 13, 109], "greater": [5, 17, 36, 38, 40, 51, 52, 62, 71, 104, 109], "k": [5, 12, 23, 38, 48, 51, 56, 80, 97, 104, 113, 114], "mislead": [5, 53, 111], "explicit": 5, "examin": [5, 27], "lc_ctype": [5, 38, 39, 111], "getlocal": [5, 38, 39, 111], "intuit": [5, 38, 67, 80, 109], "stdin": [5, 38], "keyboard": [5, 38], "sens": [5, 112], "encount": [5, 12, 39, 111], "unless": [5, 9, 27, 39, 51, 52, 58, 89, 90, 94, 113], "know": [5, 39, 106, 107, 111, 113], "carefulli": [5, 109], "These": [5, 7, 8, 9, 14, 15, 17, 18, 19, 23, 27, 35, 44, 46, 47, 51, 52, 58, 59, 60, 68, 76, 82, 84, 85, 86, 91, 95, 99, 100, 107, 113], "is_unknown_8bit": [5, 43], "final": [5, 6, 9, 12, 103], "properli": [5, 10, 38, 50, 53, 62, 64, 108], "shown": [5, 9, 12], "apart": [5, 37, 108, 112, 113], "insensit": [5, 9, 11, 12, 17, 65, 66, 107, 108, 113], "lead": [5, 9, 12, 17, 113], "digit": [5, 9, 12, 13, 23, 45, 64, 71, 93, 98, 101, 108, 110, 111, 113], "alphanumer": 5, "utf_8": 5, "tf08": 5, "exactli": [5, 12, 17, 32, 33, 38, 42, 68, 107, 113], "plai": [5, 108], "role": 5, "autom": [5, 110], "meaning": [5, 108], "imprecis": [5, 30, 31, 111], "consider": 5, "speak": 5, "io": [5, 6, 8, 9, 10, 12, 13, 17, 20, 23, 26, 29, 30, 44, 63, 64, 65, 66, 67, 72, 80, 81, 88, 93, 94, 95, 97, 98, 99, 102, 113], "userguid": [5, 6, 8, 9, 10, 12, 17, 20, 23, 26, 29, 30, 44, 63, 64, 65, 66, 67, 72, 80, 81, 93, 95, 97, 98, 99, 102, 113], "html": [5, 6, 9, 10, 12, 26, 30, 63, 64, 65, 66, 84, 93, 94, 95, 110, 113], "technic": [5, 8, 12, 84, 99, 113, 114], "www": [5, 6, 9, 12, 13, 84, 99, 103, 111, 114], "utf_bom": 5, "encoding_manag": [5, 33, 37, 38, 39], "encoding_detect": [5, 30, 31, 34, 35, 36], "stri_enc_isutf16b": [5, 30, 31, 34, 35, 36], "encoding_convers": [5, 32, 40, 41, 42, 43, 44], "section": [6, 9, 12, 66, 106, 108, 109, 110, 111], "fundament": 6, "concept": [6, 113], "who": [6, 114], "cultur": [6, 108], "human": [6, 92], "interact": 6, "region": [6, 93, 108, 110, 112], "verifi": [6, 107], "ask": [6, 107], "must": [6, 8, 12, 76, 90, 111, 112, 113], "back": [6, 9, 12, 23, 89], "necessarili": [6, 108, 109, 113], "parametr": 6, "deliv": [6, 108], "language_countri": [6, 55, 57, 108], "language_country_vari": [6, 57, 108], "en_u": [6, 56, 57, 59, 83, 95, 108], "letter": [6, 8, 9, 10, 11, 12, 14, 18, 23, 24, 30, 34, 36, 48, 50, 51, 53, 62, 63, 64, 66, 70, 71, 80, 85, 93, 95, 97, 103, 106, 108, 109, 111, 113], "639": [6, 37, 98, 108], "stand": [6, 9, 22, 23, 26, 113], "english": [6, 10, 30, 106, 108, 112, 113], "pl": [6, 55, 56, 93, 97, 98], "fr": [6, 37, 56], "french": [6, 30, 64, 93, 108], "de": [6, 37, 56, 93, 98, 106, 111, 112], "german": [6, 30, 95, 108], "countri": [6, 55, 93, 108, 110], "3166": [6, 93, 108], "reflect": [6, 33, 108], "convent": [6, 19, 45, 47, 59, 95, 104, 108, 109], "australian": [6, 93, 108], "en_au": [6, 56, 57, 108], "currenc": [6, 9, 108], "sever": [6, 30], "circul": 6, "variant": [6, 55, 76, 89, 90, 108, 111], "_euro": 6, "keyword": [6, 13, 20, 21, 22, 23], "Their": [6, 12, 113], "util": [6, 12, 54, 61, 75, 77, 94, 104, 108, 112, 113], "recogn": [6, 45, 66, 101], "phonebook": [6, 17, 108], "islam": [6, 26], "civil": 6, "synonym": [6, 28, 85, 106, 111, 113], "desir": [6, 66, 71, 77, 97, 106, 111, 112, 113], "referenc": 6, "dure": [6, 56, 82, 93, 108, 109], "improp": [6, 108], "One": [6, 113], "tune": [6, 10, 11, 12, 17, 18, 27, 46, 58, 63, 64, 65, 66, 67, 72, 76, 80, 81, 82, 86, 91, 107, 109], "choos": 6, "nor": [6, 39, 43, 108, 113], "es_": [6, 56], "v": [6, 17, 23, 45, 48, 51, 80, 81, 83, 101, 106, 108, 109, 114], "stri_trans_tolow": [6, 7, 8, 10, 13, 15, 17, 19, 29, 31, 47, 59, 63, 64, 67, 72, 80, 81, 83, 84, 95, 96, 97, 98, 99, 102, 104, 112], "locale_manag": [6, 55, 56, 57], "locale_sensit": [6, 8, 10, 15, 17, 19, 29, 31, 47, 59, 64, 67, 72, 80, 81, 83, 95, 102, 104], "stri_extract_all_boundari": [6, 7, 8, 10, 15, 17, 19, 29, 31, 46, 47, 59, 60, 63, 64, 67, 72, 80, 81, 83, 84, 95, 102, 104], "stringsearch": [7, 10], "occur": [7, 8, 12, 30, 44, 107, 108, 109, 112], "stri_count_": 7, "stri_replace_": [7, 76], "chunk": [7, 90, 106, 112], "text_boundari": [7, 8, 19, 47, 59, 63, 83, 84, 95, 104], "search_regex": [7, 12, 66], "search_fix": [7, 11, 65], "search_col": [7, 10, 64], "search_charclass": [7, 9, 100], "stri_trim_both": [7, 9, 76, 78, 100], "search_detect": [7, 27, 86], "search_count": [7, 18, 19], "search_loc": [7, 58, 59], "stri_locate_al": [7, 58, 59, 89, 90, 107], "search_replac": [7, 76, 78, 100], "search_split": [7, 82, 83, 84], "search_subset": [7, 91], "search_extract": [7, 46, 47, 60], "stri_match_al": [7, 46, 47, 60, 107], "linguist": [8, 9, 112], "margin": 8, "sentenc": [8, 19, 59, 63, 69, 83, 95, 112], "capit": [8, 95], "third": [8, 60, 64, 106, 108], "japanes": [8, 9, 26, 30, 97, 106, 112], "chines": [8, 9, 23, 30, 37, 106, 108, 112], "separ": [8, 9, 23, 47, 48, 51, 52, 55, 58, 63, 73, 82, 84, 85, 86, 87, 88, 97, 105, 106, 107, 108, 109, 110, 111, 112, 113], "middl": [8, 9, 89, 93, 109, 112], "punctuat": [8, 9, 10, 11, 23, 112, 113], "diacrit": [8, 9, 17, 112], "taken": [8, 30, 109, 110], "account": [8, 10, 17, 30, 65, 68, 85, 92, 104, 108], "would": [8, 62, 66, 100, 109, 110], "think": 8, "whole": [8, 60, 65, 107, 109, 110], "line_break": [8, 19, 47, 59, 63, 83, 112], "boundaryanalysi": [8, 63], "here": [9, 10, 11, 12, 17, 30, 38, 41, 43, 53, 58, 60, 85, 91, 106, 107, 108, 109, 111, 112, 113], "faster": [9, 44, 86, 91, 107, 109, 113], "briefli": 9, "summar": [9, 12], "bibliograph": 9, "recal": [9, 106, 107, 111, 113], "legal": 9, "inclus": [9, 89, 106], "seri": [9, 97, 109, 113], "bound": [9, 89], "squar": [9, 104, 106, 112, 113], "bracket": [9, 12, 30, 106, 112, 113], "emploi": 9, "perl": [9, 12, 98, 109, 113], "u0105": [9, 17, 29, 34, 36, 45, 50, 53, 62, 79, 85, 95, 97, 99, 101, 102, 103, 109], "0105": [9, 108], "abc": [9, 12, 14, 27, 28, 46, 50, 51, 53, 62, 79, 89, 90, 95, 107, 109, 113], "b": [9, 12, 15, 16, 18, 26, 29, 45, 46, 48, 51, 54, 56, 61, 72, 75, 76, 80, 82, 83, 85, 90, 101, 106, 107, 108, 109, 112, 113], "z": [9, 12, 18, 23, 27, 46, 48, 51, 71, 80, 82, 100, 106, 109, 111, 113], "through": 9, "theoret": [9, 12, 113], "complement": 9, "pat1": 9, "pat2": 9, "union": [9, 12, 113], "intersect": [9, 12], "asymmetr": 9, "slash": 9, "freeli": 9, "clariti": 9, "f": [9, 12, 23, 26, 30, 45, 48, 51, 54, 79, 80, 83, 85, 101, 104, 107, 110, 112, 113, 114], "mean": [9, 23, 35, 36, 57, 66, 87, 92, 93, 94, 106, 107, 108, 109, 110, 113], "acd": 9, "fm": 9, "disallow": [9, 44], "preced": [9, 12, 113], "backslash": [9, 66, 76, 111, 113], "glanc": [9, 10], "accord": [9, 38, 44, 46, 62, 64, 72, 80, 82, 95, 108, 111, 112, 113], "regexp": [9, 12, 66, 113], "u0000": 9, "u0010ffff": [9, 12], "general_categori": [9, 12], "l": [9, 10, 12, 18, 23, 48, 51, 52, 80, 83, 84, 97, 109, 111, 112, 113, 114], "upper": [9, 13, 64, 95, 97, 98, 108, 112, 113], "everyth": [9, 12], "numeric_valu": [9, 12], "cyril": [9, 12, 37, 97, 98, 108], "latin": [9, 12, 37, 68, 69, 71, 97, 98, 108, 111, 112, 113], "za": [9, 12, 56, 71, 113], "z0": [9, 12, 71], "greek": [9, 30, 37, 97, 98], "abov": [9, 31, 54, 60, 64, 83, 106, 107, 108, 109, 110, 111, 112, 113], "predefin": [9, 69], "lu": [9, 18, 27, 56, 111, 113], "uppercas": [9, 97, 113], "white_spac": [9, 18, 76, 82, 87], "larg": 9, "databas": [9, 13, 113], "classif": 9, "fall": [9, 23], "cc": [9, 23, 103, 106], "c0": [9, 103], "c1": [9, 103], "cf": [9, 103], "cn": [9, 30, 37], "reserv": [9, 23], "unassign": 9, "co": 9, "privat": 9, "surrog": 9, "lc": 9, "ll": [9, 18, 23, 27, 46, 71, 108, 111, 113], "lt": [9, 56, 98], "lowercas": [9, 97, 109, 113], "lm": 9, "lo": [9, 23, 56], "syllabl": 9, "ideograph": [9, 63], "digraph": 9, "mc": 9, "combin": [9, 12, 55, 97, 99, 108, 109, 111], "advanc": [9, 12, 63, 111, 113], "me": [9, 86, 103], "enclos": [9, 12, 23], "mn": [9, 56, 98, 103, 106], "nd": [9, 12, 56, 113], "decim": [9, 12, 111, 113], "nl": [9, 37, 56, 98], "pd": 9, "hyphen": [9, 103], "pair": [9, 108, 113], "pe": 9, "tie": 9, "po": 9, "pi": [9, 85, 112], "quotat": 9, "pf": 9, "sm": 9, "mathemat": [9, 97], "sc": [9, 56], "zl": 9, "2028": [9, 84], "zp": 9, "2029": [9, 84], "alphabet": [9, 12, 112, 113], "ascii_hex_digit": 9, "9a": [9, 113], "fa": [9, 56, 98], "bidi_control": 9, "bidi": 9, "bidirect": [9, 70, 71, 79, 89], "bidi_mirror": 9, "kind": [9, 107, 113], "default_ignorable_code_point": 9, "2060": 9, "206f": 9, "fff0": 9, "fffb": 9, "e0000": 9, "e0fff": 9, "discourag": 9, "anoth": [9, 97, 106, 109, 111, 113], "shape": 9, "hex_digit": 9, "commonli": [9, 30], "hexadecim": [9, 111], "katakana": [9, 63, 97, 98, 112], "dot": [9, 85, 108, 109, 113], "id_continu": 9, "continu": [9, 107], "id_start": 9, "cjkv": 9, "korean": [9, 30, 37, 93, 97, 98, 106], "vietnames": 9, "math": 9, "noncharacter_code_point": 9, "quotation_mark": 9, "soft_dot": 9, "soft": [9, 63, 103], "j": [9, 12, 26, 46, 48, 51, 54, 80, 107, 113, 114], "place": [9, 89, 90, 91, 107, 109], "disappear": 9, "terminal_punctu": 9, "textual": [9, 108], "tab": [9, 12, 84, 104], "cr": [9, 63, 84, 104], "lf": [9, 63, 84, 104], "zwsp": 9, "zwnbsp": 9, "case_sensit": 9, "posix_alnum": 9, "posix_blank": 9, "posix_graph": 9, "posix_print": 9, "posix_xdigit": 9, "case_ignor": 9, "changes_when_lowercas": 9, "changes_when_uppercas": 9, "changes_when_titlecas": 9, "changes_when_casefold": 9, "changes_when_casemap": 9, "changes_when_nfkc_casefold": 9, "57": [9, 37, 46, 93, 98], "emoji_present": 9, "emoji_modifi": 9, "emoji_modifier_bas": 9, "punct": [9, 113], "someth": [9, 76, 108], "ispunct": [9, 113], "iec": [9, 111, 113], "9899": [9, 113], "1990": [9, 113], "c90": [9, 113], "isalnum": [9, 113], "belong": 9, "flavor": 9, "annex": [9, 99, 103, 108, 112, 113], "tr44": 9, "migrat": [9, 65], "unidata": 9, "txt": [9, 30, 111], "doc": [9, 10, 13, 26, 63, 64, 66, 93, 94, 110, 111], "apidoc": [9, 13, 26, 63, 64, 66, 93, 94], "classicu_1_1unicodeset": 9, "facil": [10, 11, 30, 31, 66, 101, 109, 113], "interestingli": [10, 109], "seem": 10, "notion": [10, 17, 103], "take": [10, 17, 65, 68, 85, 92, 104, 106, 108], "conjoin": [10, 11, 108], "slower": [10, 14, 29, 76, 102, 108], "werner": 10, "1999": [10, 23, 37], "efficient_text_searching_in_java": 10, "worst": [11, 107], "Be": [11, 27], "actual": [11, 104, 108, 111], "bitwis": 11, "done": [11, 71, 110, 113], "usual": [11, 15, 16, 32, 45, 51, 53, 67, 80, 90, 91, 99, 102, 107], "abstract": [12, 108, 111, 113], "fragment": 12, "With": [12, 55, 95], "Its": [12, 36, 89, 90, 95], "loos": 12, "jdk": [12, 113], "18": [12, 37, 58, 84, 88, 93, 98, 99, 106, 113], "good": [12, 46, 111], "introduct": [12, 108, 109, 113, 114], "friedl": [12, 114], "2002": [12, 37, 108], "topic": [12, 13, 111, 113], "prefer": [12, 108], "less": [12, 17, 54, 58, 108, 109], "retri": [12, 113], "fewer": 12, "possess": [12, 113], "parenthes": [12, 58, 60, 76, 110], "sub": [12, 60, 91], "somewhat": [12, 67, 80, 106, 107, 112], "comment": [12, 66, 113], "ahead": 12, "assert": 12, "unbound": 12, "angl": [12, 30, 113], "ismwx": 12, "evalu": [12, 85], "enabl": [12, 30, 65, 66, 107, 108, 112, 113], "portion": 12, "bell": [12, 114], "u0007": 12, "begin": [12, 13, 67, 80, 88, 93, 109], "transit": [12, 113], "w": [12, 23, 24, 26, 48, 51, 58, 60, 66, 80, 93, 109, 111, 113], "cx": [12, 101], "u001b": 12, "q": [12, 23, 48, 51, 80], "feed": [12, 84], "u000c": 12, "horizont": [12, 104], "space_separ": 12, "u0009": 12, "u000a": 12, "until": 12, "carriag": [12, 84], "u000d": 12, "t": [12, 18, 23, 26, 45, 48, 51, 80, 83, 97, 101, 109, 112, 113, 114], "tabul": 12, "uhhhh": 12, "hex": [12, 45, 97, 98, 101], "hhhh": 12, "uhhhhhhhh": 12, "hhhhhhhh": 12, "eight": 12, "largest": 12, "decimal_numb": 12, "connector_punctu": 12, "u200c": 12, "u200d": 12, "six": 12, "xhh": 12, "hh": [12, 23, 24, 112], "cluster": 12, "whatev": [12, 113], "nth": 12, "total": [12, 31, 68, 85, 87, 100, 104, 112], "0ooo": 12, "octal": [12, 101], "ooo": [12, 101], "three": [12, 23, 30, 31, 93, 95, 107, 108], "0377": 12, "distinguish": [12, 108], "newlin": [12, 73, 84, 105, 113], "outsid": [12, 23], "treat": [12, 23, 48, 51, 64, 66, 75, 85, 97, 108, 109, 113], "insid": [12, 23, 66], "context": [12, 23, 26, 65, 88, 95, 107, 108, 112], "whitespac": 12, "capabl": [12, 97], "offer": [12, 109], "natch": 12, "On": [12, 82, 83, 90, 106, 108, 109, 111, 113], "wish": [12, 48, 76, 82, 86, 110, 113], "lookup": [12, 26], "reilli": [12, 114], "tr18": [12, 84], "info": 12, "predict": 13, "everi": [13, 60, 76, 79, 104, 107, 109, 111, 113], "internation": 13, "l10n": 13, "homepag": 13, "accompani": 13, "ucd": 13, "seek": [13, 113], "pace": 13, "therein": [13, 109, 113], "gather": [13, 110], "fanci": [13, 48], "joy": 13, "lower": [13, 64, 95, 97, 98, 108, 111, 112, 113], "titl": [13, 95, 97, 98, 112], "bartek": 13, "ibm": [13, 33, 37, 114], "inc": [13, 114], "consortium": 13, "10646": [13, 37, 111], "rfc": [13, 23, 99], "3629": 13, "editor": [13, 99, 113, 114], "rfc3629": 13, "join": [14, 28, 48, 51, 52], "feel": [14, 15, 17, 86], "e1": [14, 15, 16, 17, 28], "e2": [14, 15, 16, 17, 28], "e3": 14, "temporari": 14, "xy": 14, "abca": [14, 109], "123b": 14, "xyc": 14, "abcd": [14, 16, 60, 68, 85, 106, 107, 109, 112], "123e": 14, "xyf": 14, "id_": 14, "5": [14, 18, 22, 23, 28, 30, 37, 46, 51, 54, 58, 59, 67, 70, 71, 72, 80, 83, 84, 85, 89, 90, 93, 98, 99, 100, 103, 106, 107, 108, 109, 110, 111, 112, 113, 114], "id_1": 14, "id_2": 14, "id_3": 14, "id_4": 14, "id_5": 14, "friend": 15, "consequ": [15, 39], "pairwis": 15, "shorter": [15, 18, 27, 46, 58, 60, 76, 82, 86, 90, 91, 106, 109], "python": [16, 106, 109, 112], "overload": [16, 112], "propag": [16, 109], "atomic_vector": 16, "u00df": [16, 19, 29, 95, 97, 102, 108, 111], "u00b5": 16, "u0001f970": 16, "abcdef": 16, "\u00df\u00b5": 16, "equal": [17, 23, 29, 30, 31, 51, 52, 64, 68, 71, 82, 83, 102, 103, 108, 111, 113], "clever": [17, 44, 113], "lexicograph": [17, 67, 72, 80, 108], "strcmp": [17, 81], "hold": [17, 38], "ch": [17, 37, 98, 108], "hladni": [17, 58, 67, 72, 80, 81], "chladni": [17, 67, 72, 80, 81, 108], "pl_pl": [17, 23, 26, 55, 56, 67, 72, 80, 81, 108, 109, 112], "slovak": [17, 108], "strength": [17, 29, 46, 58, 64, 86, 102], "hladn": [17, 58], "u00fd": [17, 46, 58], "mario": 17, "u00e1rio": 17, "case_level": [17, 64, 108], "2l": 17, "1l": [17, 20, 82, 83, 86, 89, 90], "stri_trans_nfkd": [17, 19, 29, 53, 68, 99, 102, 103, 111], "u105": 17, "ligatur": [17, 108], "ufb00": [17, 108], "ff": [17, 56, 84, 108], "u00e4rtn": 17, "gaertner": 17, "de_d": [17, 56, 95, 108], "coll": [18, 27, 46, 58, 64, 65, 76, 82, 86, 91, 109], "stri_count_charclass": 18, "stri_count_col": 18, "stri_count_regex": [18, 66, 111, 113], "supplementari": [18, 27, 46, 58, 60, 76, 82, 86, 91], "underli": [18, 27, 46, 58, 60, 76, 81, 82, 86, 91, 110, 111, 113], "dolor": [18, 52, 69, 76, 82, 87, 88, 104, 112], "sit": [18, 52, 69, 76, 82, 87, 88, 104, 112], "amet": [18, 52, 69, 76, 82, 87, 88, 104, 112], "consectetur": [18, 69, 76, 87, 88, 104], "adipis": [18, 76, 87, 88, 104], "elit": [18, 69, 76, 87, 88, 104, 112], "7": [18, 23, 26, 30, 37, 46, 51, 58, 59, 70, 72, 76, 83, 85, 93, 98, 106, 107, 108, 109, 110, 112, 113, 114], "babab": 18, "strrringi": [18, 27], "el": [18, 56, 76, 98, 111], "bab": [18, 109], "baab": 18, "baaab": 18, "ubrk_word_non": [19, 47, 59], "skip_word_non": [19, 59, 63, 83], "u00a0abov": [19, 59, 83, 112], "egg": [19, 58, 59, 60, 83, 89, 106, 112, 113], "bacon": [19, 52, 59, 60, 83, 89, 106, 109, 113], "83": [19, 37, 46, 93, 98, 109], "13": [19, 23, 26, 37, 46, 51, 59, 83, 84, 93, 98, 106, 112, 113, 114], "test2": 19, "u03c0": [19, 85], "u0153": 19, "u0119": [19, 109], "u00a9": 19, "u2190": 19, "u2193": 19, "u2192": 19, "20": [19, 20, 37, 58, 80, 83, 85, 93, 98, 104, 109, 110, 111, 112, 113], "tz": [20, 21, 22, 23, 92, 93, 94, 112], "posixlt": [20, 22, 23], "month": [20, 21, 22, 23, 26, 110], "week": [20, 23], "dai": [20, 21, 22, 23, 110, 112], "hour": [20, 21, 22, 23, 92, 93, 110], "minut": [20, 21, 22, 23], "millisecond": [20, 21, 22, 23, 66, 109, 113], "timezon": [20, 23, 92, 93, 94], "januari": [20, 22, 26], "februari": [20, 26], "28": [20, 22, 23, 26, 37, 93, 98, 110, 111, 112], "29": [20, 21, 23, 37, 46, 66, 93, 98, 108, 110, 112, 113], "datetim": [20, 21, 22, 23, 24, 25, 26, 92, 93, 94], "2024": [20, 21, 22, 85], "07": [20, 23, 93], "06": [20, 21, 85, 93], "11": [20, 22, 23, 26, 37, 46, 51, 56, 58, 59, 67, 71, 72, 80, 85, 93, 98, 103, 104, 107, 109, 110, 112, 113, 114], "01": [20, 21, 23, 25, 85, 92, 93, 96, 111], "45": [20, 37, 46, 93, 98, 110, 111], "cest": [20, 21, 23, 112], "05": [20, 21, 23, 85, 93, 111], "2014": [20, 37], "04": [20, 23, 93, 109], "hebrew": [20, 21, 22, 26, 30, 37, 98, 108, 112], "09": [20, 23, 93, 110, 111, 112], "2016": [20, 110], "02": [20, 21, 23, 93], "cet": [20, 21, 23, 93], "0l": [21, 66], "lenient": [21, 23], "1bce": 21, "2bce": 21, "fraction": [21, 23, 85, 113], "12": [21, 22, 23, 37, 51, 58, 59, 68, 85, 89, 90, 93, 98, 106, 109, 112, 113, 114], "23": [21, 23, 37, 46, 93, 98, 100, 109, 110, 113], "999": [21, 26, 37], "5775": 21, "nisan": [21, 22, 26, 112], "03": [21, 23, 37, 93], "15": [21, 23, 37, 46, 57, 58, 93, 98, 99, 106, 108, 110, 112, 113], "00": [21, 23, 25, 92, 93, 111], "attr": [22, 58, 113], "tzone": 22, "1bc": 22, "2bc": 22, "24": [22, 23, 37, 59, 93, 98, 109, 110, 111], "clock": [22, 23], "weekofyear": 22, "weekofmonth": 22, "dayofyear": 22, "dayofweek": 22, "sundai": [22, 26], "hour12": 22, "ampm": [22, 26], "era": [22, 23, 26, 113], "92": [22, 37, 93, 98, 109], "19": [22, 23, 26, 37, 46, 59, 83, 93, 98, 113], "5784": 22, "97": [22, 26, 37, 93, 98, 111], "35": [22, 37, 46, 59, 93, 98], "234": [22, 37, 93, 98], "vice": [23, 113], "versa": [23, 113], "uuuu": 23, "mm": [23, 24, 110, 112], "dd": [23, 24, 112], "ss": [23, 24, 59, 83, 95, 108, 112], "unspecifi": 23, "strftime": [23, 24, 112], "dt_style": 23, "dt_relative_styl": 23, "dt": 23, "medium": 23, "rel": [23, 81, 110, 112], "yy": [23, 46], "produc": [23, 44, 65, 107, 112], "wherea": [23, 109, 110, 113], "yyyi": [23, 24, 112], "abbrevi": [23, 26], "adjac": 23, "becom": [23, 78, 82, 105, 112], "gg": [23, 107], "ggg": 23, "gggg": 23, "anno": [23, 26], "domini": [23, 26], "ggggg": 23, "96": [23, 37, 56, 88, 93, 98], "1996": [23, 37], "4601": 23, "cyclic": 23, "lunar": 23, "quarter": [23, 26], "qq": 23, "qqq": 23, "q2": [23, 26], "qqqq": 23, "2nd": [23, 26, 58, 89, 90, 106, 107, 109, 113], "qqqqq": 23, "alon": [23, 108, 113], "mmm": 23, "mmmm": [23, 112], "septemb": [23, 26, 108], "mmmmm": 23, "lll": 23, "llll": 23, "lllll": 23, "ww": 23, "27": [23, 37, 46, 88, 93, 98, 110], "189": [23, 37, 93, 98], "wed": [23, 26], "juli": [23, 26], "julian": 23, "2451334": 23, "ee": [23, 56], "eee": 23, "tue": [23, 26], "eeee": 23, "tuesdai": [23, 26], "eeeee": [23, 106], "eeeeee": 23, "tu": 23, "mondai": [23, 26], "1st": [23, 26, 106, 107, 109, 110], "ccc": [23, 106, 109], "cccc": 23, "ccccc": 23, "cccccc": 23, "am": [23, 26, 56, 59, 83, 98, 113], "pm": [23, 26, 112], "marker": [23, 44, 73], "kk": [23, 56, 98], "truncat": [23, 69], "append": [23, 85, 108], "sss": 23, "235": [23, 26, 37, 85, 93, 98], "ssss": 23, "2350": 23, "61201235": 23, "zz": 23, "zzz": 23, "pdt": 23, "zzzz": 23, "pacif": [23, 93], "daylight": [23, 92, 93], "iso8601": 23, "hm": 23, "822": [23, 37], "0800": 23, "gmt": [23, 92, 93], "oooo": 23, "08": [23, 93], "xxxxx": 23, "zzzzz": 23, "pt": [23, 56], "vvvv": 23, "angel": 23, "id": [23, 56, 69, 92, 93, 96, 97, 107, 109, 112], "uslax": 23, "vv": 23, "america": [23, 93], "los_angel": [23, 93], "exemplar": 23, "citi": [23, 110], "vvv": 23, "0530": 23, "xx": [23, 85], "xxx": [23, 48, 101], "xxxx": 23, "075258": 23, "noth": [23, 105], "row": [23, 46, 47, 54, 58, 59, 60, 82, 83, 107, 109, 110], "real": [23, 85, 107, 108, 112, 113], "czw": 23, "gru": 23, "yyyyi": 23, "aaa": [23, 28, 46, 100, 109], "grudnia": [23, 26], "ssz": 23, "31t23": 23, "0100": [23, 92], "8601": 23, "guidelin": [23, 73, 84], "format_pars": [23, 26], "17": [23, 37, 46, 58, 93, 98, 110, 112, 113], "lipca": [23, 26], "date_long": [23, 112], "datetime_relative_medium": 23, "datetime_ful": 24, "date_relative_short": 24, "formatt": 24, "circumst": 24, "inconsist": 24, "1970": [25, 114], "utc": [25, 93], "leap": [25, 93], "weekdai": 26, "standalon": 26, "narrow": 26, "selector": 26, "dateformatsymbol": 26, "classicu_1_1dateformatsymbol": 26, "march": 26, "april": 26, "june": 26, "august": 26, "octob": 26, "novemb": 26, "decemb": 26, "wednesdai": 26, "thursdai": 26, "fridai": 26, "saturdai": 26, "4th": [26, 106, 109], "christ": 26, "tishri": [26, 112], "heshvan": [26, 112], "kislev": [26, 112], "tevet": [26, 112], "shevat": [26, 112], "adar": [26, 112], "iyar": [26, 112], "sivan": [26, 112], "tamuz": [26, 112], "av": [26, 112], "elul": [26, 112], "ii": [26, 56], "he_il": [26, 56], "\u05ea\u05e9\u05e8\u05d9": 26, "\u05d7\u05e9\u05d5\u05d5\u05df": 26, "\u05db\u05e1\u05dc\u05d5": 26, "\u05d8\u05d1\u05ea": 26, "\u05e9\u05d1\u05d8": 26, "\u05d0\u05d3\u05e8": 26, "\u05d0": 26, "\u05e0\u05d9\u05e1\u05df": 26, "\u05d0\u05d9\u05d9\u05e8": 26, "\u05e1\u05d9\u05d5\u05d5\u05df": 26, "\u05ea\u05de\u05d5\u05d6": 26, "\u05d0\u05d1": 26, "\u05d0\u05dc\u05d5\u05dc": 26, "\u05d1": 26, "\u05d9\u05d5\u05dd": 26, "\u05e8\u05d0\u05e9\u05d5\u05df": 26, "\u05e9\u05e0\u05d9": 26, "\u05e9\u05dc\u05d9\u05e9\u05d9": 26, "\u05e8\u05d1\u05d9\u05e2\u05d9": 26, "\u05d7\u05de\u05d9\u05e9\u05d9": 26, "\u05e9\u05d9\u05e9\u05d9": 26, "\u05e9\u05d1\u05ea": 26, "\u05e8\u05d1\u05e2\u05d5\u05df": 26, "\u05dc\u05e4\u05e0\u05d4": 26, "\u05e6": 26, "\u05d0\u05d7\u05d4": 26, "\u05dc\u05d1\u05e8\u05d9\u05d0\u05ea": 26, "\u05d4\u05e2\u05d5\u05dc\u05dd": 26, "muharram": 26, "safar": 26, "rabi\u02bb": 26, "jumada": 26, "rajab": 26, "sha\u02bbban": 26, "ramadan": 26, "shawwal": 26, "dhu\u02bbl": 26, "qi\u02bbdah": 26, "hijjah": 26, "ah": 26, "persian": [26, 98], "farvardin": 26, "ordibehesht": 26, "khordad": 26, "tir": 26, "mordad": 26, "shahrivar": 26, "mehr": 26, "aban": 26, "azar": 26, "dei": 26, "bahman": 26, "esfand": 26, "ap": 26, "indian": [26, 93], "chaitra": 26, "vaisakha": 26, "jyaistha": 26, "asadha": 26, "sravana": 26, "bhadra": 26, "asvina": 26, "kartika": 26, "agrahayana": 26, "pausa": 26, "magha": 26, "phalguna": 26, "saka": 26, "coptic": 26, "tout": 26, "baba": 26, "hator": 26, "kiahk": 26, "toba": 26, "amshir": 26, "baramhat": 26, "baramouda": 26, "bashan": 26, "paona": 26, "epep": 26, "mesra": 26, "nasi": 26, "era0": 26, "era1": 26, "taika": 26, "645": [26, 37, 98], "650": [26, 37, 98, 111], "hakuchi": 26, "671": [26, 37, 56, 98], "hakuh\u014d": 26, "672": [26, 37, 98], "686": [26, 37, 56, 98], "shuch\u014d": 26, "701": [26, 37, 56, 98], "taih\u014d": 26, "704": [26, 37, 98, 114], "keiun": 26, "708": [26, 37, 98], "wad\u014d": 26, "715": [26, 37, 98], "reiki": 26, "717": [26, 37, 98], "y\u014dr\u014d": 26, "724": [26, 37, 98], "jinki": 26, "729": [26, 37, 98], "tenpy\u014d": 26, "749": [26, 37, 98], "kamp\u014d": 26, "sh\u014dh\u014d": 26, "757": [26, 37], "h\u014dji": 26, "765": [26, 37], "jingo": 26, "767": [26, 37], "770": [26, 37], "h\u014dki": 26, "780": [26, 37], "ten": 26, "\u014d": 26, "781": [26, 37, 56], "782": [26, 37], "enryaku": 26, "806": [26, 37, 56], "daid\u014d": 26, "810": [26, 37], "k\u014dnin": 26, "824": [26, 37], "22": [26, 37, 58, 93, 98, 110, 113], "tench\u014d": 26, "834": [26, 37, 109], "j\u014dwa": 26, "848": [26, 37], "kaj\u014d": 26, "851": [26, 37, 56], "25": [26, 37, 46, 51, 67, 72, 80, 83, 93, 98, 110, 111], "ninju": 26, "854": [26, 37], "saik\u014d": 26, "857": [26, 37], "859": [26, 37], "j\u014dgan": 26, "877": [26, 37], "gangy\u014d": 26, "885": [26, 37], "ninna": 26, "889": [26, 37], "kanpy\u014d": 26, "898": [26, 37], "sh\u014dtai": 26, "901": [26, 37], "engi": 26, "923": [26, 37], "34": [26, 37, 93, 98, 113], "ench\u014d": 26, "931": [26, 37], "j\u014dhei": 26, "938": [26, 37], "tengy\u014d": 26, "947": [26, 37], "37": [26, 37, 46, 59, 83, 93, 98, 113], "tenryaku": 26, "957": [26, 37], "tentoku": 26, "961": [26, 37], "\u014dwa": 26, "964": [26, 37], "40": [26, 37, 59, 93, 98, 109, 110, 114], "k\u014dh\u014d": 26, "968": [26, 37], "anna": 26, "970": [26, 37], "tenroku": 26, "973": [26, 37], "43": [26, 37, 46, 93, 98, 111], "976": [26, 37], "j\u014dgen": 26, "978": [26, 37, 114], "tengen": 26, "983": [26, 37], "eikan": 26, "985": [26, 37], "kanna": 26, "987": [26, 37], "eien": 26, "989": [26, 37], "49": [26, 37, 46, 93, 98, 109, 110], "eiso": 26, "990": [26, 37], "sh\u014dryaku": 26, "995": [26, 37, 109], "ch\u014dtoku": 26, "ch\u014dh\u014d": 26, "1004": [26, 37], "kank\u014d": 26, "1012": [26, 37], "ch\u014dwa": 26, "1017": [26, 37], "kannin": 26, "1021": [26, 37], "jian": 26, "1024": [26, 37], "manju": 26, "1028": [26, 37], "ch\u014dgen": 26, "1037": [26, 37], "ch\u014dryaku": 26, "1040": [26, 37], "ch\u014dky\u016b": 26, "1044": [26, 37], "kantoku": 26, "1046": [26, 37], "eish\u014d": 26, "1053": [26, 37], "tengi": 26, "1058": [26, 37], "64": [26, 37, 93, 98], "k\u014dhei": 26, "1065": [26, 37], "jiryaku": 26, "1069": [26, 37], "enky\u016b": 26, "1074": [26, 37], "67": [26, 37, 44, 46, 73, 93, 98, 111], "sh\u014dho": 26, "1077": [26, 37], "1081": [26, 37], "eih\u014d": 26, "1084": [26, 37], "70": [26, 37, 93, 98, 109, 110], "\u014dtoku": 26, "1087": [26, 37], "kanji": 26, "1094": [26, 37], "kah\u014d": 26, "1096": [26, 37], "eich\u014d": 26, "1097": [26, 37], "j\u014dtoku": 26, "1099": [26, 37], "k\u014dwa": 26, "1104": [26, 37], "76": [26, 37, 56, 93, 98], "ch\u014dji": 26, "1106": [26, 37], "kash\u014d": 26, "1108": [26, 37], "tennin": 26, "1110": [26, 37], "79": [26, 37, 46, 59, 85, 93, 98], "ei": 26, "1113": [26, 37], "eiky\u016b": 26, "1118": [26, 37], "gen": 26, "1120": [26, 37], "82": [26, 37, 59, 93, 98], "h\u014dan": 26, "1124": [26, 37], "tenji": 26, "1126": [26, 37], "daiji": 26, "1131": [26, 37], "85": [26, 36, 37, 46, 84, 93, 98, 110, 111], "tensh\u014d": 26, "1132": [26, 37], "ch\u014dsh\u014d": 26, "1135": [26, 37], "h\u014den": 26, "1141": [26, 37], "eiji": 26, "1142": [26, 37], "k\u014dji": 26, "1144": [26, 37], "y\u014d": 26, "1145": [26, 37], "ky\u016ban": 26, "1151": [26, 37], "ninpei": 26, "1154": [26, 37], "ky\u016bju": 26, "1156": [26, 37], "h\u014dgen": 26, "1159": [26, 37], "heiji": 26, "1160": [26, 37], "eiryaku": 26, "1161": [26, 37], "\u014dho": 26, "1163": [26, 37], "ch\u014dkan": 26, "1165": [26, 37], "eiman": 26, "1166": [26, 37], "nin": 26, "1169": [26, 37], "ka\u014d": 26, "1171": [26, 37], "sh\u014dan": 26, "1175": [26, 37], "angen": 26, "1177": [26, 37], "jish\u014d": 26, "1181": [26, 37], "y\u014dwa": 26, "1182": [26, 37], "juei": 26, "1184": [26, 37, 104, 114], "genryaku": 26, "1185": [26, 37], "bunji": 26, "1190": [26, 37], "kenky\u016b": 26, "1199": [26, 37], "sh\u014dji": 26, "1201": [26, 37], "kennin": 26, "1204": [26, 37], "genky\u016b": 26, "1206": 26, "ken": 26, "1207": 26, "1211": 26, "115": [26, 37, 93, 98, 110], "kenryaku": 26, "1213": [26, 37], "kenp\u014d": 26, "1219": 26, "j\u014dky\u016b": 26, "1222": 26, "j\u014d\u014d": 26, "1224": 26, "gennin": 26, "1225": 26, "karoku": 26, "1227": 26, "121": [26, 37, 56, 93, 98], "antei": 26, "1229": 26, "kanki": 26, "1232": [26, 37], "j\u014dei": 26, "1233": [26, 37], "tenpuku": 26, "1234": [26, 37, 76], "bunryaku": 26, "1235": [26, 37], "katei": 26, "1238": 26, "ryakunin": 26, "1239": 26, "1240": 26, "ninji": 26, "1243": 26, "130": [26, 37, 93, 98], "kangen": 26, "1247": 26, "1249": 26, "kench\u014d": 26, "1256": [26, 30, 37], "k\u014dgen": 26, "1257": [26, 37], "sh\u014dka": 26, "1259": 26, "sh\u014dgen": 26, "1260": 26, "136": [26, 37, 56, 93, 98], "bun": 26, "1261": 26, "k\u014dch\u014d": 26, "1264": 26, "1275": 26, "kenji": 26, "1278": 26, "k\u014dan": 26, "1288": 26, "sh\u014d\u014d": 26, "1293": 26, "142": [26, 37, 85, 87, 93, 98, 112], "einin": 26, "1299": 26, "1302": 26, "kengen": 26, "1303": 26, "145": [26, 37, 93, 98], "kagen": 26, "1306": 26, "tokuji": 26, "1308": 26, "enky\u014d": 26, "1311": 26, "148": [26, 37, 93, 98], "\u014dch\u014d": 26, "1312": 26, "sh\u014dwa": 26, "1317": 26, "bunp\u014d": 26, "1319": 26, "151": [26, 37, 56, 93, 98], "gen\u014d": 26, "1321": 26, "genk\u014d": 26, "1324": 26, "sh\u014dch\u016b": 26, "1326": 26, "karyaku": 26, "1329": 26, "gentoku": 26, "1331": 26, "1334": 26, "kenmu": 26, "1336": 26, "engen": 26, "1340": 26, "k\u014dkoku": 26, "1346": 26, "160": [26, 37, 93, 98], "sh\u014dhei": 26, "1370": 26, "kentoku": 26, "1372": 26, "bunch\u016b": 26, "1375": [26, 37], "163": [26, 37, 87, 93, 98], "tenju": 26, "1379": 26, "k\u014dryaku": 26, "1381": 26, "1384": 26, "166": [26, 37, 56, 93, 98], "gench\u016b": 26, "1392": [26, 37], "meitoku": 26, "1387": 26, "kakei": 26, "1389": 26, "k\u014d\u014d": 26, "1390": [26, 37], "1394": 26, "\u014dei": 26, "1428": 26, "172": [26, 37, 93, 98], "sh\u014dch\u014d": 26, "1429": 26, "eiky\u014d": 26, "1441": 26, "kakitsu": 26, "1444": 26, "1449": 26, "h\u014dtoku": 26, "1452": 26, "ky\u014dtoku": 26, "1455": 26, "178": [26, 37, 93, 98, 110], "k\u014dsh\u014d": 26, "1457": 26, "ch\u014droku": 26, "1460": 26, "kansh\u014d": 26, "1466": 26, "181": [26, 37, 56, 93, 98], "bunsh\u014d": 26, "1467": 26, "\u014dnin": 26, "1469": 26, "bunmei": 26, "1487": 26, "184": [26, 37, 93, 98], "ch\u014dky\u014d": 26, "1489": 26, "entoku": 26, "1492": 26, "mei\u014d": 26, "1501": 26, "bunki": 26, "1504": 26, "1521": 26, "taiei": 26, "1528": 26, "190": [26, 37, 69, 93, 98], "ky\u014droku": 26, "1532": 26, "tenbun": 26, "1555": 26, "1558": 26, "eiroku": 26, "1570": 26, "genki": 26, "1573": 26, "1592": 26, "196": [26, 37, 56, 93, 98], "bunroku": 26, "1596": 26, "keich\u014d": 26, "1615": 26, "genna": 26, "1624": 26, "kan": 26, "1644": 26, "1648": 26, "keian": 26, "1652": 26, "202": [26, 37, 93, 98], "1655": 26, "meireki": 26, "1658": 26, "manji": 26, "1661": 26, "kanbun": 26, "1673": 26, "enp\u014d": 26, "1681": 26, "tenna": 26, "1684": 26, "208": [26, 37, 93, 98], "j\u014dky\u014d": 26, "1688": 26, "genroku": 26, "1704": 26, "h\u014dei": 26, "1711": 26, "211": [26, 37, 56, 93, 98], "sh\u014dtoku": 26, "1716": 26, "ky\u014dh\u014d": 26, "1736": 26, "genbun": 26, "1741": 26, "kanp\u014d": 26, "1744": 26, "1748": 26, "1751": 26, "217": [26, 37, 93, 98], "h\u014dreki": 26, "1764": 26, "meiwa": 26, "1772": 26, "1781": [26, 111], "tenmei": 26, "1789": 26, "kansei": 26, "1801": 26, "ky\u014dwa": 26, "1804": 26, "223": [26, 37, 93, 98], "bunka": 26, "1818": 26, "bunsei": 26, "1830": 26, "tenp\u014d": 26, "1844": 26, "226": [26, 37, 56, 93, 98], "k\u014dka": 26, "1848": 26, "kaei": 26, "1854": 26, "ansei": 26, "1860": 26, "229": [26, 37, 93, 98], "1861": 26, "bunky\u016b": 26, "1864": 26, "genji": 26, "1865": 26, "kei\u014d": 26, "1868": 26, "meiji": 26, "taish\u014d": 26, "heisei": 26, "reiwa": 26, "ja_jp_tradit": 26, "1\u6708": 26, "2\u6708": 26, "3\u6708": 26, "4\u6708": 26, "5\u6708": 26, "6\u6708": 26, "7\u6708": 26, "8\u6708": 26, "9\u6708": 26, "10\u6708": 26, "11\u6708": 26, "12\u6708": 26, "\u65e5\u66dc\u65e5": 26, "\u6708\u66dc\u65e5": 26, "\u706b\u66dc\u65e5": 26, "\u6c34\u66dc\u65e5": 26, "\u6728\u66dc\u65e5": 26, "\u91d1\u66dc\u65e5": 26, "\u571f\u66dc\u65e5": 26, "\u7b2c1\u56db\u534a\u671f": 26, "\u7b2c2\u56db\u534a\u671f": 26, "\u7b2c3\u56db\u534a\u671f": 26, "\u7b2c4\u56db\u534a\u671f": 26, "\u5348\u524d": 26, "\u5348\u5f8c": 26, "\u7d00\u5143\u524d": 26, "\u897f\u66a6": 26, "th_th_tradit": 26, "buddhist": 26, "\u0e21\u0e01\u0e23\u0e32\u0e04\u0e21": 26, "\u0e01": 26, "\u0e21\u0e20\u0e32\u0e1e": 26, "\u0e19\u0e18": 26, "\u0e21": 26, "\u0e19\u0e32\u0e04\u0e21": 26, "\u0e40\u0e21\u0e29\u0e32\u0e22\u0e19": 26, "\u0e1e\u0e24\u0e29\u0e20\u0e32\u0e04\u0e21": 26, "\u0e16": 26, "\u0e19\u0e32\u0e22\u0e19": 26, "\u0e01\u0e23\u0e01\u0e0e\u0e32\u0e04\u0e21": 26, "\u0e2a": 26, "\u0e07\u0e2b\u0e32\u0e04\u0e21": 26, "\u0e19\u0e22\u0e32\u0e22\u0e19": 26, "\u0e15": 26, "\u0e25\u0e32\u0e04\u0e21": 26, "\u0e1e\u0e24\u0e28\u0e08": 26, "\u0e01\u0e32\u0e22\u0e19": 26, "\u0e18": 26, "\u0e19\u0e27\u0e32\u0e04\u0e21": 26, "\u0e27": 26, "\u0e19\u0e2d\u0e32\u0e17": 26, "\u0e15\u0e22": 26, "\u0e19\u0e08": 26, "\u0e19\u0e17\u0e23": 26, "\u0e19\u0e2d": 26, "\u0e07\u0e04\u0e32\u0e23": 26, "\u0e19\u0e1e": 26, "\u0e19\u0e1e\u0e24\u0e2b": 26, "\u0e2a\u0e1a\u0e14": 26, "\u0e19\u0e28": 26, "\u0e01\u0e23": 26, "\u0e19\u0e40\u0e2a\u0e32\u0e23": 26, "\u0e44\u0e15\u0e23\u0e21\u0e32\u0e2a": 26, "\u0e2d\u0e19\u0e40\u0e17": 26, "\u0e22\u0e07": 26, "\u0e2b\u0e25": 26, "\u0e07\u0e40\u0e17": 26, "\u0e1b": 26, "\u0e2d\u0e19\u0e04\u0e23": 26, "\u0e2a\u0e15\u0e01\u0e32\u0e25": 26, "\u0e04\u0e23": 26, "\u0e2a\u0e15": 26, "\u0e28": 26, "\u0e01\u0e23\u0e32\u0e0a": 26, "stycznia": 26, "lutego": 26, "marca": 26, "kwietnia": 26, "maja": 26, "czerwca": 26, "sierpnia": 26, "wrze\u015bnia": [26, 112], "pa\u017adziernika": 26, "listopada": 26, "niedziela": 26, "poniedzia\u0142ek": 26, "wtorek": 26, "\u015broda": 26, "czwartek": 26, "pi\u0105tek": 26, "sobota": 26, "kwarta\u0142": 26, "iii": 26, "iv": 26, "przed": 26, "nasz\u0105": 26, "er\u0105": 26, "naszej": 26, "eri": 26, "stycze\u0144": 26, "luti": 26, "marzec": 26, "kwiecie\u0144": 26, "maj": 26, "czerwiec": 26, "lipiec": 26, "sierpie\u0144": 26, "wrzesie\u0144": 26, "pa\u017adziernik": 26, "listopad": 26, "grudzie\u0144": 26, "jan": [26, 110], "feb": [26, 110], "mar": [26, 110], "apr": [26, 110], "aug": [26, 110], "sept": 26, "oct": [26, 110], "nov": [26, 110], "dec": [26, 110], "mon": 26, "fri": 26, "sat": [26, 56, 98], "q1": 26, "q3": 26, "q4": 26, "bc": [26, 109], "stri_detect_fix": [27, 65, 107, 110], "stri_detect_charclass": 27, "stri_detect_col": [27, 64, 108], "rather": [27, 44, 66, 68, 86, 91, 99, 107], "inspect": 27, "sting": 27, "uninspect": 27, "singleton": 27, "consecut": [27, 46, 58, 76, 104], "alpha": [27, 109], "zc1": 27, "def": [27, 107, 109], "ghi": [27, 109], "456": [27, 37, 52, 56, 76, 83, 93, 98], "789": [27, 37, 52, 76, 83, 85, 89, 90], "jkl": 27, "aa": [28, 46, 106], "aaaa": [28, 46, 76, 113], "aaaaa": 28, "ba": [28, 56, 86, 113], "babababa": 28, "pqrst": 28, "abcabcabcabc": 28, "pqrstpqrst": 28, "unlik": [29, 38, 42, 102, 106, 107], "anydupl": 29, "bytewis": [29, 64, 102, 111], "henc": [29, 85, 91, 102, 106, 107, 108, 109, 110, 113], "significantli": [29, 102], "suit": [29, 102], "counterpart": [29, 102, 108, 109], "found": [29, 40, 44, 46, 58, 107, 109, 113], "gro": [29, 97, 102, 108], "gross": [29, 97, 102, 107, 108, 112, 113], "filter_angle_bracket": 30, "filter": [30, 83, 106], "xml": [30, 37, 98], "markup": 30, "readlin": [30, 73, 87, 88, 111], "fact": [30, 37, 109], "imag": 30, "heurist": [30, 31, 111], "mostli": [30, 113], "limit": [30, 66, 107, 108, 109, 113], "along": 30, "techniqu": 30, "legibl": 30, "interfer": 30, "main": 30, "tabl": [30, 107, 108, 110, 113], "show": 30, "character_set": 30, "16be": [30, 31, 35, 37, 111], "16le": [30, 31, 35, 37, 111], "32be": [30, 31, 35, 37], "32le": [30, 31, 35, 37], "shift_ji": [30, 37], "jp": [30, 37], "kr": [30, 37], "gb18030": [30, 37], "big5": [30, 37], "tradit": [30, 66, 98, 108, 113], "euc": [30, 37], "danish": 30, "dutch": [30, 112], "italian": 30, "norwegian": 30, "portugues": 30, "swedish": 30, "czech": 30, "hungarian": 30, "romanian": 30, "russian": [30, 93, 98], "arab": [30, 37, 93, 98, 112], "turkish": [30, 37, 112], "1250": [30, 36, 37, 109, 111], "1251": [30, 37], "1253": [30, 37], "1254": [30, 37], "1255": [30, 37], "koi8": [30, 37], "ibm420": [30, 37], "ibm424": [30, 37], "guess": [30, 31, 111], "confid": [30, 31, 111], "higher": [30, 31, 109], "decreas": [30, 31, 67, 80], "Not": [30, 46, 57, 62, 76, 89, 94, 109], "rawtochar": [30, 44], "readbin": 30, "100000": [30, 109], "roughli": [31, 42, 77, 91, 103], "csrucod": 31, "greatest": 31, "hit": 31, "vec": [32, 56, 98, 110], "inttoutf8": 32, "dual": [32, 42, 112], "ill": [32, 40, 42, 101, 113], "decod": [32, 97], "arbitrari": [32, 86, 100, 113], "enc": [33, 39], "mime": 33, "utr22": 33, "iana": 33, "unavail": [33, 56, 60, 108], "1to1": 33, "charsiz": 33, "8bit": 33, "min": [33, 72, 109, 110], "max": [33, 85, 109, 110], "uchar": 33, "uchar32": 33, "maxim": [33, 44, 66, 73, 82, 83, 104, 111, 113], "u0104": [34, 36, 50, 53, 62, 95, 97, 109], "stri_enc_isutf16l": 35, "stri_enc_isutf32b": 35, "stri_enc_isutf32l": 35, "sure": [35, 109], "classifi": 35, "proper": 36, "certainli": 36, "c4": [36, 111], "umlaut": 36, "impli": 36, "inde": 36, "u1234": 36, "u0222": 36, "entri": [37, 66, 112], "037": 37, "273": [37, 93, 98], "277": [37, 93, 98], "278": [37, 93, 98], "280": [37, 93, 98], "284": [37, 93, 98], "297": [37, 93, 98], "424": [37, 93, 98], "437": [37, 93, 98], "500": [37, 93, 98], "646": [37, 56, 98], "14": [37, 58, 71, 93, 98, 109, 112, 113], "737": [37, 98], "775": 37, "813": 37, "819": 37, "838": 37, "850": 37, "852": 37, "855": 37, "856": 37, "860": 37, "26": [37, 56, 58, 93, 98, 110], "861": 37, "862": 37, "863": 37, "865": 37, "30": [37, 93, 98, 109, 111, 113], "866": 37, "868": 37, "869": 37, "33": [37, 46, 59, 93, 98, 110], "871": 37, "875": 37, "912": 37, "36": [37, 56, 93, 98, 110, 111], "913": 37, "914": 37, "915": 37, "916": 37, "920": 37, "921": 37, "42": [37, 59, 93, 98], "922": 37, "930": 37, "933": 37, "935": 37, "47": [37, 46, 59, 93, 98, 110, 113], "937": 37, "48": [37, 47, 93, 98], "939": 37, "943": 37, "949": 37, "51": [37, 46, 56, 93, 98, 110], "950": 37, "53": [37, 46, 59, 85, 93, 98], "54": [37, 85, 93, 98, 109, 111], "1006": 37, "1025": 37, "56": [37, 56, 59, 83, 93, 98], "1026": 37, "1047": 37, "1089": 37, "60": [37, 93, 98, 111], "1098": 37, "1112": 37, "62": [37, 59, 93, 98, 111], "1122": 37, "1123": 37, "65": [37, 46, 59, 93, 98, 110, 111], "1383": 37, "66": [37, 56, 93, 98, 110], "5601": 37, "8859_1": 37, "68": [37, 59, 93, 98], "8859_2": 37, "8859_3": 37, "8859_4": 37, "71": [37, 46, 56, 85, 93, 98, 109], "8859_5": 37, "8859_6": 37, "8859_7": 37, "8859_8": 37, "75": [37, 46, 59, 93, 98, 111], "8859_9": 37, "8859_13": 37, "8859_15": 37, "78": [37, 93, 98, 109], "33722": 37, "adob": 37, "80": [37, 69, 93, 98, 110], "ansi_x3": 37, "1968": 37, "81": [37, 46, 56, 93, 98, 111], "1986": 37, "ansi1251": 37, "84": [37, 93, 98, 109], "ascii7": 37, "asmo": 37, "hksc": 37, "89": [37, 46, 85, 93, 98, 109], "unicode3": 37, "90": [37, 93, 98, 109, 110], "big5hk": 37, "bocu": 37, "ccsid00858": 37, "93": [37, 93, 98], "ccsid01140": 37, "ccsid01141": 37, "95": [37, 85, 93, 98], "ccsid01142": 37, "ccsid01143": 37, "ccsid01144": 37, "ccsid01145": 37, "ccsid01146": 37, "ccsid01147": 37, "101": [37, 56, 67, 72, 80, 93, 98], "ccsid01148": 37, "ccsid01149": 37, "cesu": 37, "104": [37, 93, 98, 109], "cns11643": 37, "compound_text": 37, "cp": [37, 109], "gr": 37, "cp037": 37, "cp37": 37, "cp273": 37, "113": [37, 93, 98], "cp277": 37, "cp278": 37, "cp280": 37, "cp284": 37, "cp285": 37, "cp290": 37, "cp297": 37, "cp367": 37, "cp420": 37, "cp424": 37, "cp437": 37, "cp500": 37, "125": [37, 93, 98, 114], "cp737": 37, "cp775": 37, "cp803": 37, "cp813": 37, "cp819": 37, "cp838": 37, "131": [37, 56, 93, 98], "cp850": 37, "cp851": 37, "cp852": 37, "cp855": 37, "cp856": 37, "cp857": 37, "cp00858": 37, "cp858": 37, "cp860": 37, "140": [37, 93, 98, 111], "cp861": 37, "cp862": 37, "cp863": 37, "cp864": 37, "cp865": 37, "cp866": 37, "146": [37, 56, 93, 98], "cp868": 37, "147": [37, 93, 98], "cp869": 37, "cp870": 37, "cp871": 37, "150": [37, 93, 98], "cp874": 37, "cp875": 37, "152": [37, 93, 98], "cp878": 37, "cp912": 37, "cp913": 37, "155": [37, 93, 98], "cp914": 37, "156": [37, 56, 93, 98], "cp915": 37, "cp916": 37, "158": [37, 93, 98], "cp918": 37, "159": [37, 93, 98], "cp920": 37, "cp921": 37, "161": [37, 56, 93, 98], "cp922": 37, "162": [37, 93, 98], "cp923": 37, "cp930": 37, "cp932": 37, "cp933": 37, "cp935": 37, "167": [37, 93, 98], "cp936": 37, "cp937": 37, "cp939": 37, "cp943": 37, "171": [37, 56, 93, 98, 109], "cp943c": 37, "cp949": 37, "173": [37, 93, 98], "cp949c": 37, "cp950": 37, "cp964": 37, "cp970": 37, "cp1006": 37, "cp1025": 37, "179": [37, 93, 98], "cp1026": 37, "cp1047": 37, "cp1089": 37, "182": [37, 93, 98, 109], "cp1097": 37, "cp1098": 37, "cp1112": 37, "185": [37, 93, 98], "cp1122": 37, "186": [37, 56, 93, 98], "cp1123": 37, "cp1124": 37, "cp1125": 37, "cp1131": 37, "cp01140": 37, "191": [37, 56, 93, 98, 110], "cp1140": 37, "192": [37, 93, 98], "cp01141": 37, "cp1141": 37, "194": [37, 93, 98], "cp01142": 37, "195": [37, 93, 98], "cp1142": 37, "cp01143": 37, "197": [37, 93, 98], "cp1143": 37, "198": [37, 93, 98], "cp01144": 37, "cp1144": 37, "200": [37, 93, 98], "cp01145": 37, "201": [37, 56, 93, 98], "cp1145": 37, "cp01146": 37, "203": [37, 93, 98], "cp1146": 37, "204": [37, 93, 98], "cp01147": 37, "cp1147": 37, "206": [37, 56, 93, 98], "cp01148": 37, "cp1148": 37, "cp01149": 37, "209": [37, 93, 98], "cp1149": 37, "cp1200": 37, "cp1201": 37, "212": [37, 93, 98], "cp1208": 37, "213": [37, 93, 98], "cp1250": 37, "cp1251": 37, "215": [37, 93, 98], "cp1252": 37, "cp1253": 37, "cp1254": 37, "218": [37, 93, 98], "cp1255": 37, "cp1256": 37, "cp1257": 37, "221": [37, 56, 93, 98], "cp1258": 37, "222": [37, 93, 98], "cp1363": 37, "cp1383": 37, "224": [37, 93, 98], "cp1386": 37, "225": [37, 93, 98], "cp33722": 37, "cpibm37": 37, "cpibm284": 37, "228": [37, 93, 98, 109], "cpibm285": 37, "cpibm297": 37, "csadobestandardencod": 37, "csascii": 37, "csbig5": 37, "233": [37, 93, 98], "csbocu": 37, "cseuckr": 37, "cseucpkdfmtjapanes": 37, "236": [37, 56, 93, 98], "csgb2312": 37, "237": [37, 93, 98], "cshproman8": 37, "csibm037": 37, "239": [37, 93, 98], "csibm273": 37, "240": [37, 93, 98], "csibm277": 37, "241": [37, 56, 93, 98], "csibm278": 37, "csibm280": 37, "243": [37, 93, 98, 109], "csibm284": 37, "244": [37, 93, 98], "csibm285": 37, "245": [37, 93, 98], "csibm290": 37, "246": [37, 56, 93, 98], "csibm297": 37, "247": [37, 93, 98], "csibm420": 37, "248": [37, 93, 98], "csibm424": 37, "249": [37, 93, 98], "csibm500": 37, "250": [37, 93, 98, 109], "csibm855": 37, "251": [37, 56, 93, 98], "csibm857": 37, "252": [37, 93, 98], "csibm860": 37, "csibm861": 37, "csibm863": 37, "255": [37, 93, 98, 111], "csibm864": 37, "256": [37, 56, 93, 98], "csibm865": 37, "257": [37, 93, 98], "csibm866": 37, "csibm868": 37, "259": [37, 93, 98], "csibm869": 37, "260": [37, 93, 98], "csibm870": 37, "261": [37, 56, 93, 98, 109, 111], "csibm871": 37, "262": [37, 93, 98, 109], "csibm918": 37, "csibm1026": 37, "264": [37, 93, 98], "csibmthai": 37, "265": [37, 93, 98, 109], "csiso58gb231280": 37, "csiso2022cn": 37, "csiso2022jp": 37, "268": [37, 93, 98], "csiso2022jp2": 37, "269": [37, 93, 98], "csiso2022kr": 37, "csisolatin0": 37, "271": [37, 56, 93, 98], "csisolatin1": 37, "272": [37, 93, 98], "csisolatin2": 37, "csisolatin3": 37, "274": [37, 93, 98], "csisolatin4": 37, "275": [37, 93, 98], "csisolatin5": 37, "276": [37, 56, 93, 98], "csisolatin6": 37, "csisolatin9": 37, "csisolatinarab": 37, "279": [37, 93, 98, 110], "csisolatincyril": 37, "csisolatingreek": 37, "281": [37, 56, 93, 98], "csisolatinhebrew": 37, "282": [37, 93, 98], "csjisencod": 37, "283": [37, 93, 98], "cskoi8r": 37, "csksc56011987": 37, "csmacintosh": 37, "286": [37, 56, 93, 98], "cspc8codepage437": 37, "287": [37, 93, 98], "cspc775baltic": 37, "cspc850multilingu": 37, "cspc851": 37, "290": [37, 93, 98], "cspc862latinhebrew": 37, "291": [37, 56, 93, 98], "cspcp852": 37, "292": [37, 93, 98], "cspcp855": 37, "293": [37, 93, 98], "csshiftji": 37, "294": [37, 93, 98], "csucs4": 37, "295": [37, 93, 98], "csunicod": 37, "cswindows31j": 37, "298": [37, 93, 98], "720": [37, 98], "299": [37, 93, 98], "300": [37, 93, 98], "ebcdic": 37, "301": [37, 56, 93, 98], "ar1": 37, "302": [37, 93, 98], "ar2": 37, "303": [37, 93, 98], "304": [37, 93, 98], "ca": [37, 56, 69, 114], "305": [37, 93, 98], "306": [37, 56, 93, 98], "dk": 37, "307": [37, 93, 98], "308": [37, 93, 98], "fi": [37, 56], "309": [37, 93, 98], "310": [37, 93, 98], "gb": [37, 44, 73, 93], "311": [37, 56, 93, 98], "he": [37, 56, 98], "312": [37, 93, 98], "313": [37, 93, 98], "315": [37, 93, 98], "NO": [37, 95], "316": [37, 56, 93, 98], "roec": 37, "se": [37, 56, 93, 107], "wt": 37, "320": [37, 93, 98], "yu": 37, "321": [37, 56, 79, 93, 98], "322": [37, 93, 98], "323": [37, 93, 98, 114], "324": [37, 93, 98], "326": [37, 56, 93, 98], "327": [37, 93, 98], "328": [37, 93, 98, 114], "329": [37, 93, 98], "330": [37, 93, 98, 109], "331": [37, 56, 93, 98], "332": [37, 93, 98], "333": [37, 93, 98], "kana": [37, 63, 98, 112], "336": [37, 56, 93, 98], "sv": [37, 56], "339": [37, 93, 98], "340": [37, 93, 98], "ecma": 37, "342": [37, 93, 98, 109], "elot_928": 37, "346": [37, 56, 93, 98, 114], "2007": 37, "349": [37, 93, 98], "tw": 37, "350": [37, 93, 98, 114], "351": [37, 56, 93, 98], "eucji": 37, "352": [37, 93, 98], "eucth": 37, "353": [37, 93, 98], "extended_unix_code_packed_format_for_japanes": 37, "gb_2312": 37, "gb2312": 37, "356": [37, 56, 93, 98], "1980": 37, "357": [37, 93, 98], "358": [37, 93, 98], "359": [37, 93, 98], "360": [37, 93, 98], "gbk": 37, "361": [37, 56, 93, 98], "greek8": 37, "gsm": 37, "2009": 37, "gsm0338": 37, "365": [37, 93, 98, 110], "hebrew8": 37, "367": [37, 93, 98], "hkbig5": 37, "368": [37, 93, 98], "hp": 37, "roman8": 37, "hp15cn": 37, "371": [37, 56, 93, 98], "hz": 37, "2312": 37, "373": [37, 93, 98], "374": [37, 93, 98], "375": [37, 93, 98], "37_p100": 37, "1995": 37, "376": [37, 56, 93, 98], "swaplfnl": 37, "377": [37, 93, 98], "s390": 37, "378": [37, 93, 98], "379": [37, 93, 98], "273_p100": 37, "380": [37, 93, 98], "381": [37, 56, 93, 98], "277_p100": 37, "383": [37, 93, 98], "278_p100": 37, "384": [37, 93, 98], "385": [37, 93, 98], "280_p100": 37, "387": [37, 93, 98], "284_p100": 37, "388": [37, 93, 98], "389": [37, 85, 93, 98], "285_p100": 37, "390": [37, 93, 98], "391": [37, 56, 93, 98], "290_p100": 37, "392": [37, 93, 98], "297_p100": 37, "394": [37, 93, 98], "395": [37, 93, 98], "396": [37, 56, 93, 98], "420_x120": 37, "424_p100": 37, "437_p100": 37, "402": [37, 93, 98], "500_p100": 37, "403": [37, 93, 98], "404": [37, 93, 98], "720_p100": 37, "1997": 37, "405": [37, 93, 98], "406": [37, 56, 93, 98], "737_p100": 37, "407": [37, 93, 98], "775_p100": 37, "409": [37, 93, 98], "803": 37, "410": [37, 93, 98, 109], "803_p100": 37, "411": [37, 56, 93, 98], "412": [37, 93, 98], "813_p100": 37, "413": [37, 93, 98], "838_p100": 37, "416": [37, 56, 93, 98], "417": [37, 93, 98], "850_p100": 37, "418": [37, 93, 98], "419": [37, 93, 98], "851_p100": 37, "852_p100": 37, "422": [37, 93, 98], "423": [37, 93, 98], "855_p100": 37, "856_p100": 37, "426": [37, 56, 93, 98], "427": [37, 93, 98], "857_p100": 37, "858": 37, "858_p100": 37, "430": [37, 93, 98], "860_p100": 37, "432": [37, 93, 98], "433": [37, 93, 98], "861_p100": 37, "435": [37, 93, 98], "862_p100": 37, "436": [37, 56, 93, 98], "863_p100": 37, "864": 37, "439": [37, 93, 98], "864_x110": 37, "440": [37, 93, 98], "441": [37, 56, 93, 98], "865_p100": 37, "442": [37, 93, 98], "443": [37, 93, 98], "866_p100": 37, "444": [37, 93, 98], "867": 37, "445": [37, 93, 98], "867_p100": 37, "1998": 37, "446": [37, 56, 93, 98], "447": [37, 93, 98], "868_p100": 37, "448": [37, 93, 98], "869_p100": 37, "450": [37, 93, 98], "870": [37, 85], "451": [37, 56, 93, 98], "870_p100": 37, "452": [37, 93, 98], "453": [37, 93, 98], "871_p100": 37, "454": [37, 93, 98], "874": 37, "455": [37, 93, 98], "874_p100": 37, "875_p100": 37, "878": 37, "459": [37, 93, 98], "878_p100": 37, "460": [37, 93, 98], "461": [37, 56, 93, 98], "901_p100": 37, "902": 37, "902_p100": 37, "464": [37, 93, 98], "465": [37, 93, 98], "912_p100": 37, "466": [37, 56, 93, 98], "913_p100": 37, "2000": 37, "468": [37, 93, 98], "914_p100": 37, "470": [37, 93, 98], "471": [37, 56, 93, 98], "915_p100": 37, "472": [37, 93, 98], "916_p100": 37, "474": [37, 93, 98], "918": 37, "475": [37, 93, 98], "918_p100": 37, "477": [37, 93, 98], "920_p100": 37, "478": [37, 93, 98], "479": [37, 93, 98], "921_p100": 37, "481": [37, 56, 93, 98], "922_p100": 37, "482": [37, 93, 98], "483": [37, 93, 98], "923_p100": 37, "484": [37, 93, 98], "485": [37, 93, 98], "930_p120": 37, "486": [37, 56, 93, 98], "932": 37, "488": [37, 93, 98], "932_vsub_vpua": 37, "489": [37, 93, 98], "490": [37, 93, 98, 109], "933_p110": 37, "491": [37, 56, 93, 98], "492": [37, 93, 98], "935_p110": 37, "493": [37, 93, 98], "494": [37, 93, 98], "937_p110": 37, "495": [37, 93, 98], "496": [37, 56, 93, 98], "939_p120": 37, "497": [37, 93, 98], "942": 37, "498": [37, 93, 98], "942_p12a": 37, "499": [37, 93, 98], "942_vsub_vpua": 37, "943_p15a": 37, "2003": 37, "943_p130": 37, "503": [37, 93, 98], "943_vascii_vsub_vpua": 37, "504": [37, 93, 98], "943_vsub_vpua": 37, "505": [37, 93, 98], "943c": 37, "506": [37, 56, 93, 98], "507": [37, 93, 98], "949_p11a": 37, "508": [37, 93, 98], "949_p110": 37, "509": [37, 93, 98], "949_vascii_vsub_vpua": 37, "510": [37, 93, 98], "949_vsub_vpua": 37, "511": [37, 56, 93, 98], "949c": 37, "512": [37, 93, 98], "513": [37, 93, 98], "950_p110": 37, "514": [37, 93, 98], "954": 37, "515": [37, 93, 98], "954_p101": 37, "516": [37, 56, 93, 98], "517": [37, 93, 98, 109], "964_p110": 37, "518": [37, 93, 98], "964_vpua": 37, "519": [37, 93, 98], "520": [37, 93, 98], "970_p110_p110": 37, "2006_u2": 37, "521": [37, 56, 93, 98], "970_vpua": 37, "522": [37, 93, 98], "971": 37, "523": [37, 93, 98], "971_p100": 37, "524": [37, 93, 98], "971_vpua": 37, "525": [37, 93, 98], "526": [37, 56, 93, 98], "1006_p100": 37, "527": [37, 93, 98], "528": [37, 93, 98], "1025_p100": 37, "529": [37, 93, 98], "530": [37, 93, 98], "1026_p100": 37, "531": [37, 56, 93, 98], "532": [37, 93, 98], "1047_p100": 37, "533": [37, 93, 98], "534": [37, 93, 98], "535": [37, 93, 98], "1051": 37, "536": [37, 56, 93, 98], "1051_p100": 37, "537": [37, 93, 98], "538": [37, 93, 98], "1089_p100": 37, "539": [37, 93, 98], "540": [37, 93, 98], "1097_p100": 37, "541": [37, 56, 93, 98], "542": [37, 93, 98], "1098_p100": 37, "543": [37, 93, 98], "544": [37, 93, 98], "1112_p100": 37, "545": [37, 93, 98], "546": [37, 56, 93, 98], "1122_p100": 37, "547": [37, 93, 98], "548": [37, 93, 98], "1123_p100": 37, "549": [37, 93, 98], "550": [37, 93, 98], "1124_p100": 37, "551": [37, 56, 93, 98], "1125": 37, "552": [37, 93, 98], "1125_p100": 37, "553": [37, 93, 98], "1129": 37, "554": [37, 93, 98], "1129_p100": 37, "555": [37, 93, 98], "1130": 37, "556": [37, 56, 93, 98], "1130_p100": 37, "557": [37, 93, 98], "558": [37, 93, 98], "1131_p100": 37, "559": [37, 93, 98], "560": [37, 93, 98], "1132_p100": 37, "561": [37, 56, 93, 98, 109], "1133": 37, "562": [37, 93, 98], "1133_p100": 37, "563": [37, 93, 98], "1137": 37, "564": [37, 93, 98], "1137_p100": 37, "565": [37, 93, 98], "1140": 37, "566": [37, 56, 93, 98], "1140_p100": 37, "567": [37, 93, 98], "568": [37, 93, 98], "569": [37, 93, 98], "570": [37, 93, 98], "1141_p100": 37, "571": [37, 56, 93, 98], "572": [37, 93, 98], "573": [37, 93, 98], "574": [37, 93, 98], "1142_p100": 37, "575": [37, 93, 98], "576": [37, 56, 93, 98], "577": [37, 93, 98], "1143": 37, "578": [37, 93, 98], "1143_p100": 37, "579": [37, 93, 98], "580": [37, 93, 98], "581": [37, 56, 93, 98], "582": [37, 93, 98], "1144_p100": 37, "583": [37, 93, 98], "584": [37, 93, 98], "585": [37, 93, 98], "586": [37, 56, 93, 98], "1145_p100": 37, "587": [37, 93, 98, 109], "588": [37, 93, 98], "589": [37, 93, 98], "1146": 37, "590": [37, 93, 98], "1146_p100": 37, "591": [37, 56, 93, 98], "592": [37, 93, 98], "593": [37, 93, 98], "1147": 37, "594": [37, 93, 98], "1147_p100": 37, "595": [37, 93, 98], "596": [37, 56, 93, 98], "597": [37, 93, 98], "1148": 37, "598": [37, 93, 98], "1148_p100": 37, "599": [37, 93, 98], "600": [37, 93, 98, 110], "601": [37, 56, 93, 98], "1149": 37, "602": [37, 93, 98], "1149_p100": 37, "603": [37, 93, 98], "604": [37, 93, 98], "605": [37, 93, 98], "1153": 37, "606": [37, 56, 93, 98], "1153_p100": 37, "607": [37, 93, 98], "608": [37, 93, 98, 109], "609": [37, 93, 98], "610": [37, 93, 98], "1154_p100": 37, "611": [37, 56, 93, 98], "1155": 37, "612": [37, 93, 98], "1155_p100": 37, "613": [37, 93, 98], "614": [37, 93, 98], "1156_p100": 37, "615": [37, 93, 98], "1157": 37, "616": [37, 56, 93, 98], "1157_p100": 37, "617": [37, 93, 98], "1158": 37, "618": [37, 93, 98], "1158_p100": 37, "619": [37, 93, 98], "620": [37, 93, 98], "1160_p100": 37, "621": [37, 56, 93, 98], "1162": [37, 109], "622": [37, 93, 98], "1162_p100": 37, "623": [37, 93, 98], "1164": 37, "624": [37, 93, 98], "1164_p100": 37, "625": [37, 93, 98], "1168": 37, "626": [37, 56, 93, 98], "1168_p100": 37, "627": [37, 93, 98], "1200": 37, "628": [37, 93, 98], "629": [37, 93, 98, 113], "1202": 37, "630": [37, 93, 98, 108], "1203": 37, "631": [37, 56, 93, 98, 109], "632": [37, 93, 98], "1205": 37, "633": [37, 93, 98], "1208": 37, "634": [37, 93, 98], "1209": 37, "635": [37, 93, 98], "1212": 37, "636": [37, 56, 93, 98], "637": [37, 93, 98], "1214": 37, "638": [37, 98], "1215": 37, "640": [37, 98], "641": [37, 56, 98], "642": [37, 98], "643": [37, 98], "1236": 37, "644": [37, 98], "1237": 37, "1250_p100": 37, "647": [37, 98], "648": [37, 98], "1251_p100": 37, "649": [37, 98], "1252_p100": 37, "651": [37, 56, 98], "652": [37, 98], "1253_p100": 37, "653": [37, 98], "654": [37, 98], "1254_p100": 37, "655": [37, 98], "656": [37, 56, 98], "1255_p100": 37, "657": [37, 98], "658": [37, 98], "1256_p110": 37, "659": [37, 98], "660": [37, 98], "1257_p100": 37, "661": [37, 56, 98], "1258": 37, "662": [37, 98], "1258_p100": 37, "663": [37, 98], "1276": 37, "664": [37, 98], "1276_p100": 37, "665": [37, 98], "1363": 37, "666": [37, 56, 98], "1363_p11b": 37, "667": [37, 89, 90, 98], "1363_p110": 37, "668": [37, 98], "1363_vascii_vsub_vpua": 37, "669": [37, 98], "1363_vsub_vpua": 37, "670": [37, 98], "1364": 37, "1364_p110": 37, "1371": 37, "673": [37, 98], "1371_p100": 37, "674": [37, 98], "1373": 37, "675": [37, 98], "1373_p100": 37, "676": [37, 56, 98], "677": [37, 98], "1375_p100": 37, "2008": [37, 114], "678": [37, 98, 113], "679": [37, 98], "1383_p110": 37, "680": [37, 98], "1383_vpua": 37, "681": [37, 56, 98, 109], "1386": 37, "682": [37, 98], "1386_p100": 37, "683": [37, 98], "1386_vsub_vpua": 37, "684": [37, 98], "1388": 37, "685": [37, 98], "1388_p103": 37, "687": [37, 98], "1390_p110": 37, "688": [37, 98, 109], "689": [37, 98], "1399": 37, "690": [37, 98], "1399_p110": 37, "691": [37, 56, 98], "4517": 37, "692": [37, 98], "4517_p100": 37, "2005": 37, "693": [37, 98], "4899": 37, "694": [37, 98], "4899_p100": 37, "695": [37, 98], "4902": 37, "696": [37, 56, 98], "4909": 37, "697": [37, 98], "4909_p100": 37, "698": [37, 98], "4971": 37, "699": [37, 98], "4971_p100": 37, "700": [37, 98], "5012": 37, "5012_p100": 37, "702": [37, 98], "5026": 37, "703": [37, 98], "5035": 37, "5050": 37, "705": [37, 98], "5054": 37, "706": [37, 56, 98], "5123": 37, "707": [37, 98], "5123_p100": 37, "5304": 37, "709": [37, 98], "5305": 37, "710": [37, 98], "5346": 37, "711": [37, 56, 98], "5346_p100": 37, "712": [37, 98], "5347": 37, "713": [37, 98], "5347_p100": 37, "714": [37, 98], "5348": 37, "5348_p100": 37, "716": [37, 56, 98], "5349": 37, "5349_p100": 37, "718": [37, 85, 98], "5350": 37, "719": [37, 98], "5350_p100": 37, "5351": 37, "721": [37, 56, 98], "5351_p100": 37, "722": [37, 98], "5352": 37, "723": [37, 98], "5352_p100": 37, "5353": 37, "725": [37, 98], "5353_p100": 37, "726": [37, 56, 98], "5354": 37, "727": [37, 98], "5354_p100": 37, "728": [37, 98], "5471": 37, "5471_p100": 37, "2006": [37, 114], "730": [37, 98], "5478": 37, "731": [37, 56, 98], "5478_p100": 37, "732": [37, 98], "8482": 37, "733": [37, 98], "8482_p100": 37, "734": [37, 98], "9005": 37, "735": [37, 98], "9005_x110": 37, "736": [37, 56, 98], "9030": 37, "9066": 37, "738": [37, 98], "9067": 37, "739": [37, 98], "9067_x100": 37, "740": [37, 98], "9400": 37, "741": [37, 56, 98], "9424": 37, "742": [37, 98], "9447": 37, "743": [37, 98], "9447_p100": 37, "744": [37, 98], "9448": 37, "745": [37, 98], "9448_x100": 37, "746": [37, 56, 98], "9449": 37, "747": [37, 98], "9449_p100": 37, "748": [37, 98], "9580": 37, "12712": 37, "750": [37, 98], "12712_p100": 37, "751": [37, 56, 98], "752": [37, 98], "753": [37, 98], "13488": 37, "754": [37, 98], "13489": 37, "755": [37, 98], "13490": 37, "756": [37, 56, 98], "13491": 37, "13496": 37, "758": 37, "13497": 37, "759": 37, "16684": 37, "760": 37, "16684_p110": 37, "761": [37, 56], "16804": 37, "762": 37, "16804_x110": 37, "763": 37, "764": 37, "17584": 37, "766": [37, 56], "17585": 37, "17586": 37, "768": 37, "17587": 37, "769": 37, "17592": 37, "17593": 37, "771": [37, 56], "20780": 37, "772": 37, "21680": 37, "773": 37, "21681": 37, "774": 37, "21682": 37, "21683": 37, "776": [37, 56], "25546": 37, "777": 37, "25776": 37, "778": 37, "25777": 37, "779": 37, "25778": 37, "25779": 37, "29872": 37, "29873": 37, "783": 37, "29874": 37, "784": [37, 108], "29875": 37, "785": 37, "786": [37, 56], "33722_p12a_p12a": 37, "2009_u2": 37, "787": 37, "33722_p120": 37, "788": 37, "33722_vascii_vpua": 37, "33722_vpua": 37, "790": 37, "61955": 37, "791": [37, 56], "61956": 37, "792": 37, "65025": 37, "793": 37, "euccn": 37, "794": 37, "eucjp": 37, "795": 37, "euckr": 37, "796": [37, 56], "euctw": 37, "797": 37, "thai": [37, 98], "798": [37, 111], "ibm037": 37, "799": 37, "ibm273": 37, "800": 37, "ibm277": 37, "801": [37, 56], "ibm278": 37, "802": 37, "ibm280": 37, "ibm284": 37, "804": 37, "ibm285": 37, "805": 37, "ibm290": 37, "ibm297": 37, "807": 37, "ibm367": 37, "808": [37, 111], "809": 37, "ibm437": 37, "811": [37, 56], "ibm500": 37, "812": 37, "ibm737": 37, "ibm775": 37, "814": 37, "ibm819": 37, "815": 37, "ibm838": 37, "816": [37, 56], "ibm850": 37, "817": 37, "ibm851": 37, "818": [37, 109], "ibm852": 37, "ibm855": 37, "820": 37, "ibm856": 37, "821": [37, 56], "ibm857": 37, "ibm00858": 37, "823": 37, "ibm860": 37, "ibm861": 37, "825": 37, "ibm862": 37, "826": [37, 56], "ibm863": 37, "827": 37, "ibm864": 37, "828": 37, "ibm865": 37, "829": 37, "ibm866": 37, "830": 37, "ibm868": 37, "831": [37, 56], "ibm869": 37, "832": 37, "ibm870": 37, "833": 37, "ibm871": 37, "ibm875": 37, "835": 37, "ibm918": 37, "836": [37, 56], "ibm922": 37, "837": 37, "ibm930": 37, "ibm939": 37, "839": 37, "ibm1006": 37, "840": 37, "ibm1026": 37, "841": [37, 56], "ibm1047": 37, "842": 37, "ibm1047_lf": 37, "843": 37, "ibm1098": 37, "844": 37, "ibm01140": 37, "845": 37, "ibm01141": 37, "846": [37, 56], "ibm1141_lf": 37, "847": 37, "ibm01142": 37, "ibm01143": 37, "849": 37, "ibm01144": 37, "ibm01145": 37, "ibm01146": 37, "ibm01147": 37, "853": 37, "ibm01148": 37, "ibm01149": 37, "ibm1153": 37, "imap": 37, "mailbox": 37, "iscii": 37, "bng": 37, "guj": 37, "gur": 37, "knd": 37, "mlm": 37, "ori": 37, "tlg": 37, "tml": 37, "872": 37, "873": 37, "iso_646": 37, "irv": 37, "1983": 37, "876": 37, "1991": [37, 110], "iso_2022": 37, "ja": [37, 56, 98], "879": 37, "880": 37, "881": 37, "882": 37, "ko": [37, 56, 98], "883": 37, "884": 37, "zh": [37, 56, 98, 108], "886": 37, "887": 37, "iso_8859": 37, "1987": 37, "888": 37, "1988": 37, "890": 37, "891": 37, "892": 37, "893": 37, "894": 37, "895": 37, "1989": 37, "896": 37, "1992": [37, 113], "897": 37, "899": 37, "900": 37, "ext": 37, "903": 37, "904": 37, "905": 37, "8859_10": 37, "906": 37, "8859_11": 37, "907": 37, "8859_14": 37, "908": 37, "909": 37, "910": 37, "911": 37, "917": 37, "919": 37, "924": 37, "925": 37, "926": 37, "uc": [37, 103], "927": 37, "928": 37, "celtic": 37, "929": 37, "ir": 37, "934": 37, "936": 37, "940": 37, "941": 37, "iso646": 37, "944": 37, "iso8859_15_fdi": 37, "945": 37, "ji": 37, "946": 37, "jis_encod": 37, "jis7": 37, "948": 37, "jis8": 37, "951": 37, "952": 37, "953": 37, "ks_c_5601": 37, "955": 37, "ksc": 37, "956": 37, "ksc_5601": 37, "l1": 37, "958": 37, "l2": 37, "959": 37, "l3": 37, "960": [37, 109], "l4": 37, "l5": 37, "962": 37, "l6": 37, "963": 37, "l8": 37, "l9": 37, "965": 37, "966": 37, "latin0": 37, "967": 37, "latin2": 37, "969": 37, "latin3": 37, "latin4": 37, "latin5": 37, "972": 37, "latin6": 37, "latin8": 37, "974": 37, "lmbc": 37, "975": 37, "mac": 37, "977": 37, "macc": 37, "979": 37, "maccentraleurop": 37, "980": 37, "macci": 37, "981": 37, "macgr": 37, "982": 37, "macintosh": 37, "0_2": 37, "984": 37, "6_2": 37, "7_3": 37, "986": 37, "988": 37, "macroman": 37, "mactr": 37, "ms_kanji": 37, "991": 37, "ms874": 37, "992": 37, "ms932": 37, "993": 37, "ms936": 37, "994": 37, "ms949": 37, "ms950": 37, "996": 37, "ms950_hksc": 37, "997": 37, "multilingu": 37, "998": 37, "pck": 37, "r8": 37, "1000": [37, 109, 113], "1001": 37, "scsu": 37, "1002": 37, "1003": 37, "shift_jis78": 37, "sji": 37, "1005": 37, "sjis78": 37, "sun_eu_greek": 37, "1007": 37, "thai8": 37, "1008": 37, "ti": [37, 56, 72, 108], "1009": 37, "tis620": 37, "2533": 37, "1010": 37, "1011": 37, "turkish8": 37, "1013": 37, "1014": 37, "uji": 37, "1015": 37, "1016": 37, "1018": 37, "1019": 37, "1020": 37, "unicodebig": 37, "unicodebigunmark": 37, "1022": 37, "unicodelittl": 37, "1023": 37, "unicodelittleunmark": 37, "1027": 37, "1029": 37, "1030": 37, "1031": 37, "1032": 37, "1033": 37, "1034": 37, "1035": 37, "1036": 37, "1038": 37, "utf16_bigendian": 37, "1039": 37, "utf16_littleendian": 37, "utf16_oppositeendian": 37, "1041": 37, "utf16_platformendian": 37, "1042": 37, "utf32_bigendian": 37, "1043": 37, "utf32_littleendian": 37, "utf32_oppositeendian": 37, "1045": 37, "utf32_platformendian": 37, "31j": 37, "1048": 37, "1049": 37, "1050": 37, "1052": 37, "1054": 37, "1055": 37, "1056": 37, "1057": 37, "1059": 37, "1060": 37, "1061": 37, "1062": 37, "1063": 37, "1064": 37, "1066": 37, "1067": 37, "1068": 37, "1070": 37, "1071": 37, "1072": 37, "1073": 37, "1075": 37, "1076": 37, "1078": 37, "1079": 37, "1080": 37, "10000": 37, "10006": 37, "1082": 37, "10007": 37, "1083": 37, "10029": 37, "10081": 37, "1085": 37, "20127": 37, "1086": 37, "20866": 37, "21866": 37, "1088": 37, "28592": 37, "28593": 37, "1090": 37, "28594": 37, "1091": 37, "28595": 37, "1092": 37, "28596": 37, "1093": 37, "28597": 37, "28598": 37, "1095": 37, "28599": 37, "28603": 37, "28605": 37, "51949": 37, "54936": 37, "1100": 37, "57002": 37, "1101": 37, "57003": 37, "1102": 37, "57004": 37, "1103": 37, "57005": 37, "57006": 37, "1105": 37, "57007": 37, "57008": 37, "1107": 37, "57009": 37, "57010": 37, "1109": 37, "57011": 37, "65000": 37, "1111": 37, "65001": 37, "compound": [37, 97], "1114": 37, "1115": 37, "ibm720": 37, "1116": 37, "1117": 37, "ibm867": 37, "1119": [37, 104, 114], "ibm874": 37, "1121": 37, "ibm921": 37, "ibm930a": 37, "ibm933": 37, "ibm935": 37, "1127": 37, "ibm937": 37, "1128": 37, "ibm939a": 37, "ibm942": 37, "ibm942c": 37, "ibm943": 37, "ibm949": 37, "1134": 37, "ibm949c": 37, "ibm950": 37, "1136": 37, "ibm954": 37, "ibm954c": 37, "1138": 37, "ibm964": 37, "1139": 37, "ibm970": 37, "ibm971": 37, "ibm1025": 37, "ibm1097": 37, "ibm1112": 37, "ibm1122": 37, "ibm1123": 37, "ibm1124": 37, "1150": 37, "ibm1363": 37, "ibm1363c": 37, "1152": 37, "ibm1364": 37, "ibm1371": 37, "ibm1388": 37, "ibm1390": 37, "ibm1399": 37, "ibm33722": 37, "ibm33722a": 37, "ibm33722c": 37, "gu": [37, 56], "ka": [37, 56, 98], "ma": [37, 56, 108], "1167": 37, "pa": [37, 56], "ta": [37, 56, 98], "te": [37, 56], "1170": 37, "iscii91": 37, "1172": 37, "1173": 37, "1174": 37, "jisautodetect": 37, "1176": 37, "ksc5601": 37, "ce": [37, 56], "1178": 37, "centraleurroman": 37, "1179": 37, "1180": 37, "1183": 37, "maccyril": 37, "macgreek": 37, "1186": 37, "macturkish": 37, "1187": 37, "macukrain": 37, "1188": 37, "1189": 37, "ms932_0213": 37, "1191": 37, "1192": 37, "1193": 37, "utf_8j": 37, "1194": 37, "1195": 37, "1196": 37, "1197": 37, "1198": 37, "50220": 37, "50221": 37, "iso2022jp": 37, "x11": 37, "undesir": 39, "expert": 39, "situat": [39, 108], "old": 39, "neither": [39, 43, 108, 113], "effect": [39, 57, 85, 93, 108, 113], "charset": [39, 49], "invisibli": [39, 57, 94], "0x1a": 40, "itself": [40, 93, 111, 113], "x1a": [40, 106], "032": 40, "utf8toint": 42, "enc2utf8": [42, 43], "unchang": [43, 76, 89, 90, 107], "ufffd": [43, 44], "bogu": 43, "serv": [44, 84, 107, 113], "own": [44, 109, 112], "iconv": [44, 109, 111], "to_raw": [44, 111], "stri_conv": 44, "encodingnam": 44, "erron": 44, "001a": 44, "fffd": 44, "thereof": [44, 107, 113], "problemat": [44, 110, 112], "stri_locate_all_regex": [44, 58, 90, 109, 113], "converted_str": 44, "u001a": 44, "exce": [44, 73], "printabl": 45, "uxxxx": [45, 101], "uxxxxxxxx": [45, 101], "stri_extract_first_": [46, 47], "stri_extract_last_": [46, 47], "stri_extract_first": [46, 89, 107], "stri_extract_last": [46, 89, 107], "mode": [46, 58, 60, 66, 73, 74, 76, 104, 105, 113], "stri_extract_first_charclass": 46, "stri_extract_last_charclass": 46, "stri_extract_all_col": 46, "stri_extract_first_col": 46, "stri_extract_last_col": 46, "stri_extract_first_regex": [46, 109, 113], "stri_extract_last_regex": 46, "stri_extract_first_fix": [46, 107], "stri_extract_last_fix": 46, "_": [46, 55, 58, 76, 82, 96, 106, 113], "scenario": [46, 58, 60, 90, 107, 109], "skip": [46, 58, 76, 110], "xaaaax": 46, "bartolini": 46, "abcdefghijk": 46, "bcde": 46, "ij": [46, 106], "aabbcc": 46, "55200": 46, "0123456789": [46, 70], "\u2139": 46, "aaaaaaaa": 46, "\u00fd": 46, "abababa": [46, 58], "aba": [46, 58, 109], "agaga": [46, 76], "aga": [46, 58, 60, 76, 107], "stri_extract_last_boundari": 47, "stri_extract_first_boundari": 47, "_word": [47, 59], "whatsoev": [48, 109], "abcdefghijklmnopqrstuvwxyz": 48, "abbcccdeefff": 48, "concis": [49, 113], "fastest": 50, "term": [51, 93, 109], "longest": [51, 54, 106], "confus": 51, "ordinari": [51, 64], "1a": 51, "2b": 51, "3c": 51, "4d": [51, 111], "5e": 51, "6f": 51, "7g": 51, "8h": 51, "9i": 51, "10j": 51, "11k": 51, "12l": 51, "13m": 51, "1n": 51, "2o": 51, "3p": 51, "4q": 51, "5r": 51, "7t": 51, "8u": 51, "9v": 51, "10w": 51, "11x": 51, "12y": 51, "13z": 51, "xyz": 51, "stri_c_list": 52, "stri_paste_list": 52, "sausag": [52, 106, 113], "method": [53, 94, 104], "by_row": [54, 106], "transpos": [54, 109], "simplify2arrai": [54, 106], "transposit": 54, "unsupport": 55, "anyth": [55, 89], "complic": [55, 107], "3l": [55, 64], "insight": 55, "underscor": [55, 109], "af": 56, "af_na": 56, "af_za": 56, "agq": 56, "agq_cm": 56, "ak": 56, "ak_gh": 56, "am_et": 56, "ar_001": 56, "ar_a": 56, "ar_bh": 56, "ar_dj": 56, "ar_dz": 56, "ar_eg": 56, "ar_eh": 56, "ar_er": 56, "ar_il": 56, "ar_iq": 56, "ar_jo": 56, "ar_km": 56, "ar_kw": 56, "ar_lb": 56, "ar_li": 56, "ar_ma": 56, "ar_mr": 56, "ar_om": 56, "ar_p": 56, "ar_qa": 56, "ar_sa": 56, "ar_sd": 56, "ar_so": 56, "ar_ss": 56, "ar_si": 56, "ar_td": 56, "ar_tn": 56, "ar_y": 56, "as_in": 56, "asa": 56, "asa_tz": 56, "ast": [56, 93, 114], "ast_": 56, "az": [56, 98], "az_cyrl": [56, 98], "az_cyrl_az": 56, "az_latn": 56, "az_latn_az": 56, "bas_cm": 56, "be_bi": 56, "bem": 56, "bem_zm": 56, "bez": 56, "bez_tz": 56, "bg": [56, 98], "bg_bg": 56, "bgc": 56, "bgc_in": 56, "bho": 56, "bho_in": 56, "blo": 56, "blo_bj": 56, "bm": 56, "bm_ml": 56, "bn": 56, "bn_bd": 56, "bn_in": 56, "bo": 56, "bo_cn": 56, "bo_in": 56, "br": 56, "br_fr": 56, "brx": 56, "brx_in": 56, "bs_cyrl": 56, "bs_cyrl_ba": 56, "bs_latn": 56, "bs_latn_ba": 56, "ca_ad": 56, "ca_e": 56, "ca_fr": 56, "ca_it": 56, "ccp": 56, "ccp_bd": 56, "ccp_in": 56, "ce_ru": 56, "ceb": 56, "ceb_ph": 56, "cgg": 56, "cgg_ug": 56, "chr": [56, 98, 110], "chr_u": 56, "ckb": 56, "ckb_iq": 56, "ckb_ir": 56, "cs_cz": 56, "csw": 56, "csw_ca": 56, "cv": 56, "cv_ru": 56, "cy": [56, 98], "cy_gb": 56, "da": 56, "da_dk": 56, "da_gl": 56, "dav": 56, "dav_k": 56, "de_at": [56, 108], "de_b": 56, "de_ch": 56, "de_it": 56, "de_li": 56, "de_lu": 56, "dje": 56, "dje_n": 56, "doi_in": 56, "dsb": [56, 98], "dsb_de": 56, "dua": 56, "dua_cm": 56, "dyo": 56, "dyo_sn": 56, "dz": 56, "dz_bt": 56, "ebu": 56, "ebu_k": 56, "ee_gh": 56, "ee_tg": 56, "el_ci": 56, "el_gr": 56, "en_001": 56, "en_150": 56, "en_a": 56, "en_ag": 56, "en_ai": 56, "en_at": 56, "en_bb": 56, "en_b": 56, "en_bi": 56, "en_bm": 56, "en_bw": 56, "en_bz": 56, "en_ca": 56, "en_cc": 56, "en_ch": 56, "en_ck": 56, "en_cm": 56, "en_cx": 56, "en_ci": 56, "en_d": 56, "en_dg": 56, "en_dk": 56, "en_dm": 56, "en_er": 56, "en_fi": 56, "en_fj": 56, "en_fk": 56, "en_fm": 56, "en_gb": 56, "en_gd": 56, "en_gg": 56, "en_gh": 56, "en_gi": 56, "en_gm": 56, "en_gu": 56, "en_hk": [56, 108], "en_id": 56, "en_i": 56, "en_il": 56, "en_im": 56, "en_in": 56, "en_io": 56, "en_j": 56, "en_jm": 56, "en_k": 56, "en_ki": 56, "en_kn": 56, "en_lc": 56, "en_lr": 56, "en_l": 56, "en_mg": 56, "en_mh": 56, "en_mo": 56, "en_mp": 56, "en_m": 56, "en_mt": 56, "en_mu": 56, "en_mv": 56, "en_mw": 56, "en_mi": 56, "en_na": 56, "en_nf": 56, "en_ng": 56, "en_nl": 56, "en_nr": 56, "en_nu": 56, "en_nz": [56, 112], "en_pg": 56, "en_ph": [56, 108], "en_pk": 56, "en_pn": 56, "en_pr": 56, "en_pw": 56, "en_rw": 56, "en_sb": 56, "en_sc": 56, "en_sd": 56, "en_s": 56, "en_sg": 56, "en_sh": 56, "en_si": 56, "en_sl": 56, "en_ss": 56, "en_sx": 56, "en_sz": 56, "en_tc": 56, "en_tk": 56, "en_to": 56, "en_tt": 56, "en_tv": 56, "en_tz": 56, "en_ug": 56, "en_um": 56, "en_vc": 56, "en_vg": 56, "en_vi": 56, "en_vu": 56, "en_w": 56, "en_za": 56, "en_zm": 56, "en_zw": 56, "eo": [56, 98], "eo_001": 56, "es_419": [56, 98], "es_ar": 56, "es_bo": 56, "es_br": 56, "es_bz": 56, "es_cl": 56, "es_co": 56, "es_cr": 56, "es_cu": 56, "es_do": 56, "es_ea": 56, "es_ec": 56, "es_gq": 56, "es_gt": 56, "es_hn": 56, "es_ic": 56, "es_mx": 56, "es_ni": 56, "es_pa": 56, "es_p": 56, "es_ph": 56, "es_pr": 56, "es_pi": 56, "es_sv": 56, "es_u": 56, "es_ui": 56, "es_v": 56, "et": [56, 69, 112], "et_e": 56, "eu": [56, 69], "eu_": 56, "ewo": 56, "ewo_cm": 56, "fa_af": 56, "fa_ir": 56, "ff_adlm": 56, "ff_adlm_bf": 56, "ff_adlm_cm": 56, "ff_adlm_gh": 56, "ff_adlm_gm": 56, "ff_adlm_gn": 56, "ff_adlm_gw": 56, "ff_adlm_lr": 56, "ff_adlm_mr": 56, "ff_adlm_n": 56, "ff_adlm_ng": 56, "ff_adlm_sl": 56, "ff_adlm_sn": 56, "ff_latn": 56, "ff_latn_bf": 56, "ff_latn_cm": 56, "ff_latn_gh": 56, "ff_latn_gm": 56, "ff_latn_gn": 56, "ff_latn_gw": 56, "ff_latn_lr": 56, "ff_latn_mr": 56, "ff_latn_n": 56, "ff_latn_ng": 56, "ff_latn_sl": [56, 108], "ff_latn_sn": 56, "fi_fi": 56, "fil": 56, "fil_ph": 56, "fo": 56, "fo_dk": 56, "fo_fo": 56, "fr_be": 56, "fr_bf": 56, "fr_bi": 56, "fr_bj": 56, "fr_bl": 56, "fr_ca": [56, 108], "fr_cd": 56, "fr_cf": 56, "fr_cg": 56, "fr_ch": 56, "fr_ci": 56, "fr_cm": 56, "fr_dj": 56, "fr_dz": 56, "fr_fr": [56, 108], "fr_ga": 56, "fr_gf": 56, "fr_gn": 56, "fr_gp": 56, "fr_gq": 56, "fr_ht": 56, "fr_km": 56, "fr_lu": 56, "fr_ma": 56, "fr_mc": 56, "fr_mf": 56, "fr_mg": 56, "fr_ml": 56, "fr_mq": 56, "fr_mr": 56, "fr_mu": 56, "fr_nc": 56, "fr_ne": 56, "fr_pf": 56, "fr_pm": 56, "fr_re": 56, "fr_rw": 56, "fr_sc": 56, "fr_sn": 56, "fr_sy": 56, "fr_td": 56, "fr_tg": 56, "fr_tn": 56, "fr_vu": 56, "fr_wf": 56, "fr_yt": 56, "fur": 56, "fur_it": 56, "fy": 56, "fy_nl": 56, "ga": [56, 76, 107, 108], "ga_gb": 56, "ga_i": 56, "gd": 56, "gd_gb": 56, "gl": 56, "gl_e": 56, "gsw": 56, "gsw_ch": 56, "gsw_fr": 56, "gsw_li": 56, "gu_in": 56, "guz": 56, "guz_k": 56, "gv": 56, "gv_im": 56, "ha_gh": 56, "ha_n": [56, 98], "ha_ng": 56, "haw": 56, "haw_u": 56, "hi": 56, "hi_in": 56, "hi_latn": 56, "hi_latn_in": 56, "hr": 56, "hr_ba": 56, "hr_hr": 56, "hsb": 56, "hsb_de": 56, "hu": 56, "hu_hu": 56, "hy": [56, 98, 112], "hy_am": 56, "ia": [56, 98], "ia_001": 56, "id_id": 56, "ie": 56, "ie_e": 56, "ig": 56, "ig_ng": 56, "ii_cn": 56, "is_i": 56, "it_ch": 56, "it_it": 56, "it_sm": 56, "it_va": 56, "ja_jp": [56, 112], "jgo": 56, "jgo_cm": 56, "jmc": 56, "jmc_tz": 56, "jv": 56, "jv_id": 56, "ka_g": 56, "kab": 56, "kab_dz": 56, "kam": 56, "kam_k": 56, "kde": 56, "kde_tz": 56, "kea": 56, "kea_cv": 56, "kgp": 56, "kgp_br": 56, "khq": 56, "khq_ml": 56, "ki": 56, "ki_k": 56, "kk_kz": 56, "kkj": 56, "kkj_cm": 56, "kl": [56, 106], "kl_gl": 56, "kln": 56, "kln_ke": 56, "km": 56, "km_kh": 56, "kn": 56, "kn_in": 56, "ko_cn": 56, "ko_kp": 56, "ko_kr": 56, "kok": 56, "kok_in": 56, "ks_arab": 56, "ks_arab_in": 56, "ks_deva": 56, "ks_deva_in": 56, "ksb": 56, "ksb_tz": 56, "ksf": 56, "ksf_cm": 56, "ksh": 56, "ksh_de": 56, "ku": 56, "ku_tr": 56, "kw": 56, "kw_gb": 56, "kxv": 56, "kxv_deva": 56, "kxv_deva_in": 56, "kxv_latn": 56, "kxv_latn_in": 56, "kxv_orya": 56, "kxv_orya_in": 56, "kxv_telu": 56, "kxv_telu_in": 56, "ky": [56, 98], "ky_kg": 56, "lag": 56, "lag_tz": 56, "lb": 56, "lb_lu": 56, "lg": 56, "lg_ug": 56, "lij": 56, "lij_it": 56, "lkt": 56, "lkt_u": 56, "lmo": 56, "lmo_it": 56, "ln": 56, "ln_ao": 56, "ln_cd": 56, "ln_cf": 56, "ln_cg": 56, "lo_la": 56, "lrc": 56, "lrc_iq": 56, "lrc_ir": 56, "lt_lt": 56, "lu_cd": 56, "luo": 56, "luo_k": 56, "lui": 56, "luy_k": 56, "lv": 56, "lv_lv": 56, "mai_in": 56, "mas_k": 56, "mas_tz": 56, "mer": 56, "mer_k": 56, "mfe": 56, "mfe_mu": 56, "mg": 56, "mg_mg": 56, "mgh": 56, "mgh_mz": 56, "mgo": 56, "mgo_cm": 56, "mi": [56, 69, 87, 88, 104, 111, 112], "mi_nz": 56, "mk": [56, 98], "mk_mk": 56, "ml": 56, "ml_in": 56, "mn_mn": 56, "mni": 56, "mni_beng": 56, "mni_beng_in": 56, "mr": [56, 59, 83], "mr_in": 56, "ms_bn": 56, "ms_id": 56, "ms_my": 56, "ms_sg": 56, "mt": 56, "mt_mt": 56, "mua": 56, "mua_cm": 56, "my": [56, 98, 112], "my_mm": 56, "mzn": 56, "mzn_ir": 56, "naq": 56, "naq_na": 56, "nb": [56, 76], "nb_no": 56, "nb_sj": 56, "nd_zw": 56, "nds_de": 56, "nds_nl": 56, "ne": 56, "ne_in": 56, "ne_np": 56, "nl_aw": 56, "nl_be": 56, "nl_bq": 56, "nl_cw": [56, 108], "nl_nl": [56, 112], "nl_sr": 56, "nl_sx": 56, "nmg": 56, "nmg_cm": 56, "nn": 56, "nn_no": 56, "nnh": 56, "nnh_cm": 56, "nqo": 56, "nqo_gn": 56, "nu": 56, "nus_ss": 56, "nyn": 56, "nyn_ug": 56, "oc": 56, "oc_": 56, "oc_fr": 56, "om": 56, "om_et": 56, "om_k": 56, "or_in": 56, "os_g": 56, "os_ru": 56, "pa_arab": 56, "pa_arab_pk": 56, "pa_guru": 56, "pa_guru_in": 56, "pcm": 56, "pcm_ng": 56, "prg": 56, "prg_pl": 56, "ps_af": 56, "ps_pk": 56, "pt_ao": 56, "pt_br": [56, 57], "pt_ch": [56, 108], "pt_cv": 56, "pt_gq": 56, "pt_gw": 56, "pt_lu": 56, "pt_mo": 56, "pt_mz": 56, "pt_pt": 56, "pt_st": 56, "pt_tl": 56, "qu": 56, "qu_bo": 56, "qu_ec": 56, "qu_p": 56, "raj": 56, "raj_in": 56, "rm": [56, 114], "rm_ch": 56, "rn": 56, "rn_bi": 56, "ro": [56, 98, 111], "ro_md": 56, "ro_ro": 56, "rof": 56, "rof_tz": 56, "ru": [56, 98], "ru_bi": 56, "ru_kg": 56, "ru_kz": 56, "ru_md": 56, "ru_ru": 56, "ru_ua": 56, "rw": 56, "rw_rw": 56, "rwk": 56, "rwk_tz": 56, "sa": [56, 93], "sa_in": 56, "sah": 56, "sah_ru": 56, "saq": 56, "saq_k": 56, "sat_olck": [56, 98], "sat_olck_in": 56, "sbp": 56, "sbp_tz": 56, "sc_it": 56, "sd": 56, "sd_arab": 56, "sd_arab_pk": 56, "sd_deva": 56, "sd_deva_in": 56, "se_fi": 56, "se_no": 56, "se_s": 56, "seh": 56, "seh_mz": 56, "ses_ml": 56, "sg": 56, "sg_cf": 56, "shi": 56, "shi_latn": 56, "shi_latn_ma": 56, "shi_tfng": 56, "shi_tfng_ma": 56, "si": [56, 98, 111], "si_lk": 56, "sl": 56, "sl_si": 56, "smn": 56, "smn_fi": 56, "sn": 56, "sn_zw": 56, "so_dj": 56, "so_et": 56, "so_k": 56, "so_so": 56, "sq": 56, "sq_al": 56, "sq_mk": 56, "sq_xk": 56, "sr": [56, 98], "sr_cyrl": [56, 108], "sr_cyrl_ba": 56, "sr_cyrl_m": 56, "sr_cyrl_r": 56, "sr_cyrl_xk": 56, "sr_latn": [56, 98, 108], "sr_latn_ba": 56, "sr_latn_m": 56, "sr_latn_r": 56, "sr_latn_xk": 56, "su": [56, 93, 111], "su_latn": 56, "su_latn_id": 56, "sv_ax": 56, "sv_fi": 56, "sv_se": 56, "sw": 56, "sw_cd": 56, "sw_ke": 56, "sw_tz": 56, "sw_ug": 56, "syr": 56, "syr_iq": 56, "syr_si": 56, "szl": 56, "szl_pl": 56, "ta_in": 56, "ta_lk": 56, "ta_mi": 56, "ta_sg": 56, "te_in": 56, "teo": 56, "teo_k": 56, "teo_ug": 56, "tg": 56, "tg_tj": 56, "th_th": 56, "ti_er": 56, "ti_et": 56, "tk": [56, 98], "tk_tm": 56, "to_to": 56, "tok": 56, "tok_001": 56, "tr": [56, 66, 98, 99, 111], "tr_cy": 56, "tr_tr": [56, 95, 112], "tt": 56, "tt_ru": 56, "twq": 56, "twq_ne": 56, "tzm": 56, "tzm_ma": 56, "ug": [56, 98], "ug_cn": 56, "uk": [56, 98, 103], "uk_ua": 56, "ur": [56, 98], "ur_in": 56, "ur_pk": 56, "uz": [56, 98], "uz_arab": 56, "uz_arab_af": 56, "uz_cyrl": [56, 98], "uz_cyrl_uz": 56, "uz_latn": [56, 98], "uz_latn_uz": 56, "vai": 56, "vai_latn": 56, "vai_latn_lr": 56, "vai_vaii": 56, "vai_vaii_lr": 56, "vec_it": 56, "vi": 56, "vi_vn": 56, "vmw": 56, "vmw_mz": 56, "vun": 56, "vun_tz": 56, "wae": 56, "wae_ch": 56, "wo": 56, "wo_sn": 56, "xh": [56, 98], "xh_za": 56, "xnr": 56, "xnr_in": 56, "xog": 56, "xog_ug": 56, "yav": 56, "yav_cm": 56, "yi": 56, "yi_ua": 56, "yo": [56, 98, 112], "yo_bj": [56, 98, 112], "yo_ng": 56, "yrl": 56, "yrl_br": 56, "yrl_co": 56, "yrl_ve": 56, "yue": 56, "yue_han": 56, "yue_hans_cn": 56, "yue_hant": 56, "yue_hant_hk": 56, "za_cn": 56, "zgh": 56, "zgh_ma": 56, "zh_han": [56, 108], "zh_hans_cn": 56, "zh_hans_hk": 56, "zh_hans_mo": 56, "zh_hans_sg": 56, "zh_hant": [56, 108], "zh_hant_hk": 56, "zh_hant_mo": 56, "zh_hant_tw": 56, "zu": [56, 98], "zu_za": 56, "stri_locale_get": [57, 108], "oldloc": 57, "stringi_1": 57, "9001": 57, "stri_locate_first_": [58, 59], "stri_locate_last_": [58, 59], "stri_locate_first": [58, 89, 90, 107], "stri_locate_last": [58, 89, 90, 107], "stri_locate_first_charclass": 58, "stri_locate_last_charclass": 58, "stri_locate_all_col": [58, 109], "stri_locate_first_col": 58, "stri_locate_last_col": 58, "stri_locate_first_regex": [58, 89, 109], "stri_locate_last_regex": [58, 89], "stri_locate_first_fix": [58, 107], "stri_locate_last_fix": [58, 107], "latter": [58, 106, 107, 108, 109, 113], "similarli": [58, 106], "stri_match_regex": 58, "breakfast": [58, 60], "lunch": [58, 60], "pizza": [58, 60], "food": [58, 60], "ababa": [58, 86], "ye": 58, "lookahead": 58, "acagagactttagatagagaaga": [58, 60], "jone": [59, 83, 106, 109], "brown": [59, 76, 83, 107], "happi": [59, 83], "smith": [59, 83], "stri_match_first": [60, 107], "stri_match_last": [60, 107], "stri_match_all_regex": [60, 113], "stri_match_first_regex": 60, "stri_match_last_regex": 60, "dessert": 60, "icecream": 60, "spaghetti": 60, "xyx": 60, "acgt": [60, 96, 112], "gag": 60, "ttt": 60, "ata": 60, "trail": 62, "u001f600": 62, "skip_word_numb": [63, 83], "skip_word_lett": [63, 83], "skip_word_kana": 63, "skip_word_ideo": 63, "skip_line_soft": 63, "skip_line_hard": 63, "skip_sentence_term": 63, "skip_sentence_sep": [63, 83], "action": 63, "exclud": [63, 91], "hiragana": [63, 98, 108], "hard": [63, 108], "mandatori": 63, "skip_": 63, "rbbi": 63, "ubrk": 63, "ubrk_8h": 63, "alternate_shift": [64, 108], "uppercase_first": [64, 108], "stri_col": 64, "permiss": [64, 108], "strictest": [64, 108], "primari": [64, 108], "weight": [64, 108], "top": [64, 108, 110], "quaternari": [64, 108], "canadian": [64, 108], "secondari": 64, "tertiari": [64, 108], "opposit": [64, 108], "increment": [64, 108], "fcd": [64, 98, 108, 112], "nfd": [64, 97, 98, 99, 108, 111], "turn": 64, "alik": 64, "reliabl": 64, "relationship": 64, "definit": [64, 66, 113], "architectur": 64, "classicu_1_1col": 64, "number100": 64, "number2": 64, "u_toupp": 65, "ala": [65, 66], "dotal": 66, "dot_al": [66, 113], "multilin": 66, "multi_lin": [66, 113], "unix_lin": [66, 113], "uword": [66, 113], "error_on_unknown_escap": [66, 113], "entir": [66, 113], "metacharact": 66, "000a": [66, 113], "tr29": 66, "word_boundari": 66, "unrecogn": 66, "themselv": [66, 82, 113], "cpu": [66, 113], "poorli": [66, 113], "heap": [66, 113], "backtrack": [66, 113], "uregexpflag": 66, "uregex_8h": 66, "rearrang": 67, "ascend": 67, "descend": 67, "nondecreas": [67, 80], "nonincreas": [67, 80], "put": [67, 80, 99, 104], "stabl": [67, 80, 108, 109], "stl": [67, 80], "stable_sort": [67, 80], "ok": [67, 72, 80], "floor": [68, 104], "getopt": [68, 104], "use_length": [68, 85, 104], "dispatch": 68, "stri_trim_left": [68, 100], "screen": 68, "ud6c8": 68, "ubbfc": 68, "uc815": 68, "uc74c": 68, "\ud6c8\ubbfc\uc815\uc74c": 68, "\u1112\u116e\u11ab\u1106\u1175\u11ab\u110c\u1165\u11bc\u110b\u1173\u11b7": 68, "start_lipsum": 69, "lai": 69, "exercis": [69, 112], "zipf": 69, "discret": 69, "markov": 69, "model": [69, 99], "sappli": [69, 92, 106, 110], "tincidunt": [69, 112], "fermentum": [69, 112], "erat": 69, "penatibu": 69, "parturi": 69, "porta": 69, "qui": [69, 112], "mauri": [69, 112], "volutpat": 69, "nunc": 69, "urna": 69, "aliquet": [69, 87, 104], "nec": 69, "ero": [69, 112], "diam": 69, "molesti": 69, "sociosqu": 69, "etiam": [69, 87, 104, 112], "phasellu": 69, "di": 69, "arcu": [69, 112], "variu": 69, "donec": [69, 112], "ligula": 69, "sed": [69, 87, 88, 104, 112, 113], "tempor": [69, 112], "semper": 69, "ut": [69, 112], "pulvinar": 69, "sodal": 69, "ridiculu": [69, 112], "quam": 69, "tristiqu": 69, "facilisi": [69, 112], "lacinia": [69, 87, 88, 104, 112], "vestibulum": [69, 112], "dignissim": 69, "quisqu": 69, "cursu": 69, "ultrici": 69, "pretium": [69, 112], "molli": 69, "elementum": 69, "lacu": [69, 112], "augu": [69, 87, 88, 104], "velit": 69, "iaculi": 69, "egesta": [69, 112], "curabitur": [69, 112], "proin": [69, 88, 104], "vita": [69, 112], "vivamu": 69, "morbi": 69, "imperdiet": 69, "platea": 69, "himenaeo": 69, "luctu": 69, "feugiat": 69, "efficitur": 69, "maecena": 69, "malesuada": 69, "adipisc": 69, "leo": 69, "tortor": [69, 112], "sem": [69, 112], "sapien": [69, 112], "cubilia": 69, "nisl": 69, "porttitor": 69, "cura": 69, "magna": 69, "aliquam": [69, 112], "fame": 69, "pellentesqu": [69, 87, 104], "nibh": [69, 87, 88, 104, 112], "vel": [69, 87, 104, 112], "justo": 69, "turpi": [69, 112], "libero": 69, "natoqu": 69, "condimentum": 69, "massa": [69, 112], "finibu": 69, "pharetra": 69, "nulla": 69, "socii": [69, 112], "dictumst": [69, 112], "aptent": 69, "est": [69, 93], "dapibu": [69, 112], "conval": 69, "nequ": 69, "risu": 69, "faucibu": 69, "blandit": 69, "auctor": [69, 112], "bibendum": 69, "magni": [69, 112], "feli": [69, 112], "hac": [69, 112], "nisi": 69, "scelerisqu": [69, 87, 88, 104], "aenean": 69, "sollicitudin": 69, "matti": 69, "vulput": 69, "commodo": 69, "euismod": 69, "enim": 69, "nullam": 69, "puru": 69, "At": [69, 110], "viverra": 69, "torquent": [69, 112], "accumsan": 69, "habitass": [69, 112], "eget": [69, 112], "eleifend": 69, "primi": 69, "praesent": 69, "metu": [69, 112], "netu": [69, 112], "venenati": 69, "odio": [69, 112], "tellu": [69, 87, 104], "consequat": [69, 112], "dui": 69, "taciti": 69, "ullamcorp": [69, 112], "tempu": 69, "hendrerit": 69, "lectu": 69, "fringilla": 69, "rutrum": 69, "ant": [69, 112], "sagitti": [69, 112], "dictum": 69, "incepto": 69, "gravida": [69, 112], "habit": 69, "ex": [69, 112], "nam": [69, 112], "laoreet": 69, "maximu": 69, "cra": [69, 87, 104], "posuer": 69, "suscipit": [69, 87, 88, 104], "suspendiss": 69, "orci": 69, "loborti": 69, "rhoncu": [69, 112], "ultric": [69, 112], "nascetur": 69, "litora": 69, "nostra": 69, "mu": 69, "mont": 69, "cum": 69, "congu": 69, "fusc": [69, 112], "placerat": 69, "conubia": 69, "senectu": 69, "ornar": [69, 112], "vehicula": [69, 112], "interdum": 69, "peculiar": [70, 71, 79], "abcdefghi": 70, "cheidfbag": 70, "5096873241": 70, "rep": [70, 109], "bjyxtszeufhpogcwdrvmaliqkn": 70, "kafgjolxiqwmtpnhyucdbrzev": 70, "vumbrtgqlpfhniwkxeazjdocsi": 70, "irjhvgpqsobzayneumlfdkcxtw": 70, "yplrcekozfjnvmawxgqhtisbud": 70, "afwijgkuxrqonshelmcvdpbyzt": 70, "flircxuthpsygadwkjvmnzqebo": 70, "zqynmsjreatfhcloipvubdwgkx": 70, "kvyjzutiprsbclgfqonhmaedwx": 70, "eqjtmzfuaidpkxbchygsrlownv": 70, "draw": 71, "redund": [71, 110], "sampl": [71, 80, 108, 112], "probabl": 71, "hmpsw2wty": 71, "xsgz6tf2kx": 71, "tgdzehxah9": 71, "xtgn1tldje": 71, "8ppm98esgr": 71, "tnf5n": 71, "horoonr": 71, "kdi0t": 71, "dnbl6f": 71, "fpm6qztsa": 71, "\u014f\u1eb7\u0279\u1ebd\u0267": 71, "\u01b0\ua775\u0119\u1d6c\u1d8f": 71, "\u1e6f\u0270\u1d7d\ud837\udf01\u1d79": 71, "\uab54\ufb04\u1e7b\u02ac\u0169": 71, "\uff4e\u0259\u00f2\uff57\u2c79": 71, "\u0161\u1e21\ud837\udf01\u1e59\u02a8": 71, "\u1eaf\u0267\u025d\u01e7\u028c": 71, "\ud837\udf19\u0173\u0115\u0161\u1eef": 71, "\u1e8b\uab55\u1ed5\ua733\u1d96": 71, "\u1ec1\ua7b9\ua778\ud837\udf15\u1d12": 71, "password": 71, "3hgsajnqztagw": 71, "wjgmtzjcups4": 71, "k0msqhex9bozev": 71, "ftaj1dgf2a": 71, "8lxjpujohhc": 71, "unkx3ygc2qtho": 71, "o9otfpcn3x2g": 71, "aidxj0jyffdfoa": 71, "tkgrmalp2w": 71, "sffglwz7vkw": 71, "xtfrm": 72, "receiv": 72, "runif": [72, 85, 108], "0455565": 72, "5281055": 72, "2875775": 72, "4089769": 72, "8830174": 72, "8924190": 72, "7883051": 72, "9404673": 72, "ins": 73, "entireti": [73, 113], "abil": [73, 81, 105], "robust": [73, 111], "stri_split_lines1": [73, 74, 84, 111], "stri_replace_first": [76, 89, 107], "stri_replace_last": [76, 89, 107], "vectorise_al": [76, 107, 110], "stri_replace_first_charclass": 76, "stri_replace_last_charclass": 76, "stri_replace_all_col": 76, "stri_replace_first_col": 76, "stri_replace_last_col": 76, "stri_replace_first_fix": 76, "stri_replace_last_fix": 76, "stri_replace_all_regex": [76, 110, 113], "stri_replace_first_regex": 76, "stri_replace_last_regex": 76, "npattern": 76, "tc": 76, "l0rem": 76, "d0l0r": 76, "c0nsectetur": 76, "abaca": 76, "rexamin": 76, "xamin": 76, "quick": [76, 107], "fox": [76, 107], "jump": [76, 107], "lazi": [76, 107, 113], "dog": [76, 107], "slow": [76, 107], "black": 76, "bear": 76, "quicker": 76, "ag": 76, "str2": 77, "wherev": [77, 89, 90, 109, 113], "plain": [77, 113], "test1": 77, "cba": [79, 107, 109], "zxy": 79, "u0104123": 79, "321\u0105\u0105": 79, "yxz": 79, "stri_trans_nfd": [79, 97, 99, 111], "agonek": 79, "weakli": 80, "increas": [80, 108, 109], "0dz": 81, "001": 81, "002": [81, 114], "delimit": [82, 106, 107, 112], "token": [82, 83, 106, 107, 113], "remaind": [82, 83], "hand": [82, 83, 90, 95, 106, 109, 111, 113], "never": [82, 84, 113], "a_b_c_d": 82, "a_b_c__d": 82, "b_c__d": 82, "ab_c": 82, "d_ef_g": 82, "ab": [82, 96, 106], "ef": [82, 106], "0x0d": 84, "0x0a": 84, "crlf": 84, "next": [84, 106], "nel": 84, "0x85": 84, "unambigu": 84, "0x2029": 84, "0x2028": 84, "vertic": 84, "vt": 84, "0x0b": 84, "0x0c": 84, "utr": 84, "tr13": 84, "na_str": 85, "inf_str": 85, "inf": 85, "nan_str": 85, "nan": 85, "unsign": 85, "infin": 85, "123456": 85, "thousand": [85, 110], "later": 85, "unus": [85, 91], "dioxx": 85, "feeggaa": 85, "blank": 85, "invis": 85, "printf": 85, "archlinux": 85, "wikipedia": [85, 97, 99, 110], "wiki": [85, 97, 99, 110], "printf_format_str": 85, "3f": 85, "u00b2": 85, "exp": [85, 113], "e\u00b2": 85, "\u03c0": 85, "\u03c0\u00b2": 85, "xxabcd": 85, "u0106": 85, "u0107": [85, 97], "u0108": 85, "u200b": [85, 106, 112], "u0001f3f4": 85, "u000e0067": 85, "u000e0062": 85, "u000e0073": 85, "u000e0063": 85, "u000e0074": 85, "u000e007f": 85, "minimum": 85, "xx\u0105\u0107\u0107\u0109": 85, "xxa": 85, "xx\u0105": 85, "wrt": 85, "ifels": [85, 105], "2f": 85, "preformat": 85, "seq_along": 85, "u2718": 85, "u2713": 85, "na_real_": 85, "u0001f4a9": 85, "u221": 85, "000": [85, 111, 113], "1714986115": 85, "773750": 85, "77375": 85, "23456": 85, "asterisk": 85, "14159265358979": 85, "141593": 85, "77546": 85, "775460": 85, "stri_startswith_fix": [86, 107], "stri_endswith_fix": [86, 107], "stri_startswith_charclass": 86, "stri_endswith_charclass": 86, "stri_startswith_col": 86, "stri_endswith_col": 86, "meta": 86, "wspace": [86, 100], "a1": [86, 108], "a2": [86, 108], "b3": 86, "a4": 86, "c5": 86, "pat": 86, "u0635": 86, "u0644": 86, "u0649": 86, "u0627": 86, "u0647": 86, "u0639": 86, "u064a": 86, "u0648": 86, "u0633": 86, "u0645xyz": 86, "ufdfa": [86, 99], "ufdfaxyz": 86, "aggreg": [87, 88, 106], "linesnempti": 87, "char": 87, "charsnwhit": 87, "stuff": [87, 88], "stat": [87, 88], "orient": 88, "kile": 88, "sourceforg": 88, "team": 88, "php": 88, "charsword": 88, "charscmdenvir": 88, "charswhit": 88, "envir": 88, "textbf": 88, "textit": 88, "forward": [89, 90, 97, 107, 109], "mutual": [89, 90], "exclus": [89, 90, 106], "leav": [89, 90], "inject": 89, "front": 89, "prioriti": 89, "3456": [89, 90], "new_substr": 89, "stri_sub_all_replac": 90, "simplest": 90, "disjoint": 90, "stri_subset_fix": [91, 107], "stri_subset_charclass": 91, "stri_subset_col": 91, "stri_subset_regex": 91, "partial": [91, 109], "former": [91, 107, 109], "item": [91, 107, 113], "id456": 91, "display_typ": 92, "generic_short": 92, "generic_long": 92, "gmt_short": 92, "gmt_long": 92, "generic_loc": 92, "readabl": [92, 109, 113], "dst": [92, 93], "rawoffset": [92, 93], "offset": [92, 93], "usesdaylighttim": [92, 93], "europ": [92, 93, 94, 112], "summer": [92, 93], "stredoeur\u00f3pski": 92, "\u0161tandardn\u00fd": 92, "\u010da": 92, "letn\u00fd": 92, "london": [92, 93], "greenwich": [92, 93], "kingdom": 92, "na_integer_": 93, "area": 93, "coordin": 93, "interchang": [93, 99, 109], "concern": 93, "histor": [93, 108, 113], "vari": [93, 106, 107, 109], "throughout": 93, "closer": 93, "equat": 93, "half": 93, "northern": 93, "hemispher": 93, "southern": 93, "classicu_1_1timezon": [93, 94], "aet": 93, "africa": 93, "abidjan": 93, "accra": 93, "addis_ababa": 93, "algier": 93, "asmara": 93, "asmera": 93, "bamako": 93, "bangui": 93, "banjul": 93, "bissau": 93, "blantyr": 93, "brazzavil": 93, "bujumbura": 93, "cairo": 93, "casablanca": 93, "ceuta": 93, "conakri": 93, "dakar": 93, "dar_es_salaam": 93, "djibouti": 93, "douala": 93, "el_aaiun": 93, "freetown": 93, "gaboron": 93, "harar": 93, "johannesburg": 93, "juba": 93, "kampala": 93, "khartoum": 93, "kigali": 93, "kinshasa": 93, "lago": 93, "librevil": 93, "lome": 93, "luanda": 93, "lubumbashi": 93, "lusaka": 93, "malabo": 93, "maputo": 93, "maseru": 93, "mbaban": 93, "mogadishu": 93, "monrovia": 93, "nairobi": 93, "ndjamena": 93, "niamei": 93, "nouakchott": 93, "ouagadoug": 93, "porto": 93, "novo": 93, "sao_tom": 93, "timbuktu": 93, "tripoli": 93, "tuni": 93, "windhoek": 93, "agt": 93, "adak": 93, "anchorag": 93, "anguilla": 93, "antigua": 93, "araguaina": 93, "argentina": 93, "buenos_air": 93, "catamarca": 93, "comodrivadavia": 93, "cordoba": 93, "jujui": 93, "la_rioja": 93, "mendoza": 93, "rio_gallego": 93, "salta": 93, "san_juan": 93, "san_lui": 93, "tucuman": 93, "ushuaia": 93, "aruba": 93, "asuncion": 93, "atikokan": 93, "atka": 93, "bahia": 93, "bahia_bandera": 93, "barbado": 93, "belem": 93, "beliz": 93, "blanc": 93, "sablon": 93, "boa_vista": 93, "bogota": 93, "bois": 93, "cambridge_bai": 93, "campo_grand": 93, "cancun": 93, "caraca": 93, "cayenn": 93, "cayman": 93, "chicago": 93, "chihuahua": 93, "ciudad_juarez": 93, "coral_harbour": 93, "costa_rica": 93, "creston": 93, "cuiaba": 93, "curacao": 93, "danmarkshavn": 93, "dawson": 93, "dawson_creek": 93, "denver": 93, "detroit": 93, "dominica": 93, "edmonton": 93, "eirunep": 93, "el_salvador": 93, "ensenada": 93, "fort_nelson": 93, "fort_wayn": 93, "fortaleza": 93, "glace_bai": 93, "godthab": 93, "goose_bai": 93, "grand_turk": 93, "grenada": 93, "guadeloup": 93, "guatemala": 93, "guayaquil": 93, "guyana": 93, "halifax": 93, "havana": 93, "hermosillo": 93, "indiana": 93, "indianapoli": 93, "knox": 93, "marengo": 93, "petersburg": 93, "tell_citi": 93, "vevai": 93, "vincenn": 93, "winamac": 93, "inuvik": 93, "iqaluit": 93, "jamaica": 93, "juneau": 93, "kentucki": 93, "louisvil": 93, "monticello": 93, "knox_in": 93, "kralendijk": 93, "la_paz": 93, "lima": 93, "lower_princ": 93, "maceio": 93, "managua": 93, "manau": 93, "marigot": 93, "martiniqu": 93, "matamoro": 93, "mazatlan": 93, "menomine": 93, "merida": 93, "metlakatla": 93, "mexico_c": 93, "miquelon": 93, "moncton": 93, "monterrei": 93, "montevideo": 93, "montreal": 93, "montserrat": 93, "nassau": 93, "new_york": 93, "nipigon": 93, "nome": 93, "noronha": 93, "north_dakota": 93, "beulah": 93, "new_salem": 93, "nuuk": 93, "ojinaga": 93, "panama": 93, "pangnirtung": 93, "paramaribo": 93, "phoenix": 93, "port_of_spain": 93, "port": 93, "au": 93, "princ": 93, "porto_acr": 93, "porto_velho": 93, "puerto_rico": 93, "punta_arena": 93, "rainy_riv": 93, "rankin_inlet": 93, "recif": 93, "regina": 93, "resolut": 93, "rio_branco": 93, "rosario": 93, "santa_isabel": 93, "santarem": 93, "santiago": 93, "santo_domingo": 93, "sao_paulo": 93, "scoresbysund": 93, "shiprock": 93, "sitka": 93, "st_barthelemi": 93, "st_john": 93, "st_kitt": 93, "st_lucia": 93, "st_thoma": 93, "st_vincent": 93, "swift_curr": 93, "tegucigalpa": 93, "thule": 93, "thunder_bai": 93, "tijuana": 93, "toronto": 93, "tortola": 93, "vancouv": 93, "virgin": 93, "whitehors": 93, "winnipeg": 93, "yakutat": 93, "yellowknif": 93, "antarctica": 93, "casei": 93, "davi": 93, "dumontdurvil": 93, "macquari": 93, "mawson": 93, "mcmurdo": 93, "palmer": 93, "rothera": 93, "south_pol": 93, "syowa": 93, "troll": 93, "vostok": 93, "arctic": 93, "longyearbyen": 93, "art": 93, "asia": 93, "aden": 93, "almati": 93, "amman": 93, "anadyr": 93, "aqtau": 93, "aqtob": 93, "ashgabat": 93, "ashkhabad": 93, "atyrau": 93, "baghdad": 93, "bahrain": 93, "baku": 93, "bangkok": 93, "barnaul": 93, "beirut": 93, "bishkek": 93, "brunei": 93, "calcutta": 93, "chita": 93, "choibalsan": 93, "chongq": 93, "chungk": 93, "colombo": 93, "dacca": 93, "damascu": 93, "dhaka": 93, "dili": 93, "dubai": 93, "dushanb": 93, "famagusta": 93, "gaza": 93, "harbin": 93, "hebron": 93, "ho_chi_minh": 93, "hong_kong": 93, "hovd": 93, "irkutsk": 93, "istanbul": 93, "jakarta": 93, "jayapura": 93, "jerusalem": 93, "kabul": 93, "kamchatka": 93, "karachi": 93, "kashgar": 93, "kathmandu": 93, "katmandu": 93, "khandyga": 93, "kolkata": 93, "krasnoyarsk": 93, "kuala_lumpur": 93, "kuch": 93, "kuwait": 93, "macao": 93, "macau": 93, "magadan": 93, "makassar": 93, "manila": 93, "muscat": 93, "nicosia": 93, "novokuznetsk": 93, "novosibirsk": 93, "omsk": 93, "oral": 93, "phnom_penh": 93, "pontianak": 93, "pyongyang": 93, "qatar": 93, "qostanai": 93, "qyzylorda": 93, "rangoon": 93, "riyadh": 93, "saigon": 93, "sakhalin": 93, "samarkand": 93, "seoul": 93, "shanghai": 93, "singapor": 93, "srednekolymsk": 93, "taipei": 93, "tashkent": 93, "tbilisi": 93, "tehran": 93, "tel_aviv": 93, "thimbu": 93, "thimphu": 93, "tokyo": 93, "tomsk": 93, "ujung_pandang": 93, "ulaanbaatar": 93, "ulan_b": 93, "urumqi": 93, "ust": 93, "nera": 93, "vientian": 93, "vladivostok": 93, "yakutsk": 93, "yangon": 93, "yekaterinburg": 93, "yerevan": 93, "atlant": 93, "azor": 93, "bermuda": 93, "canari": 93, "cape_verd": 93, "faero": 93, "faro": 93, "jan_mayen": 93, "madeira": 93, "reykjavik": 93, "south_georgia": 93, "st_helena": 93, "stanlei": 93, "australia": [93, 110], "adelaid": 93, "brisban": 93, "broken_hil": 93, "canberra": 93, "curri": 93, "darwin": 93, "eucla": 93, "hobart": 93, "lhi": 93, "lindeman": 93, "lord_how": 93, "melbourn": [93, 110, 114], "north": 93, "nsw": 93, "perth": 93, "queensland": 93, "south": 93, "sydnei": 93, "tasmania": 93, "victoria": 93, "west": 93, "yancowinna": 93, "bet": 93, "brazil": 93, "acr": 93, "denoronha": 93, "east": [93, 103], "bst": 93, "canada": 93, "saskatchewan": 93, "eastern": 93, "mountain": 93, "newfoundland": 93, "yukon": 93, "chile": 93, "continent": 93, "easterisland": 93, "cnt": 93, "cst": 93, "cst6cdt": 93, "ctt": [93, 112], "cuba": 93, "eat": 93, "ect": [93, 113], "eet": 93, "egypt": 93, "eir": 93, "est5edt": 93, "gmt0": 93, "uct": 93, "zulu": 93, "amsterdam": 93, "andorra": 93, "astrakhan": 93, "athen": 93, "belfast": 93, "belgrad": 93, "berlin": 93, "bratislava": 93, "brussel": 93, "bucharest": 93, "budapest": 93, "busingen": 93, "chisinau": 93, "copenhagen": 93, "dublin": 93, "gibraltar": 93, "guernsei": 93, "helsinki": 93, "isle_of_man": 93, "jersei": 93, "kaliningrad": 93, "kiev": 93, "kirov": 93, "kyiv": 93, "lisbon": 93, "ljubljana": 93, "luxembourg": 93, "madrid": 93, "malta": 93, "mariehamn": 93, "minsk": 93, "monaco": 93, "moscow": 93, "oslo": 93, "pari": 93, "podgorica": 93, "pragu": 93, "riga": 93, "rome": 93, "samara": 93, "san_marino": 93, "sarajevo": 93, "saratov": 93, "simferopol": 93, "skopj": 93, "sofia": 93, "stockholm": 93, "tallinn": 93, "tiran": 93, "tiraspol": 93, "ulyanovsk": 93, "uzhgorod": 93, "vaduz": 93, "vatican": 93, "vienna": 93, "vilniu": 93, "volgograd": 93, "zagreb": 93, "zaporozhy": 93, "zurich": 93, "factori": 93, "hongkong": 93, "hst": 93, "iceland": 93, "iet": 93, "antananarivo": 93, "chago": 93, "christma": 93, "coco": 93, "comoro": 93, "kerguelen": 93, "mahe": 93, "maldiv": 93, "mauritiu": 93, "mayott": 93, "reunion": 93, "iran": 93, "israel": 93, "ist": [93, 108], "japan": 93, "jst": 93, "kwajalein": 93, "libya": 93, "mexico": 93, "bajanort": 93, "bajasur": 93, "mit": 93, "mst": 93, "mst7mdt": 93, "navajo": 93, "net": [93, 114], "nst": 93, "nz": [93, 112, 114], "chat": 93, "apia": 93, "auckland": 93, "bougainvil": 93, "chatham": 93, "chuuk": 93, "easter": 93, "efat": 93, "enderburi": 93, "fakaofo": 93, "fiji": 93, "funafuti": 93, "galapago": 93, "gambier": 93, "guadalcan": 93, "guam": 93, "honolulu": 93, "johnston": 93, "kanton": 93, "kiritimati": 93, "kosra": 93, "majuro": 93, "marquesa": 93, "midwai": 93, "nauru": 93, "niue": 93, "norfolk": 93, "noumea": 93, "pago_pago": 93, "palau": 93, "pitcairn": 93, "pohnpei": 93, "ponap": 93, "port_moresbi": 93, "rarotonga": 93, "saipan": 93, "samoa": 93, "tahiti": 93, "tarawa": 93, "tongatapu": 93, "truk": 93, "wake": 93, "walli": 93, "yap": 93, "plt": 93, "pnt": 93, "poland": 93, "portug": 93, "prc": 93, "prt": 93, "pst": 93, "pst8pdt": 93, "roc": 93, "rok": 93, "sst": 93, "systemv": 93, "ast4": 93, "ast4adt": 93, "cst6": 93, "est5": 93, "hst10": 93, "mst7": 93, "pst8": 93, "yst9": 93, "yst9ydt": 93, "turkei": 93, "alaska": 93, "aleutian": 93, "arizona": 93, "hawaii": 93, "stark": 93, "michigan": 93, "vst": 93, "wet": 93, "rbind": 93, "lappli": 93, "brasilia": 93, "paraguai": 93, "amazon": 93, "colombia": 93, "venezuela": 93, "guiana": 93, "greenland": 93, "ecuador": 93, "mexican": 93, "bolivia": 93, "peru": 93, "st": 93, "pierr": 93, "uruguai": 93, "fernando": 93, "surinam": 93, "dumont": 93, "urvil": 93, "zealand": 93, "arabia": 93, "kazakhstan": 93, "turkmenistan": 93, "azerbaijan": 93, "indochina": 93, "kyrgyzstan": 93, "darussalam": 93, "india": 93, "china": 93, "bangladesh": 93, "timor": 93, "gulf": 93, "tajikistan": 93, "hong": 93, "kong": 93, "indonesia": 93, "afghanistan": 93, "petropavlovsk": 93, "kamchatski": 93, "pakistan": 93, "nepal": 93, "malaysia": 93, "philippin": 93, "myanmar": [93, 98], "uzbekistan": 93, "georgia": 93, "bhutan": 93, "armenia": 93, "cape": 93, "verd": 93, "falkland": 93, "island": 93, "lord": 93, "ocean": 93, "antarct": 93, "seychel": 93, "r\u00e9union": 93, "marshal": 93, "vanuatu": 93, "tokelau": 93, "tuvalu": 93, "solomon": 93, "chamorro": 93, "caledonia": 93, "papua": 93, "guinea": 93, "cook": 93, "gilbert": 93, "tonga": 93, "futuna": 93, "morocco": 93, "romanc": 93, "sudan": 93, "sao": 93, "tome": 93, "namibia": 93, "alaskan": 93, "tocantin": 93, "brazilian": 93, "turk": 93, "And": [93, 108, 109], "caico": 93, "saint": 93, "haiti": 93, "magallan": 93, "jordan": 93, "russia": 93, "altai": 93, "transbaik": 93, "sri": 93, "lanka": 93, "syria": 93, "arabian": 93, "gtb": 93, "bank": 93, "mongolia": 93, "korea": 93, "georgian": [93, 98], "ekaterinburg": 93, "caucasu": 93, "cen": 93, "irish": 93, "hawaiian": 93, "datelin": 93, "fle": 93, "belaru": 93, "oldtz": 94, "stri_trans_toupp": [95, 97, 112], "worth": [95, 113], "surround": [95, 110], "rest": 95, "casemap": 95, "scharf": 95, "\u0105\u0105": 95, "WItH": 95, "attach": 95, "id_123": 96, "babaab": 96, "101001": 96, "gcuacggagcuucggagcuag": 96, "tgca": [96, 112], "cgutgcctcguugcctcgutc": 96, "varieti": 97, "halfwidth": [97, 98], "semicolon": [97, 108], "mainli": 97, "broader": 97, "prebuilt": 97, "step": 97, "restrict": 97, "achiev": [97, 113], "analog": 97, "composit": [97, 99, 111], "nfkd": [97, 98, 99, 108, 111], "\u03c3\u03c4\u03c1\u03b9\u03b3\u03b3\u03b9": 97, "\u0441\u0442\u0440\u0438\u043d\u0433\u0438": 97, "u0105golewski": 97, "pl_fonipa": [97, 98], "mar\u025bk": 97, "\u0261\u0254\u014b\u0261\u0254l\u025bfski": 97, "u2620": 97, "skull": 97, "AND": 97, "crossbon": 97, "u201c": 97, "u2026": 97, "u201d": 97, "u015b": 97, "u017c": [97, 109], "nfc": [97, 98, 99, 103, 111], "\u0105\u015b\u0107\u017c": 97, "uc885": 97, "ub85c": 97, "uad6c": 97, "uc0ac": 97, "uc9c1": 97, "ub3d9": 97, "hangul": [97, 98, 103], "jonglogu": 97, "sajigdong": 97, "deviat": 97, "romanis": [97, 112], "romanization_of_korean": 97, "u11a8": 97, "u11a": 97, "u11b8": 97, "u1105": 97, "jongrogu": 97, "sajikdong": 97, "am_brai": 98, "am_ethi": 98, "gemin": 98, "d0_mors": 98, "am_fonipa": 98, "am_latn": 98, "bgn": 98, "amhar": 98, "ar_latn": 98, "armenian": 98, "armn": 98, "be_latn": 98, "beng": 98, "bengali": 98, "bg_latn": 98, "blt_fonipa": 98, "bopo": 98, "bopomofo": 98, "braill": 98, "byn_ethi": 98, "tekie_alibekit": 98, "xaleget": 98, "byn_latn": 98, "canadianaborigin": 98, "ch_fonipa": 98, "chr_fonipa": 98, "cs_fonipa": 98, "cy_fonipa": 98, "cyrl": 98, "gutgart": 98, "deva": [98, 112], "devanagari": 98, "dsb_fonipa": 98, "dv_latn": 98, "el_latn": 98, "eo_fonipa": 98, "es_419_fonipa": 98, "es_fonipa": 98, "ethi": 98, "ethiop": 98, "aethiopica": 98, "alaloc": 98, "beta_metsehaf": 98, "ies_jes_1964": 98, "lambdin": 98, "sera": 98, "williamson": 98, "xalaget": 98, "fa_fonipa": 98, "fa_latn": 98, "fcc": 98, "geor": 98, "ungegn": 98, "grek": 98, "gujarati": 98, "gujr": 98, "gurmukhi": 98, "guru": [98, 112], "gz_ethi": 98, "hang": 98, "han": 98, "hant": 98, "he_latn": 98, "hebr": 98, "xml10": 98, "hira": 98, "hy_arevmda_fonipa": 98, "hy_fonipa": 98, "hy_latn": 98, "ia_fonipa": 98, "jamo": [98, 103], "ka_latn": 98, "bgn_1981": 98, "kannada": 98, "kk_fonipa": 98, "kk_latn": 98, "knda": 98, "ky_fonipa": 98, "ky_latn": 98, "la_fonipa": 98, "latn": 98, "malayalam": 98, "mk_latn": 98, "mlym": 98, "mn_latn": 98, "my_fonipa": 98, "my_latn": 98, "nfkc": [98, 99, 108, 111], "nv_fonipa": 98, "oriya": 98, "orya": [98, 112], "ps_latn": 98, "rm_fonipa_sursilv": 98, "ro_fonipa": 98, "ru_latn": 98, "sarb": 98, "sat_fonipa": 98, "sgw_ethi": 98, "gurage_2013": 98, "si_fonipa": 98, "si_latn": 98, "sk_fonipa": 98, "syrc": 98, "syriac": 98, "ta_fonipa": 98, "tamil": [98, 112], "taml": [98, 112], "telu": 98, "telugu": 98, "thaa": 98, "thaana": 98, "ug_fonipa": 98, "uk_latn": 98, "und_fonipa": [98, 112], "und_fonxsamp": 98, "vec_fonipa": 98, "xh_fonipa": 98, "zu_fonipa": 98, "azerbaijani": 98, "belarusian": 98, "blt": 98, "bulgarian": 98, "burmes": 98, "tone": 98, "dv": 98, "aethiopi": 98, "aethiopi_gemin": 98, "alaloc_gemin": 98, "beta_metsehaf_gemin": 98, "es3842": 98, "ies_jes_1964_gemin": 98, "gurag": 98, "aethiopica_gemin": 98, "betametsehaf_gemin": 98, "fullwidth": 98, "geez": 98, "musnad": 98, "hani": 98, "hy_arevmda": 98, "xsampa": 98, "ja_hrkt": 98, "ja_latn": 98, "kazakh": 98, "kirghiz": 98, "ko_latn": 98, "la": [98, 112], "numericpinyin": 98, "macedonian": 98, "maldivian": 98, "mongolian": 98, "zawgyi": 98, "pinyin": 98, "nv": 98, "pashto": 98, "rm_sursilv": 98, "serbian": [98, 108], "tk_cyrl": 98, "tlh": 98, "tlh_fonipa": 98, "turkmen": 98, "ukrainian": 98, "uzbek": 98, "zh_latn_pinyin": 98, "nfkc_casefold": 99, "stri_trans_nfkc": 99, "stri_trans_nfkc_casefold": 99, "stri_trans_isnfc": 99, "stri_trans_isnfd": 99, "stri_trans_isnfkd": 99, "stri_trans_isnfkc": 99, "stri_trans_isnfkc_casefold": 99, "formal": [99, 103], "essenti": 99, "decomposit": [99, 108, 111], "nf": 99, "w3c": 99, "aris": 99, "web": [99, 110], "rfc5198": 99, "tr15": 99, "network": 99, "w3": 99, "charmod": 99, "norm": 99, "unicode_equival": 99, "codepoint": [99, 108], "\u0635\u0644\u0649": 99, "\u0627\u0644\u0644\u0647": 99, "\u0639\u0644\u064a\u0647": 99, "\u0648\u0633\u0644\u0645": 99, "unnecessari": 100, "stri_trim_right": 100, "contrari": [100, 104, 111, 113], "retain": 100, "adjust": 100, "bitcoin": 100, "mask": 101, "0x1f": 101, "bewar": 101, "u0032": 101, "a\u0105": 101, "\u0105": [102, 108, 109, 111, 113], "gro\u00df": [102, 107, 108, 112, 113], "mono": 103, "font": [103, 106, 111], "cl": 103, "cam": 103, "mgk25": 103, "wcwidth": 103, "nodej": 103, "node": [103, 110], "blob": 103, "node_i18n": 103, "uax": 103, "proce": 103, "medial": 103, "vowel": 103, "conson": 103, "enumer": [103, 109, 113], "uchar_hangul_syllable_typ": 103, "u_hst_vowel_jamo": 103, "u_hst_trailing_jamo": 103, "200b": [103, 106], "u_ea_fullwidth": 103, "u_ea_wid": 103, "00ad": 103, "asian": 103, "tr11": 103, "u0001f606": 103, "0x3000": 103, "0xff01": 103, "0xff5e": 103, "ubc1f": 103, "cost_expon": [104, 112], "reformat": 104, "expon": 104, "aesthet": 104, "subsequ": [104, 106], "arrang": 104, "evenli": 104, "plass": [104, 114], "practic": [104, 114], "1981": [104, 114], "pp": 104, "writelin": 105, "noteworthi": [105, 109, 113], "review": 106, "entiti": [106, 108], "\u4f60\u597d": 106, "carri": [106, 113], "4f60": 106, "597d": 106, "greet": 106, "compris": [106, 108, 113], "5th": [106, 109], "undefin": 106, "sweav": [106, 112], "knitr": [106, 112, 114], "estim": 106, "occupi": 106, "monospac": 106, "cell": [106, 110], "said": 106, "tasti": 106, "delici": 106, "yummi": 106, "y2a": 106, "z3a": 106, "x4a": 106, "y5a": 106, "z6a": 106, "paste0": 106, "x_1_a": 106, "y_2_a": 106, "z_3_a": 106, "x_4_a": 106, "y_5_a": 106, "z_6_a": 106, "implicitli": 106, "graham": [106, 109], "chapman": [106, 109, 114], "clees": [106, 109], "terri": [106, 109], "gilliam": [106, 109], "eric": [106, 109], "idl": [106, 109], "michael": [106, 109], "palin": [106, 109], "outer": [106, 109, 113], "product": [106, 109], "bb": 106, "dddd": 106, "negg": 106, "buckwheat": 106, "fulfil": 106, "essenc": 106, "18th": 106, "12th": 106, "15th": 106, "deeper": 106, "sorghum": 106, "orgh": 106, "ghu": 106, "flexibl": 106, "stri_sub_list": 106, "fed": 106, "from_to": 106, "label": [106, 110], "ncol": [106, 109, 110], "abcdefgh": 106, "ijklmnop": 106, "op": 106, "gh": 106, "mapa": 106, "anobc": 106, "uvw": 106, "axcd": 106, "abcuvw": 106, "uu": 106, "wwww": 106, "azcz": 106, "uuabvewwww": 106, "7th": [106, 109], "syntact": 106, "sugar": 106, "face": 107, "nucleotid": 107, "dna": 107, "profil": 107, "uuid": 107, "simplic": [107, 109], "quickli": 107, "manner": [107, 109, 111, 113], "actg": [107, 109, 112], "actga": 107, "five": 107, "operand": [107, 109], "kmp": 107, "notabl": 107, "descript": 107, "soon": [107, 113], "abcabcdefabcabcabdc": 107, "grep": [107, 113], "needl": [107, 109], "haystack": [107, 109], "redirect": 107, "simplist": 107, "actgacgacgggacg": 107, "acg": 107, "acatgacaca": 107, "xyzabc": 107, "uabdc": 107, "dab": [107, 109], "why": 107, "specialis": [107, 112], "respons": 107, "twice": [107, 109], "particularli": 107, "programmat": 107, "fly": 107, "pinpoint": [107, 110, 113], "agagagagaga": 107, "yearn": 107, "answer": 107, "constitut": [107, 108, 111], "fine": 107, "ggagagagagaca": 107, "agagagaga": 107, "gaca": 107, "yellow": 107, "hen": 107, "spamiti": [107, 112, 113], "llama": 107, "supersed": 107, "repeat": [107, 113], "forth": [107, 109, 110, 113], "nlp": 107, "extent": [107, 109], "anchor": 107, "pointwis": [108, 113], "involv": 108, "nowadai": [108, 113], "approach": 108, "basi": [108, 113], "meet": 108, "proceed": 108, "parameteris": 108, "speaker": 108, "eng": 108, "spa": [108, 113], "spanish": [108, 113], "zho": 108, "masai": 108, "lack": 108, "vocabulari": 108, "measur": 108, "toward": 108, "de_de_preeuro": 108, "deutsch": 108, "dem": 108, "high": [108, 109, 110, 111], "chosen": 108, "gnu": [108, 109], "sporad": 108, "2021": [108, 111, 112], "metric": 108, "WITH": 108, "0061": [108, 113], "0328": 108, "render": 108, "glyph": 108, "u0328": [108, 111], "g\u0105golewski": [108, 113], "u0328golewski": 108, "chaotic": 108, "ch\u0142odni": 108, "hardi": 108, "goe": 108, "beyond": 108, "contract": 108, "cichi": 108, "cenni": 108, "expans": 108, "german_k_word": 108, "k\u00f6nnen": 108, "kondensieren": 108, "kochen": 108, "korrelieren": 108, "phone": 108, "book": 108, "\u00f6": 108, "oe": 108, "go": 108, "neglig": 108, "attent": 108, "fb00": 108, "nest": 108, "inter": 108, "strongest": 108, "mismatch": 108, "deem": 108, "u1e9": 108, "\u00df": [108, 113], "csa": 108, "z243": 108, "cote": 108, "c\u00f4te": 108, "cot\u00e9": 108, "c\u00f4t\u00e9": 108, "immedi": 108, "a11": 108, "a99": 108, "a10": 108, "a100": 108, "a9": 108, "nonneg": 108, "dealt": 108, "528105": 108, "940467": 108, "408977": 108, "045556": 108, "551435": 108, "456615": 108, "788305": 108, "892419": 108, "287578": 108, "883017": 108, "decreasingli": 108, "looser": 108, "\u00bc": 108, "00bc": 108, "\u211d": 108, "favourit": 108, "fuzzi": 108, "stringdist": 108, "utilis": 108, "albeit": 108, "er": [108, 113], "je": 108, "help": [108, 112, 113], "polish_poland": [108, 109], "rhl": 108, "fairli": 109, "2012": 109, "thin": 109, "ground": 109, "abund": 109, "workhors": 109, "safe": 109, "namespac": 109, "clash": 109, "self": 109, "explanatori": 109, "enter": 109, "apostroph": 109, "classic": 109, "scalar": 109, "typeof": 109, "strategi": 109, "loop": 109, "maintain": [109, 113], "ariti": 109, "oftentim": [109, 113], "crucial": 109, "prototyp": 109, "strrep": 109, "mappli": 109, "multipli": 109, "obviou": [109, 111], "unawar": 109, "unintuit": 109, "illustr": 109, "abcabc": 109, "abdc": 109, "abcdeabc": 109, "grid": 109, "nrow": [109, 110], "aab": 109, "abb": 109, "acb": 109, "aac": 109, "acc": 109, "baa": [109, 113], "bba": 109, "bca": 109, "bbb": 109, "bcb": 109, "bac": 109, "bbc": 109, "bcc": 109, "caa": 109, "cca": 109, "cab": 109, "cbb": 109, "ccb": 109, "cac": 109, "cbc": 109, "dimnam": [109, 110, 113], "flat": 109, "fortran": 109, "sought": [109, 113], "8th": 109, "6th": 109, "9th": 109, "structur": [109, 110, 111, 113], "cartesian": 109, "bx2": 109, "cx1": 109, "prone": 109, "jam": [109, 113], "grepl": 109, "furthermor": [109, 113], "despit": 109, "reduc": 109, "coher": 109, "coverag": 109, "tradition": 109, "scope": 109, "plenti": 109, "pcre": [109, 113], "setlocal": 109, "gregexpr": [109, 113], "tre": [109, 113], "aezaez\u0105\u0119\u017c\u0105\u0119\u017c": 109, "aezaez": 109, "u0118": 109, "u017b": 109, "\u0119": 109, "\u017c": 109, "author": [109, 113], "scratch": 109, "microbenchmark": 109, "join2": 109, "join3": 109, "r_paste2": 109, "r_paste3": 109, "expr": 109, "lq": 109, "median": 109, "uq": 109, "neval": 109, "064": 109, "088": 109, "acca": 109, "r_tre": 109, "r_pcre": 109, "r_fix": 109, "9861": 109, "0658": 109, "1497": 109, "1666": 109, "4805": 109, "5586": 109, "5049": 109, "6874": 109, "1632": 109, "6454": 109, "9504": 109, "4606": 109, "9660": 109, "3722": 109, "0878": 109, "4128": 109, "8794": 109, "7429": 109, "0573": 109, "8115": 109, "2062": 109, "8814": 109, "5560": 109, "8478": 109, "7709": 109, "9305": 109, "0572": 109, "061": 109, "1899": 109, "3638": 109, "themself": 109, "scienc": [109, 114], "expos": 109, "pick": 109, "studi": 110, "scrape": 110, "analys": [110, 111, 113], "climat": 110, "settlement": 110, "lists_of_c": 110, "harvest": 110, "relev": 110, "temperatur": 110, "precipit": 110, "harm": 110, "focu": 110, "vic": 110, "xml2": 110, "rvest": 110, "2020": [110, 112, 113], "tree": [110, 111], "read_html": 110, "20200917_wikipedia_melbourn": 110, "all_tabl": 110, "text_tabl": 110, "html_node": 110, "html_text": 110, "len": 110, "strict": 110, "preview": 110, "melbournevictoriafrom": 110, "flind": 110, "__truncated__": 110, "temp": 110, "annual": 110, "rainfal": 110, "offic": 110, "birth": 110, "birthplac": 110, "npop": 110, "idx": 110, "html_tabl": 110, "record": 110, "averag": 110, "daili": 110, "low": [110, 113], "inch": 110, "raini": 110, "1mm": 110, "afternoon": 110, "humid": 110, "monthli": 110, "sunshin": 110, "bureau": 110, "meteorologi": 110, "evid": [110, 113], "subject": 110, "sake": 110, "2212": 110, "difficult": [110, 112], "simpler": 110, "comma": 110, "jun": 110, "2191": 110, "dispos": [110, 113], "jul": 110, "sum": 110, "6463": 110, "chart": 111, "popular": 111, "setdiff": 111, "0x10ffff": 111, "0xd800": 111, "0xf8ff": 111, "131241": 111, "2155": 111, "1791": 111, "7564": 111, "134564": 111, "unalloc": 111, "occasion": 111, "recent": 111, "supplement": 111, "007f": [111, 113], "007a": [111, 113], "u007a": 111, "u0000007a": 111, "z\u00df\u4f60\u597d": 111, "u4f60": 111, "u597d": 111, "devic": 111, "unabl": 111, "ram": 111, "disk": 111, "abz0\u0105\u00df\u4f60\u597d": 111, "7a": 111, "c3": 111, "9f": 111, "e4": 111, "bd": 111, "a0": 111, "e5": 111, "a5": 111, "df": 111, "4f": [111, 112], "7d": 111, "scan": 111, "associ": 111, "importantli": 111, "proven": 111, "pipelin": 111, "w3tech": 111, "nevertheless": [111, 112, 113], "es_latin1": 111, "head": 111, "canto": 111, "cal\u00edop": 111, "miguel": 111, "cervant": 111, "al": [111, 113], "dulc": 111, "son": 111, "templada": 111, "lira": 111, "prestad": 111, "pastor": 111, "o\u00eddo": 111, "atento": 111, "aid": 111, "4e": 111, "4c": 111, "2d": 111, "Then": 111, "chanc": 111, "destin": 111, "tail": 111, "spoiler": 111, "alert": 111, "homero": 111, "iguala": 111, "escrebir": 111, "intenta": 111, "tanto": 111, "llega": 111, "pluma": 111, "vuelo": 111, "cuanto": 111, "verdad": 111, "que": 111, "todo": 111, "notorio": 111, "alto": 111, "ingenio": 111, "don": 111, "diego": 111, "osorio": 111, "ve": 111, "idea": 111, "url": [111, 113, 114], "distinct": [111, 113], "subscript": 111, "superscript": 111, "r\u00b2": 111, "r2": 111, "runtim": 111, "okai": 111, "sequel": 112, "segment": 112, "stri_extract__boundari": 112, "stri_locate__boundari": 112, "stri_extract__word": 112, "hovercraft": 112, "eel": 112, "pretti": 112, "reach": 112, "centr": 112, "love": 112, "minimis": 112, "rewrit": 112, "u200b\u0105\u00df\u00b2": 112, "\u0105\u00df\u00b2": 112, "1416": 112, "placehold": 112, "uniformli": 112, "ct": 112, "agtg": 112, "ctcgg": 112, "ataact": 112, "\uff90\uff6e\u31ff\ud82c\udd67\uff67\uff71\u30fe\u31f7": 112, "broad": 112, "ii\u0307": 112, "\u0131i": 112, "ijsvrij": 112, "yoghurt": 112, "gataaatctggtcttatttcc": 112, "ctatttagaccagaataaagg": 112, "catalogu": 112, "brows": 112, "\u017c\u00f3\u0142\u0107": 112, "ni\u00f1a": 112, "k\u00f6sz\u00f6n\u00f6m": 112, "zolc": 112, "nina": 112, "koszonom": 112, "godz": 112, "easi": 112, "datetime_relative_long": 112, "tomorrow": 112, "nzdt": 112, "5780": 112, "5781": 112, "date_ful": 112, "\u4ee4\u548c2\u5e742\u67084\u65e5\u706b\u66dc\u65e5": 112, "\u4ee4\u548c2\u5e748\u67087\u65e5\u91d1\u66dc\u65e5": 112, "grammar": 113, "systemat": 113, "scientif": 113, "telephon": [113, 114], "email": 113, "finit": [113, 114], "automata": [113, 114], "present": 113, "qed": [113, 114], "predecessor": 113, "pcre2": 113, "ore": 113, "re2r": 113, "re2": 113, "although": 113, "facet": 113, "recurs": 113, "kate": 113, "eclips": 113, "vscode": 113, "rstudio": 113, "instrument": 113, "scientist": 113, "summaris": 113, "perspect": 113, "suffix": 113, "unrecognis": 113, "trigger": 113, "straightforward": 113, "doesn": 113, "behav": 113, "backlash": 113, "unescap": 113, "ham": 113, "njam": 113, "motiv": 113, "member": 113, "mathtt": 113, "hj": 113, "nobodi": 113, "inquisit": 113, "nob": 113, "odi": 113, "ni": 113, "inq": 113, "ui": 113, "iti": 113, "assign": 113, "fun": 113, "nicod": 113, "a\u0105b\u00df\u00e6a\u0105b\u4f60123": 113, "\u00b2\u00b3\u00be": 113, "\u00e6": 113, "\u4f60": 113, "\u00b2": 113, "\u00b3": 113, "\u00be": 113, "regmatch": 113, "belonging": 113, "reader": 113, "branch": 113, "alga": 113, "amalgam": 113, "dent": 113, "sp": 113, "question": 113, "parser": 113, "sophist": 113, "subfrag": 113, "presenc": 113, "baaa": 113, "bababa": 113, "altogeth": 113, "spamamamnomnomnomammmmmmmmm": 113, "nom": 113, "spamamamnomnomnomam": 113, "stress": 113, "901234": 113, "nondeterminist": 113, "automaton": 113, "exponenti": 113, "aaaaac": 113, "trycatch": 113, "1e5": 113, "elaps": 113, "reformul": 113, "consum": 113, "characterist": 113, "sir": 113, "launcelot": 113, "quest": 113, "grail": 113, "favecolour": 113, "blue": 113, "stri_locate__regex": 113, "caught": 113, "dollar": 113, "strong": 113, "em": 113, "tag": 113, "tagnam": 113, "lastli": 113, "anywher": 113, "didact": 113, "j23": 113, "629cm": 113, "research": 114, "2023": 114, "zenodo": 114, "isbn": 114, "6455719": 114, "deepr": 114, "5281": 114, "7490464": 114, "hock": 114, "2019": 114, "namedcaptur": 114, "hopcroft": 114, "ullman": 114, "1979": 114, "theori": 114, "addison": 114, "weslei": 114, "kleen": 114, "1951": 114, "event": 114, "nerv": 114, "rand": 114, "corpor": 114, "santa": 114, "monica": 114, "dam": 114, "pub": 114, "research_memoranda": 114, "rm704": 114, "1977": 114, "siam": 114, "rabin": 114, "scott": 114, "1959": 114, "decis": 114, "ritchi": 114, "thompson": 114, "70107": 114, "laboratori": 114, "wayback": 114, "20150203071645": 114, "cm": 114, "lab": 114, "dmr": 114, "qedman": 114, "2010": 114, "odern": 114, "\u00e7etinkaya": 114, "rundel": 114, "grolemund": 114, "r4d": 114, "xie": 114, "hall": 114, "crc": 114}, "objects": {}, "objtypes": {}, "objnames": {}, "titleterms": {"stringi": [0, 1, 3, 6, 12], "fast": [0, 13], "portabl": [0, 13], "charact": [0, 5, 9, 12, 13, 14, 30, 31, 33, 37, 51, 54, 75, 77, 87, 88, 89, 96, 100, 111, 112, 113], "string": [0, 7, 10, 13, 15, 17, 24, 28, 38, 41, 42, 43, 44, 48, 50, 52, 61, 68, 70, 71, 75, 78, 79, 80, 82, 83, 84, 85, 86, 95, 100, 106, 107, 108, 111, 112, 113], "process": [0, 1, 13], "r": [0, 3, 5, 13, 109], "instal": 1, "icu4c": 1, "customis": 1, "build": 1, "get": [1, 22, 25, 38], "help": 1, "changelog": 2, "1": 2, "8": [2, 5, 36, 43], "3": 2, "9xxx": 2, "under": 2, "develop": 2, "2023": 2, "12": 2, "10": 2, "2": 2, "11": 2, "22": 2, "09": 2, "7": 2, "01": 2, "2022": 2, "07": 2, "6": 2, "2021": 2, "29": 2, "5": 2, "04": 2, "4": 2, "08": 2, "15": 2, "14": 2, "05": 2, "2020": 2, "02": 2, "17": 2, "06": 2, "2019": 2, "03": 2, "2018": 2, "20": 2, "16": [2, 5, 35], "2017": 2, "21": 2, "2016": 2, "30": 2, "25": 2, "0": 2, "2015": 2, "28": 2, "2014": 2, "24": 2, "23": 2, "19": 2, "2013": 2, "13": 2, "packag": 3, "refer": [3, 5, 6, 8, 9, 10, 12, 13, 17, 20, 23, 26, 29, 30, 44, 63, 64, 65, 66, 67, 72, 80, 81, 84, 85, 93, 94, 95, 97, 98, 99, 102, 103, 104, 113, 114], "about_argu": 4, "descript": [4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105], "coercion": 4, "argument": [4, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 99, 100, 101, 102, 103, 104, 105], "vector": [4, 14, 51, 75, 77, 87, 88, 89, 106], "handl": 4, "miss": [4, 77, 109], "valu": [4, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 109], "na": [4, 61], "preserv": 4, "object": [4, 21], "attribut": 4, "author": [4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105], "": [4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106], "see": [4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 114], "also": [4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 114], "about_encod": 5, "detail": [5, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 76, 77, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 99, 100, 101, 102, 103, 104, 105], "utf": [5, 32, 35, 36, 42, 43], "encod": [5, 31, 33, 37, 38, 41, 44, 111], "span": [5, 6, 12], "class": [5, 6, 9, 12, 113], "rlang": 5, "convers": 5, "detect": [5, 27, 30, 31, 107, 111], "about_local": 6, "local": [6, 10, 31, 55, 56, 108], "identifi": [6, 93], "A": [6, 69, 108], "note": [6, 108, 113], "default": [6, 108], "sensit": [6, 31], "function": [6, 12, 106], "pkg": [6, 12], "about_search": 7, "search": [7, 10, 65, 107, 108], "about_search_boundari": 8, "about_search_charclass": 9, "unicodeset": 9, "pattern": [9, 18, 27, 46, 58, 60, 65, 76, 82, 86, 91, 107], "unicod": [9, 45, 99, 111], "properti": 9, "gener": [9, 63, 64, 65, 66, 69, 71, 87, 97, 109, 112], "categori": 9, "binari": [9, 16], "posix": [9, 113], "about_search_col": 10, "awar": 10, "engin": [10, 65, 107], "about_search_fix": 11, "byte": [11, 62], "compar": [11, 15, 17, 107], "about_search_regex": 12, "icu": 12, "regex": [12, 60, 66], "oper": [12, 16, 106, 112, 113], "glanc": 12, "meta": 12, "about_stringi": 13, "facil": 13, "avail": [13, 56, 93, 98], "operator_add": 14, "concaten": [14, 51, 52], "two": 14, "usag": [14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105], "exampl": [14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 26, 27, 28, 29, 30, 34, 36, 37, 45, 46, 47, 48, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 64, 65, 66, 67, 68, 69, 70, 71, 72, 75, 76, 77, 79, 80, 81, 82, 83, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 110], "operator_compar": 15, "without": [15, 17], "collat": [15, 17, 64, 108], "operator_dollar": 16, "stri_compar": 17, "stri_count": 18, "count": [18, 19, 53, 62, 107], "number": [18, 19, 53, 62], "occurr": [18, 27, 46, 58, 76, 107], "stri_count_boundari": 19, "text": [19, 47, 59, 73, 74, 83, 84, 97, 98, 104, 105, 111, 112], "boundari": [19, 47, 59, 83, 112, 113], "stri_datetime_add": 20, "date": [20, 21, 22, 23, 25, 26, 112], "time": [20, 21, 22, 23, 25, 26, 92, 93, 112], "arithmet": 20, "stri_datetime_cr": 21, "creat": 21, "stri_datetime_field": 22, "field": 22, "stri_datetime_format": 23, "format": [23, 24, 26, 85, 104, 112], "pars": [23, 112], "stri_datetime_fstr": 24, "style": [24, 78], "stri_datetime_now": 25, "current": 25, "stri_datetime_symbol": 26, "list": [26, 37, 52, 54, 56, 63, 64, 65, 66, 93, 98, 106, 108], "localiz": 26, "data": [26, 34, 35, 36, 47, 109, 110], "stri_detect": 27, "stri_dup": 28, "duplic": [28, 29, 106], "stri_dupl": 29, "determin": [29, 50, 86, 103], "element": [29, 91, 102], "stri_enc_detect": 30, "set": [30, 63, 64, 65, 66, 113], "languag": 30, "stri_enc_detect2": 31, "deprec": 31, "stri_enc_fromutf32": 32, "convert": [32, 40, 41, 42, 43, 44, 54, 78, 111], "from": [32, 73, 75, 89, 100, 106, 109], "32": [32, 35, 42], "stri_enc_info": 33, "queri": [33, 55, 92, 108], "stri_enc_isascii": 34, "check": [34, 35, 36, 99], "If": [34, 35, 36], "stream": [34, 35, 36], "i": [34, 35, 36, 50], "possibli": [34, 35, 36], "ascii": [34, 40], "stri_enc_isutf16": 35, "stri_enc_isutf8": 36, "stri_enc_list": 37, "known": 37, "stri_enc_mark": 38, "declar": 38, "each": [38, 70, 79], "stri_enc_set": 39, "stri_enc_toascii": 40, "To": [40, 41, 42, 43, 106], "stri_enc_ton": 41, "nativ": 41, "stri_enc_toutf32": 42, "stri_enc_toutf8": 43, "stri_encod": 44, "between": [44, 47, 111, 112], "given": [44, 55, 91, 92], "stri_escape_unicod": 45, "escap": [45, 101], "code": [45, 53, 70, 103, 106, 107, 111, 113], "point": [45, 53, 70, 103, 106, 111, 113], "stri_extract": 46, "extract": [46, 47, 60, 89, 90, 102, 106, 107, 113], "stri_extract_boundari": 47, "stri_flatten": 48, "flatten": [48, 106], "stri_info": 49, "stri_isempti": 50, "length": [50, 106], "zero": 50, "stri_join": 51, "stri_join_list": 52, "stri_length": 53, "stri_list2matrix": 54, "matrix": 54, "stri_locale_info": 55, "stri_locale_list": 56, "stri_locale_set": 57, "stri_loc": 58, "locat": [58, 59, 107, 113], "stri_locate_boundari": 59, "stri_match": 60, "match": [60, 82, 86, 91, 107, 113], "togeth": 60, "captur": [60, 113], "group": [60, 113], "stri_na2empti": 61, "replac": [61, 76, 77, 78, 89, 90, 106, 107, 113], "empti": [61, 75], "stri_numbyt": 62, "stri_opts_brkit": 63, "breakiter": 63, "stri_opts_col": 64, "stri_opts_fix": 65, "fix": [65, 107, 108], "stri_opts_regex": 66, "matcher": 66, "stri_ord": 67, "order": [67, 108], "permut": [67, 106], "stri_pad": 68, "pad": [68, 112], "center": 68, "left": [68, 100], "right": [68, 100], "align": 68, "stri_rand_lipsum": 69, "lorem": 69, "ipsum": 69, "stri_rand_shuffl": 70, "randomli": 70, "shuffl": 70, "stri_rand_str": 71, "random": [71, 112], "stri_rank": 72, "rank": 72, "stri_read_lin": 73, "read": [73, 74, 111], "line": [73, 84, 105], "file": [73, 74, 105, 111], "stri_read_raw": 74, "raw": 74, "stri_remove_empti": 75, "remov": 75, "all": [75, 101], "stri_replac": 76, "stri_replace_na": 77, "stri_replace_rstr": 78, "gsub": 78, "stri_revers": 79, "revers": 79, "stri_sort": 80, "sort": [80, 81, 108], "stri_sort_kei": 81, "kei": 81, "stri_split": 82, "split": [82, 83, 84, 107], "By": 82, "stri_split_boundari": 83, "stri_split_lin": 84, "Into": 84, "stri_sprintf": 85, "stri_startsendswith": 86, "start": 86, "end": [86, 113], "stri_stats_gener": 87, "statist": [87, 88], "stri_stats_latex": 88, "contain": 88, "latex": 88, "command": 88, "stri_sub": 89, "substr": [89, 90, 106], "In": [89, 106], "stri_sub_al": [90, 106], "multipl": 90, "stri_subset": 91, "select": 91, "stri_timezone_info": 92, "zone": [92, 93], "stri_timezone_list": 93, "stri_timezone_set": 94, "stri_trans_casemap": 95, "transform": [95, 97, 98, 112], "case": [95, 108, 110, 112], "map": [95, 112], "fold": 95, "stri_trans_char": 96, "translat": 96, "stri_trans_gener": 97, "includ": 97, "transliter": [97, 98, 112], "stri_trans_list": 98, "stri_trans_nf": 99, "perform": [99, 113], "For": 99, "normal": 99, "stri_trim": 100, "trim": [100, 112], "side": 100, "stri_unescape_unicod": 101, "un": 101, "sequenc": 101, "stri_uniqu": 102, "uniqu": 102, "stri_width": 103, "width": [103, 106], "stri_wrap": 104, "word": [104, 112, 113], "wrap": [104, 112], "paragraph": 104, "stri_write_lin": 105, "write": [105, 111], "basic": 106, "comput": 106, "join": 106, "generalis": 106, "within": 106, "index": 106, "matric": 106, "place": 106, "pointwis": 107, "test": [107, 108], "equal": 107, "option": [107, 108], "subset": 107, "specifi": 108, "specif": [108, 112], "servic": 108, "equival": 108, "linear": 108, "strength": 108, "ignor": 108, "some": 108, "punctuat": 108, "backward": 108, "secondari": 108, "numer": 108, "compat": 108, "revisit": 108, "design": 109, "principl": 109, "name": 109, "vectoris": 109, "act": 109, "elementwis": 109, "recycl": 109, "flow": 109, "further": 109, "deviat": 109, "base": 109, "us": [110, 113], "prepar": 110, "input": 111, "output": 111, "deal": 111, "normalis": 111, "other": 112, "analys": 112, "appli": 112, "templat": 112, "regular": 113, "express": 113, "individu": 113, "ani": 113, "defin": 113, "complement": 113, "rang": 113, "predefin": 113, "avoid": 113, "altern": 113, "subexpress": 113, "non": 113, "parenthes": 113, "quantifi": 113, "thereto": 113, "back": 113, "referenc": 113, "anchor": 113, "begin": 113, "look": 113, "behind": 113, "ahead": 113, "how": 114, "cite": 114, "bibliographi": 114}, "envversion": {"sphinx.domains.c": 3, "sphinx.domains.changeset": 1, "sphinx.domains.citation": 1, "sphinx.domains.cpp": 9, "sphinx.domains.index": 1, "sphinx.domains.javascript": 3, "sphinx.domains.math": 2, "sphinx.domains.python": 4, "sphinx.domains.rst": 2, "sphinx.domains.std": 2, "sphinxcontrib.bibtex": 9, "sphinx": 60}, "alltitles": {"stringi: Fast and Portable Character String Processing in R": [[0, "stringi-fast-and-portable-character-string-processing-in-r"]], "Installing stringi": [[1, "installing-stringi"]], "ICU4C": [[1, "icu4c"]], "Customising the Build Process": [[1, "customising-the-build-process"]], "Getting Help": [[1, "getting-help"]], "Changelog": [[2, "changelog"]], "1.8.3.9xxx (under development)": [[2, "xxx-under-development"]], "1.8.3 (2023-12-10)": [[2, "id1"]], "1.8.2 (2023-11-22)": [[2, "id2"]], "1.8.1 (2023-11-09)": [[2, "id3"]], "1.7.12 (2023-01-09)": [[2, "id4"]], "1.7.8 (2022-07-11)": [[2, "id5"]], "1.7.6 (2021-11-29)": [[2, "id6"]], "1.7.5 (2021-10-04)": [[2, "id7"]], "1.7.4 (2021-08-12)": [[2, "id8"]], "1.7.3 (2021-07-15)": [[2, "id9"]], "1.7.2 (2021-07-14)": [[2, "id10"]], "1.7.1 (2021-07-14)": [[2, "id11"]], "1.6.2 (2021-05-14)": [[2, "id12"]], "1.6.1 (2021-05-05)": [[2, "id13"]], "1.5.3 (2020-09-04)": [[2, "id14"]], "1.4.6 (2020-02-17)": [[2, "id15"]], "1.4.5 (2020-01-11)": [[2, "id16"]], "1.4.4 (2020-01-06)": [[2, "id17"]], "1.4.3 (2019-03-12)": [[2, "id18"]], "1.3.1 (2019-02-10)": [[2, "id19"]], "1.2.4 (2018-07-20)": [[2, "id20"]], "1.2.3 (2018-05-16)": [[2, "id21"]], "1.2.2 (2018-05-01)": [[2, "id22"]], "1.1.7 (2018-03-06)": [[2, "id23"]], "1.1.6 (2017-11-10)": [[2, "id24"]], "1.1.5 (2017-04-07)": [[2, "id25"]], "1.1.3 (2017-03-21)": [[2, "id26"]], "1.1.2 (2016-09-30)": [[2, "id27"]], "1.1.1 (2016-05-25)": [[2, "id28"]], "1.0-1 (2015-10-22)": [[2, "id29"]], "0.5-5 (2015-06-28)": [[2, "id30"]], "0.5-2 (2015-06-21)": [[2, "id31"]], "0.4-1 (2014-12-11)": [[2, "id32"]], "0.3-1 (2014-11-06)": [[2, "id33"]], "0.2-5 (2014-05-16)": [[2, "id34"]], "0.2-4 (2014-05-15)": [[2, "id35"]], "0.2-3 (2014-05-14)": [[2, "id36"]], "0.1-25 (2014-03-12)": [[2, "id37"]], "0.1-24 (2014-03-11)": [[2, "id38"]], "0.1-23 (2014-03-11)": [[2, "id39"]], "0.1-22 (2014-02-20)": [[2, "id40"]], "0.1-21 (2014-02-19)": [[2, "id41"]], "0.1-20 (2014-02-17)": [[2, "id42"]], "0.1-11 (2013-11-16)": [[2, "id43"]], "0.1-10 (2013-11-13)": [[2, "id44"]], "0.1-6 (2013-07-05)": [[2, "id45"]], "0.1-1 (2013-01-05)": [[2, "id46"]], "R Package stringi Reference": [[3, "r-package-stringi-reference"]], "about_arguments:": [[4, "about-arguments"]], "Description": [[4, "description"], [5, "description"], [6, "description"], [7, "description"], [8, "description"], [9, "description"], [10, "description"], [11, "description"], [12, "description"], [13, "description"], [14, "description"], [15, "description"], [16, "description"], [17, "description"], [18, "description"], [19, "description"], [20, "description"], [21, "description"], [22, "description"], [23, "description"], [24, "description"], [25, "description"], [26, "description"], [27, "description"], [28, "description"], [29, "description"], [30, "description"], [31, "description"], [32, "description"], [33, "description"], [34, "description"], [35, "description"], [36, "description"], [37, "description"], [38, "description"], [39, "description"], [40, "description"], [41, "description"], [42, "description"], [43, "description"], [44, "description"], [45, "description"], [46, "description"], [47, "description"], [48, "description"], [49, "description"], [50, "description"], [51, "description"], [52, "description"], [53, "description"], [54, "description"], [55, "description"], [56, "description"], [57, "description"], [58, "description"], [59, "description"], [60, "description"], [61, "description"], [62, "description"], [63, "description"], [64, "description"], [65, "description"], [66, "description"], [67, "description"], [68, "description"], [69, "description"], [70, "description"], [71, "description"], [72, "description"], [73, "description"], [74, "description"], [75, "description"], [76, "description"], [77, "description"], [78, "description"], [79, "description"], [80, "description"], [81, "description"], [82, "description"], [83, "description"], [84, "description"], [85, "description"], [86, "description"], [87, "description"], [88, "description"], [89, "description"], [90, "description"], [91, "description"], [92, "description"], [93, "description"], [94, "description"], [95, "description"], [96, "description"], [97, "description"], [98, "description"], [99, "description"], [100, "description"], [101, "description"], [102, "description"], [103, "description"], [104, "description"], [105, "description"]], "Coercion of Arguments": [[4, "coercion-of-arguments"]], "Vectorization": [[4, "vectorization"]], "Handling Missing Values (NAs)": [[4, "handling-missing-values-nas"]], "Preserving Object Attributes": [[4, "preserving-object-attributes"]], "Author(s)": [[4, "author-s"], [5, "author-s"], [6, "author-s"], [7, "author-s"], [8, "author-s"], [9, "author-s"], [10, "author-s"], [11, "author-s"], [12, "author-s"], [13, "author-s"], [14, "author-s"], [15, "author-s"], [16, "author-s"], [17, "author-s"], [18, "author-s"], [19, "author-s"], [20, "author-s"], [21, "author-s"], [22, "author-s"], [23, "author-s"], [24, "author-s"], [25, "author-s"], [26, "author-s"], [27, "author-s"], [28, "author-s"], [29, "author-s"], [30, "author-s"], [31, "author-s"], [32, "author-s"], [33, "author-s"], [34, "author-s"], [35, "author-s"], [36, "author-s"], [37, "author-s"], [38, "author-s"], [39, "author-s"], [40, "author-s"], [41, "author-s"], [42, "author-s"], [43, "author-s"], [44, "author-s"], [45, "author-s"], [46, "author-s"], [47, "author-s"], [48, "author-s"], [49, "author-s"], [50, "author-s"], [51, "author-s"], [52, "author-s"], [53, "author-s"], [54, "author-s"], [55, "author-s"], [56, "author-s"], [57, "author-s"], [58, "author-s"], [59, "author-s"], [60, "author-s"], [61, "author-s"], [62, "author-s"], [63, "author-s"], [64, "author-s"], [65, "author-s"], [66, "author-s"], [67, "author-s"], [68, "author-s"], [69, "author-s"], [70, "author-s"], [71, "author-s"], [72, "author-s"], [73, "author-s"], [74, "author-s"], [75, "author-s"], [76, "author-s"], [77, "author-s"], [78, "author-s"], [79, "author-s"], [80, "author-s"], [81, "author-s"], [82, "author-s"], [83, "author-s"], [84, "author-s"], [85, "author-s"], [86, "author-s"], [87, "author-s"], [88, "author-s"], [89, "author-s"], [90, "author-s"], [91, "author-s"], [92, "author-s"], [93, "author-s"], [94, "author-s"], [95, "author-s"], [96, "author-s"], [97, "author-s"], [98, "author-s"], [99, "author-s"], [100, "author-s"], [101, "author-s"], [102, "author-s"], [103, "author-s"], [104, "author-s"], [105, "author-s"]], "See Also": [[4, "see-also"], [5, "see-also"], [6, "see-also"], [7, "see-also"], [8, "see-also"], [9, "see-also"], [10, "see-also"], [11, "see-also"], [12, "see-also"], [13, "see-also"], [14, "see-also"], [15, "see-also"], [16, "see-also"], [17, "see-also"], [18, "see-also"], [19, "see-also"], [20, "see-also"], [21, "see-also"], [22, "see-also"], [23, "see-also"], [24, "see-also"], [25, "see-also"], [26, "see-also"], [27, "see-also"], [28, "see-also"], [29, "see-also"], [30, "see-also"], [31, "see-also"], [32, "see-also"], [33, "see-also"], [34, "see-also"], [35, "see-also"], [36, "see-also"], [37, "see-also"], [38, "see-also"], [39, "see-also"], [40, "see-also"], [41, "see-also"], [42, "see-also"], [43, "see-also"], [44, "see-also"], [45, "see-also"], [46, "see-also"], [47, "see-also"], [48, "see-also"], [49, "see-also"], [50, "see-also"], [51, "see-also"], [52, "see-also"], [53, "see-also"], [54, "see-also"], [55, "see-also"], [56, "see-also"], [57, "see-also"], [58, "see-also"], [59, "see-also"], [60, "see-also"], [61, "see-also"], [62, "see-also"], [63, "see-also"], [64, "see-also"], [65, "see-also"], [66, "see-also"], [67, "see-also"], [68, "see-also"], [69, "see-also"], [70, "see-also"], [71, "see-also"], [72, "see-also"], [73, "see-also"], [74, "see-also"], [75, "see-also"], [76, "see-also"], [77, "see-also"], [78, "see-also"], [79, "see-also"], [80, "see-also"], [81, "see-also"], [82, "see-also"], [83, "see-also"], [84, "see-also"], [85, "see-also"], [86, "see-also"], [87, "see-also"], [88, "see-also"], [89, "see-also"], [90, "see-also"], [91, "see-also"], [92, "see-also"], [93, "see-also"], [94, "see-also"], [95, "see-also"], [96, "see-also"], [97, "see-also"], [98, "see-also"], [99, "see-also"], [100, "see-also"], [101, "see-also"], [102, "see-also"], [103, "see-also"], [104, "see-also"], [105, "see-also"], [114, "see-also"]], "about_encoding:": [[5, "about-encoding"]], "Details": [[5, "details"], [6, "details"], [7, "details"], [8, "details"], [9, "details"], [12, "details"], [13, "details"], [14, "details"], [15, "details"], [16, "details"], [17, "details"], [18, "details"], [19, "details"], [20, "details"], [21, "details"], [22, "details"], [23, "details"], [24, "details"], [25, "details"], [26, "details"], [27, "details"], [28, "details"], [29, "details"], [30, "details"], [31, "details"], [32, "details"], [33, "details"], [34, "details"], [35, "details"], [36, "details"], [37, "details"], [38, "details"], [39, "details"], [40, "details"], [41, "details"], [42, "details"], [43, "details"], [44, "details"], [45, "details"], [46, "details"], [47, "details"], [48, "details"], [50, "details"], [51, "details"], [52, "details"], [53, "details"], [54, "details"], [55, "details"], [56, "details"], [57, "details"], [58, "details"], [59, "details"], [60, "details"], [62, "details"], [63, "details"], [64, "details"], [65, "details"], [66, "details"], [67, "details"], [68, "details"], [69, "details"], [70, "details"], [71, "details"], [72, "details"], [73, "details"], [74, "details"], [76, "details"], [77, "details"], [79, "details"], [80, "details"], [81, "details"], [82, "details"], [83, "details"], [84, "details"], [85, "details"], [86, "details"], [87, "details"], [88, "details"], [89, "details"], [90, "details"], [91, "details"], [92, "details"], [93, "details"], [94, "details"], [95, "details"], [96, "details"], [97, "details"], [99, "details"], [100, "details"], [101, "details"], [102, "details"], [103, "details"], [104, "details"], [105, "details"]], "UTF-8 and UTF-16": [[5, "utf-8-and-utf-16"]], "Character Encodings in R": [[5, "character-encodings-in-r"]], "Encoding Conversion": [[5, "encoding-conversion"]], "Encoding Detection": [[5, "encoding-detection"]], "References": [[5, "references"], [6, "references"], [8, "references"], [9, "references"], [10, "references"], [12, "references"], [13, "references"], [17, "references"], [20, "references"], [23, "references"], [26, "references"], [29, "references"], [30, "references"], [44, "references"], [63, "references"], [64, "references"], [65, "references"], [66, "references"], [67, "references"], [72, "references"], [80, "references"], [81, "references"], [84, "references"], [85, "references"], [93, "references"], [94, "references"], [95, "references"], [97, "references"], [98, "references"], [99, "references"], [102, "references"], [103, "references"], [104, "references"], [114, "references"]], "about_locale:": [[6, "about-locale"]], "Locale Identifiers": [[6, "locale-identifiers"]], "A Note on Default Locales": [[6, "a-note-on-default-locales"]], "Locale-Sensitive Functions in stringi": [[6, "locale-sensitive-functions-in-stringi"]], "about_search: String Searching": [[7, "about-search-string-searching"]], "about_search_boundaries:": [[8, "about-search-boundaries"]], "about_search_charclass:": [[9, "about-search-charclass"]], "UnicodeSet patterns": [[9, "unicodeset-patterns"]], "Unicode properties": [[9, "unicode-properties"]], "Unicode General Categories": [[9, "unicode-general-categories"]], "Unicode Binary Properties": [[9, "unicode-binary-properties"]], "POSIX Character Classes": [[9, "posix-character-classes"]], "about_search_coll:": [[10, "about-search-coll"]], "Locale-Aware String Search Engine": [[10, "locale-aware-string-search-engine"]], "about_search_fixed:": [[11, "about-search-fixed"]], "Byte Compare": [[11, "byte-compare"]], "about_search_regex:": [[12, "about-search-regex"]], "ICU Regex Operators at a Glance": [[12, "icu-regex-operators-at-a-glance"]], "ICU Regex Meta-characters at a Glance": [[12, "icu-regex-meta-characters-at-a-glance"]], "Character Classes": [[12, "character-classes"]], "Regex Functions in stringi": [[12, "regex-functions-in-stringi"]], "about_stringi: Fast and Portable Character String Processing in R": [[13, "about-stringi-fast-and-portable-character-string-processing-in-r"]], "Facilities available": [[13, "facilities-available"]], "operator_add: Concatenate Two Character Vectors": [[14, "operator-add-concatenate-two-character-vectors"]], "Usage": [[14, "usage"], [15, "usage"], [16, "usage"], [17, "usage"], [18, "usage"], [19, "usage"], [20, "usage"], [21, "usage"], [22, "usage"], [23, "usage"], [24, "usage"], [25, "usage"], [26, "usage"], [27, "usage"], [28, "usage"], [29, "usage"], [30, "usage"], [31, "usage"], [32, "usage"], [33, "usage"], [34, "usage"], [35, "usage"], [36, "usage"], [37, "usage"], [38, "usage"], [39, "usage"], [40, "usage"], [41, "usage"], [42, "usage"], [43, "usage"], [44, "usage"], [45, "usage"], [46, "usage"], [47, "usage"], [48, "usage"], [49, "usage"], [50, "usage"], [51, "usage"], [52, "usage"], [53, "usage"], [54, "usage"], [55, "usage"], [56, "usage"], [57, "usage"], [58, "usage"], [59, "usage"], [60, "usage"], [61, "usage"], [62, "usage"], [63, "usage"], [64, "usage"], [65, "usage"], [66, "usage"], [67, "usage"], [68, "usage"], [69, "usage"], [70, "usage"], [71, "usage"], [72, "usage"], [73, "usage"], [74, "usage"], [75, "usage"], [76, "usage"], [77, "usage"], [78, "usage"], [79, "usage"], [80, "usage"], [81, "usage"], [82, "usage"], [83, "usage"], [84, "usage"], [85, "usage"], [86, "usage"], [87, "usage"], [88, "usage"], [89, "usage"], [90, "usage"], [91, "usage"], [92, "usage"], [93, "usage"], [94, "usage"], [95, "usage"], [96, "usage"], [97, "usage"], [98, "usage"], [99, "usage"], [100, "usage"], [101, "usage"], [102, "usage"], [103, "usage"], [104, "usage"], [105, "usage"]], "Arguments": [[14, "arguments"], [15, "arguments"], [16, "arguments"], [17, "arguments"], [18, "arguments"], [19, "arguments"], [20, "arguments"], [21, "arguments"], [22, "arguments"], [23, "arguments"], [24, "arguments"], [26, "arguments"], [27, "arguments"], [28, "arguments"], [29, "arguments"], [30, "arguments"], [31, "arguments"], [32, "arguments"], [33, "arguments"], [34, "arguments"], [35, "arguments"], [36, "arguments"], [37, "arguments"], [38, "arguments"], [39, "arguments"], [40, "arguments"], [41, "arguments"], [42, "arguments"], [43, "arguments"], [44, "arguments"], [45, "arguments"], [46, "arguments"], [47, "arguments"], [48, "arguments"], [49, "arguments"], [50, "arguments"], [51, "arguments"], [52, "arguments"], [53, "arguments"], [54, "arguments"], [55, "arguments"], [57, "arguments"], [58, "arguments"], [59, "arguments"], [60, "arguments"], [61, "arguments"], [62, "arguments"], [63, "arguments"], [64, "arguments"], [65, "arguments"], [66, "arguments"], [67, "arguments"], [68, "arguments"], [69, "arguments"], [70, "arguments"], [71, "arguments"], [72, "arguments"], [73, "arguments"], [74, "arguments"], [75, "arguments"], [76, "arguments"], [77, "arguments"], [78, "arguments"], [79, "arguments"], [80, "arguments"], [81, "arguments"], [82, "arguments"], [83, "arguments"], [84, "arguments"], [85, "arguments"], [86, "arguments"], [87, "arguments"], [88, "arguments"], [89, "arguments"], [90, "arguments"], [91, "arguments"], [92, "arguments"], [93, "arguments"], [94, "arguments"], [95, "arguments"], [96, "arguments"], [97, "arguments"], [99, "arguments"], [100, "arguments"], [101, "arguments"], [102, "arguments"], [103, "arguments"], [104, "arguments"], [105, "arguments"]], "Value": [[14, "value"], [15, "value"], [16, "value"], [17, "value"], [18, "value"], [19, "value"], [20, "value"], [21, "value"], [22, "value"], [23, "value"], [24, "value"], [25, "value"], [26, "value"], [27, "value"], [28, "value"], [29, "value"], [30, "value"], [31, "value"], [32, "value"], [33, "value"], [34, "value"], [35, "value"], [36, "value"], [37, "value"], [38, "value"], [39, "value"], [40, "value"], [41, "value"], [42, "value"], [43, "value"], [44, "value"], [45, "value"], [46, "value"], [47, "value"], [48, "value"], [49, "value"], [50, "value"], [51, "value"], [52, "value"], [53, "value"], [54, "value"], [55, "value"], [56, "value"], [57, "value"], [58, "value"], [59, "value"], [60, "value"], [61, "value"], [62, "value"], [63, "value"], [64, "value"], [65, "value"], [66, "value"], [67, "value"], [68, "value"], [69, "value"], [70, "value"], [71, "value"], [72, "value"], [73, "value"], [74, "value"], [75, "value"], [76, "value"], [77, "value"], [78, "value"], [79, "value"], [80, "value"], [81, "value"], [82, "value"], [83, "value"], [84, "value"], [85, "value"], [86, "value"], [87, "value"], [88, "value"], [89, "value"], [90, "value"], [91, "value"], [92, "value"], [93, "value"], [94, "value"], [95, "value"], [96, "value"], [97, "value"], [98, "value"], [99, "value"], [100, "value"], [101, "value"], [102, "value"], [103, "value"], [104, "value"], [105, "value"]], "Examples": [[14, "examples"], [15, "examples"], [16, "examples"], [17, "examples"], [18, "examples"], [19, "examples"], [20, "examples"], [21, "examples"], [22, "examples"], [23, "examples"], [24, "examples"], [26, "examples"], [27, "examples"], [28, "examples"], [29, "examples"], [30, "examples"], [34, "examples"], [36, "examples"], [37, "examples"], [45, "examples"], [46, "examples"], [47, "examples"], [48, "examples"], [50, "examples"], [51, "examples"], [52, "examples"], [53, "examples"], [54, "examples"], [55, "examples"], [56, "examples"], [57, "examples"], [58, "examples"], [59, "examples"], [60, "examples"], [61, "examples"], [62, "examples"], [64, "examples"], [65, "examples"], [66, "examples"], [67, "examples"], [68, "examples"], [69, "examples"], [70, "examples"], [71, "examples"], [72, "examples"], [75, "examples"], [76, "examples"], [77, "examples"], [79, "examples"], [80, "examples"], [81, "examples"], [82, "examples"], [83, "examples"], [85, "examples"], [86, "examples"], [87, "examples"], [88, "examples"], [89, "examples"], [90, "examples"], [91, "examples"], [92, "examples"], [93, "examples"], [94, "examples"], [95, "examples"], [96, "examples"], [97, "examples"], [98, "examples"], [99, "examples"], [100, "examples"], [101, "examples"], [102, "examples"], [103, "examples"], [104, "examples"]], "operator_compare: Compare Strings with or without Collation": [[15, "operator-compare-compare-strings-with-or-without-collation"]], "operator_dollar: as a Binary Operator": [[16, "operator-dollar-as-a-binary-operator"]], "stri_compare: Compare Strings with or without Collation": [[17, "stri-compare-compare-strings-with-or-without-collation"]], "stri_count: Count the Number of Pattern Occurrences": [[18, "stri-count-count-the-number-of-pattern-occurrences"]], "stri_count_boundaries: Count the Number of Text Boundaries": [[19, "stri-count-boundaries-count-the-number-of-text-boundaries"]], "stri_datetime_add: Date and Time Arithmetic": [[20, "stri-datetime-add-date-and-time-arithmetic"]], "stri_datetime_create: Create a Date-Time Object": [[21, "stri-datetime-create-create-a-date-time-object"]], "stri_datetime_fields: Get Values for Date and Time Fields": [[22, "stri-datetime-fields-get-values-for-date-and-time-fields"]], "stri_datetime_format: Date and Time Formatting and Parsing": [[23, "stri-datetime-format-date-and-time-formatting-and-parsing"]], "stri_datetime_fstr: -Style Format Strings": [[24, "stri-datetime-fstr-style-format-strings"]], "stri_datetime_now: Get Current Date and Time": [[25, "stri-datetime-now-get-current-date-and-time"]], "stri_datetime_symbols: List Localizable Date-Time Formatting Data": [[26, "stri-datetime-symbols-list-localizable-date-time-formatting-data"]], "stri_detect: Detect Pattern Occurrences": [[27, "stri-detect-detect-pattern-occurrences"]], "stri_dup: Duplicate Strings": [[28, "stri-dup-duplicate-strings"]], "stri_duplicated: Determine Duplicated Elements": [[29, "stri-duplicated-determine-duplicated-elements"]], "stri_enc_detect: Detect Character Set and Language": [[30, "stri-enc-detect-detect-character-set-and-language"]], "stri_enc_detect2: [DEPRECATED] Detect Locale-Sensitive Character Encoding": [[31, "stri-enc-detect2-deprecated-detect-locale-sensitive-character-encoding"]], "stri_enc_fromutf32: Convert From UTF-32": [[32, "stri-enc-fromutf32-convert-from-utf-32"]], "stri_enc_info: Query a Character Encoding": [[33, "stri-enc-info-query-a-character-encoding"]], "stri_enc_isascii: Check If a Data Stream Is Possibly in ASCII": [[34, "stri-enc-isascii-check-if-a-data-stream-is-possibly-in-ascii"]], "stri_enc_isutf16: Check If a Data Stream Is Possibly in UTF-16 or UTF-32": [[35, "stri-enc-isutf16-check-if-a-data-stream-is-possibly-in-utf-16-or-utf-32"]], "stri_enc_isutf8: Check If a Data Stream Is Possibly in UTF-8": [[36, "stri-enc-isutf8-check-if-a-data-stream-is-possibly-in-utf-8"]], "stri_enc_list: List Known Character Encodings": [[37, "stri-enc-list-list-known-character-encodings"]], "stri_enc_mark: Get Declared Encodings of Each String": [[38, "stri-enc-mark-get-declared-encodings-of-each-string"]], "stri_enc_set:": [[39, "stri-enc-set"]], "stri_enc_toascii: Convert To ASCII": [[40, "stri-enc-toascii-convert-to-ascii"]], "stri_enc_tonative: Convert Strings To Native Encoding": [[41, "stri-enc-tonative-convert-strings-to-native-encoding"]], "stri_enc_toutf32: Convert Strings To UTF-32": [[42, "stri-enc-toutf32-convert-strings-to-utf-32"]], "stri_enc_toutf8: Convert Strings To UTF-8": [[43, "stri-enc-toutf8-convert-strings-to-utf-8"]], "stri_encode: Convert Strings Between Given Encodings": [[44, "stri-encode-convert-strings-between-given-encodings"]], "stri_escape_unicode: Escape Unicode Code Points": [[45, "stri-escape-unicode-escape-unicode-code-points"]], "stri_extract: Extract Pattern Occurrences": [[46, "stri-extract-extract-pattern-occurrences"]], "stri_extract_boundaries: Extract Data Between Text Boundaries": [[47, "stri-extract-boundaries-extract-data-between-text-boundaries"]], "stri_flatten: Flatten a String": [[48, "stri-flatten-flatten-a-string"]], "stri_info:": [[49, "stri-info"]], "stri_isempty: Determine if a String is of Length Zero": [[50, "stri-isempty-determine-if-a-string-is-of-length-zero"]], "stri_join: Concatenate Character Vectors": [[51, "stri-join-concatenate-character-vectors"]], "stri_join_list: Concatenate Strings in a List": [[52, "stri-join-list-concatenate-strings-in-a-list"]], "stri_length: Count the Number of Code Points": [[53, "stri-length-count-the-number-of-code-points"]], "stri_list2matrix: Convert a List to a Character Matrix": [[54, "stri-list2matrix-convert-a-list-to-a-character-matrix"]], "stri_locale_info: Query Given Locale": [[55, "stri-locale-info-query-given-locale"]], "stri_locale_list: List Available Locales": [[56, "stri-locale-list-list-available-locales"]], "stri_locale_set:": [[57, "stri-locale-set"]], "stri_locate: Locate Pattern Occurrences": [[58, "stri-locate-locate-pattern-occurrences"]], "stri_locate_boundaries: Locate Text Boundaries": [[59, "stri-locate-boundaries-locate-text-boundaries"]], "stri_match: Extract Regex Pattern Matches, Together with Capture Groups": [[60, "stri-match-extract-regex-pattern-matches-together-with-capture-groups"]], "stri_na2empty: Replace NAs with Empty Strings": [[61, "stri-na2empty-replace-nas-with-empty-strings"]], "stri_numbytes: Count the Number of Bytes": [[62, "stri-numbytes-count-the-number-of-bytes"]], "stri_opts_brkiter: Generate a List with BreakIterator Settings": [[63, "stri-opts-brkiter-generate-a-list-with-breakiterator-settings"]], "stri_opts_collator: Generate a List with Collator Settings": [[64, "stri-opts-collator-generate-a-list-with-collator-settings"]], "stri_opts_fixed: Generate a List with Fixed Pattern Search Engine\u2019s Settings": [[65, "stri-opts-fixed-generate-a-list-with-fixed-pattern-search-engine-s-settings"]], "stri_opts_regex: Generate a List with Regex Matcher Settings": [[66, "stri-opts-regex-generate-a-list-with-regex-matcher-settings"]], "stri_order: Ordering Permutation": [[67, "stri-order-ordering-permutation"]], "stri_pad: Pad (Center/Left/Right Align) a String": [[68, "stri-pad-pad-center-left-right-align-a-string"]], "stri_rand_lipsum: A Lorem Ipsum Generator": [[69, "stri-rand-lipsum-a-lorem-ipsum-generator"]], "stri_rand_shuffle: Randomly Shuffle Code Points in Each String": [[70, "stri-rand-shuffle-randomly-shuffle-code-points-in-each-string"]], "stri_rand_strings: Generate Random Strings": [[71, "stri-rand-strings-generate-random-strings"]], "stri_rank: Ranking": [[72, "stri-rank-ranking"]], "stri_read_lines: Read Text Lines from a Text File": [[73, "stri-read-lines-read-text-lines-from-a-text-file"]], "stri_read_raw: Read Text File as Raw": [[74, "stri-read-raw-read-text-file-as-raw"]], "stri_remove_empty: Remove All Empty Strings from a Character Vector": [[75, "stri-remove-empty-remove-all-empty-strings-from-a-character-vector"]], "stri_replace: Replace Pattern Occurrences": [[76, "stri-replace-replace-pattern-occurrences"]], "stri_replace_na: Replace Missing Values in a Character Vector": [[77, "stri-replace-na-replace-missing-values-in-a-character-vector"]], "stri_replace_rstr: Convert gsub-Style Replacement Strings": [[78, "stri-replace-rstr-convert-gsub-style-replacement-strings"]], "stri_reverse: Reverse Each String": [[79, "stri-reverse-reverse-each-string"]], "stri_sort: String Sorting": [[80, "stri-sort-string-sorting"]], "stri_sort_key: Sort Keys": [[81, "stri-sort-key-sort-keys"]], "stri_split: Split a String By Pattern Matches": [[82, "stri-split-split-a-string-by-pattern-matches"]], "stri_split_boundaries: Split a String at Text Boundaries": [[83, "stri-split-boundaries-split-a-string-at-text-boundaries"]], "stri_split_lines: Split a String Into Text Lines": [[84, "stri-split-lines-split-a-string-into-text-lines"]], "stri_sprintf: Format Strings": [[85, "stri-sprintf-format-strings"]], "stri_startsendswith: Determine if the Start or End of a String Matches a Pattern": [[86, "stri-startsendswith-determine-if-the-start-or-end-of-a-string-matches-a-pattern"]], "stri_stats_general: General Statistics for a Character Vector": [[87, "stri-stats-general-general-statistics-for-a-character-vector"]], "stri_stats_latex: Statistics for a Character Vector Containing LaTeX Commands": [[88, "stri-stats-latex-statistics-for-a-character-vector-containing-latex-commands"]], "stri_sub: Extract a Substring From or Replace a Substring In a Character Vector": [[89, "stri-sub-extract-a-substring-from-or-replace-a-substring-in-a-character-vector"]], "stri_sub_all: Extract or Replace Multiple Substrings": [[90, "stri-sub-all-extract-or-replace-multiple-substrings"]], "stri_subset: Select Elements that Match a Given Pattern": [[91, "stri-subset-select-elements-that-match-a-given-pattern"]], "stri_timezone_info: Query a Given Time Zone": [[92, "stri-timezone-info-query-a-given-time-zone"]], "stri_timezone_list: List Available Time Zone Identifiers": [[93, "stri-timezone-list-list-available-time-zone-identifiers"]], "stri_timezone_set:": [[94, "stri-timezone-set"]], "stri_trans_casemap: Transform Strings with Case Mapping or Folding": [[95, "stri-trans-casemap-transform-strings-with-case-mapping-or-folding"]], "stri_trans_char: Translate Characters": [[96, "stri-trans-char-translate-characters"]], "stri_trans_general: General Text Transforms, Including Transliteration": [[97, "stri-trans-general-general-text-transforms-including-transliteration"]], "stri_trans_list: List Available Text Transforms and Transliterators": [[98, "stri-trans-list-list-available-text-transforms-and-transliterators"]], "stri_trans_nf: Perform or Check For Unicode Normalization": [[99, "stri-trans-nf-perform-or-check-for-unicode-normalization"]], "stri_trim: Trim Characters from the Left and/or Right Side of a String": [[100, "stri-trim-trim-characters-from-the-left-and-or-right-side-of-a-string"]], "stri_unescape_unicode: Un-escape All Escape Sequences": [[101, "stri-unescape-unicode-un-escape-all-escape-sequences"]], "stri_unique: Extract Unique Elements": [[102, "stri-unique-extract-unique-elements"]], "stri_width: Determine the Width of Code Points": [[103, "stri-width-determine-the-width-of-code-points"]], "stri_wrap: Word Wrap Text to Format Paragraphs": [[104, "stri-wrap-word-wrap-text-to-format-paragraphs"]], "stri_write_lines: Write Text Lines to a Text File": [[105, "stri-write-lines-write-text-lines-to-a-text-file"]], "Basic String Operations": [[106, "basic-string-operations"]], "Computing Length and Width": [[106, "computing-length-and-width"]], "Joining": [[106, "joining"]], "Operator %s+%": [[106, "operator-s"]], "Flattening": [[106, "flattening"]], "Generalisation": [[106, "generalisation"]], "Duplicating": [[106, "duplicating"]], "Within-List Joining": [[106, "within-list-joining"]], "Extracting and Replacing Substrings": [[106, "extracting-and-replacing-substrings"]], "Indexing Vectors": [[106, "indexing-vectors"]], "Extracting Substrings": [[106, "extracting-substrings"]], "stri_sub_all() Function": [[106, "stri-sub-all-function"]], "\u201cFrom\u2013To\u201d and \u201cFrom\u2013Length\u201d Matrices": [[106, "from-to-and-from-length-matrices"]], "Permuting Code Points": [[106, "permuting-code-points"]], "Replacing Substrings": [[106, "replacing-substrings"]], "Replacing Substrings In-Place": [[106, "replacing-substrings-in-place"]], "Code-Pointwise Comparing": [[107, "code-pointwise-comparing"]], "Testing for Equality of Strings": [[107, "testing-for-equality-of-strings"]], "Searching for Fixed Strings": [[107, "searching-for-fixed-strings"]], "Counting Matches": [[107, "counting-matches"]], "Search Engine Options": [[107, "search-engine-options"]], "Detecting and Subsetting Patterns": [[107, "detecting-and-subsetting-patterns"]], "Locating and Extracting Patterns": [[107, "locating-and-extracting-patterns"]], "Replacing Pattern Occurrences": [[107, "replacing-pattern-occurrences"]], "Splitting": [[107, "splitting"]], "Collation": [[108, "collation"]], "Locales": [[108, "locales"]], "Specifying Locales": [[108, "specifying-locales"]], "Listing Locales": [[108, "listing-locales"]], "Querying for Locale-Specific Services": [[108, "querying-for-locale-specific-services"]], "Default Locale": [[108, "default-locale"]], "Testing String Equivalence": [[108, "testing-string-equivalence"]], "Linear Ordering of Strings": [[108, "linear-ordering-of-strings"]], "Collator Options": [[108, "collator-options"]], "Collation Strength": [[108, "collation-strength"]], "Ignoring Case": [[108, "ignoring-case"]], "Ignoring Some Punctuation": [[108, "ignoring-some-punctuation"]], "Backward Secondary Sorting": [[108, "backward-secondary-sorting"]], "Sorting Numerals": [[108, "sorting-numerals"]], "A Note on Compatibility Equivalence": [[108, "a-note-on-compatibility-equivalence"]], "Searching for Fixed Strings Revisited": [[108, "searching-for-fixed-strings-revisited"]], "General Design Principles": [[109, "general-design-principles"]], "Naming": [[109, "naming"]], "Vectorisation": [[109, "vectorisation"]], "Acting Elementwise with Recycling": [[109, "acting-elementwise-with-recycling"]], "Missing Values": [[109, "missing-values"]], "Data Flow": [[109, "data-flow"]], "Further Deviations from Base R": [[109, "further-deviations-from-base-r"]], "Example Use Case: Data Preparation": [[110, "example-use-case-data-preparation"]], "Input and Output": [[111, "input-and-output"]], "Dealing with Unicode Code Points": [[111, "dealing-with-unicode-code-points"]], "Character Encodings": [[111, "character-encodings"]], "Reading and Writing Text Files": [[111, "reading-and-writing-text-files"]], "Detecting Encodings": [[111, "detecting-encodings"]], "Converting Between Encodings": [[111, "converting-between-encodings"]], "Normalising Strings": [[111, "normalising-strings"]], "Other Operations": [[112, "other-operations"]], "Analysing Text Boundaries": [[112, "analysing-text-boundaries"]], "Trimming, Padding, and Other Formatting": [[112, "trimming-padding-and-other-formatting"]], "Padding": [[112, "padding"]], "Trimming": [[112, "trimming"]], "Word Wrapping": [[112, "word-wrapping"]], "Applying String Templates": [[112, "applying-string-templates"]], "Generating Random Strings": [[112, "generating-random-strings"]], "Transliterating": [[112, "transliterating"]], "Case Mapping": [[112, "case-mapping"]], "Mapping Between Specific Characters": [[112, "mapping-between-specific-characters"]], "General Transforms": [[112, "general-transforms"]], "Parsing and Formatting Date and Time": [[112, "parsing-and-formatting-date-and-time"]], "Regular Expressions": [[113, "regular-expressions"]], "Matching Individual Characters": [[113, "matching-individual-characters"]], "Matching Any Character": [[113, "matching-any-character"]], "Defining Character Sets": [[113, "defining-character-sets"]], "Complementing Sets": [[113, "complementing-sets"]], "Defining Code Point Ranges": [[113, "defining-code-point-ranges"]], "Using Predefined Character Sets": [[113, "using-predefined-character-sets"]], "Avoiding POSIX Classes": [[113, "avoiding-posix-classes"]], "Alternating and Grouping Subexpressions": [[113, "alternating-and-grouping-subexpressions"]], "Alternation Operator": [[113, "alternation-operator"]], "Grouping Subexpressions": [[113, "grouping-subexpressions"]], "Non-grouping Parentheses": [[113, "non-grouping-parentheses"]], "Quantifiers": [[113, "quantifiers"]], "Performance Notes": [[113, "performance-notes"]], "Capture Groups and References Thereto": [[113, "capture-groups-and-references-thereto"]], "Extracting Capture Group Matches": [[113, "extracting-capture-group-matches"]], "Locating Capture Group Matches": [[113, "locating-capture-group-matches"]], "Replacing with Capture Group Matches": [[113, "replacing-with-capture-group-matches"]], "Back-Referencing": [[113, "back-referencing"]], "Anchoring": [[113, "anchoring"]], "Matching at the Beginning or End of a String": [[113, "matching-at-the-beginning-or-end-of-a-string"]], "Matching at Word Boundaries": [[113, "matching-at-word-boundaries"]], "Looking Behind and Ahead": [[113, "looking-behind-and-ahead"]], "How to Cite": [[114, "how-to-cite"]], "Bibliography": [[114, "bibliography"]]}, "indexentries": {}}) \ No newline at end of file +Search.setIndex({"docnames": ["index", "install", "news", "rapi", "rapi/about_arguments", "rapi/about_encoding", "rapi/about_locale", "rapi/about_search", "rapi/about_search_boundaries", "rapi/about_search_charclass", "rapi/about_search_coll", "rapi/about_search_fixed", "rapi/about_search_regex", "rapi/about_stringi", "rapi/operator_add", "rapi/operator_compare", "rapi/operator_dollar", "rapi/stri_compare", "rapi/stri_count", "rapi/stri_count_boundaries", "rapi/stri_datetime_add", "rapi/stri_datetime_create", "rapi/stri_datetime_fields", "rapi/stri_datetime_format", "rapi/stri_datetime_fstr", "rapi/stri_datetime_now", "rapi/stri_datetime_symbols", "rapi/stri_detect", "rapi/stri_dup", "rapi/stri_duplicated", "rapi/stri_enc_detect", "rapi/stri_enc_detect2", "rapi/stri_enc_fromutf32", "rapi/stri_enc_info", "rapi/stri_enc_isascii", "rapi/stri_enc_isutf16", "rapi/stri_enc_isutf8", "rapi/stri_enc_list", "rapi/stri_enc_mark", "rapi/stri_enc_set", "rapi/stri_enc_toascii", "rapi/stri_enc_tonative", "rapi/stri_enc_toutf32", "rapi/stri_enc_toutf8", "rapi/stri_encode", "rapi/stri_escape_unicode", "rapi/stri_extract", "rapi/stri_extract_boundaries", "rapi/stri_flatten", "rapi/stri_info", "rapi/stri_isempty", "rapi/stri_join", "rapi/stri_join_list", "rapi/stri_length", "rapi/stri_list2matrix", "rapi/stri_locale_info", "rapi/stri_locale_list", "rapi/stri_locale_set", "rapi/stri_locate", "rapi/stri_locate_boundaries", "rapi/stri_match", "rapi/stri_na2empty", "rapi/stri_numbytes", "rapi/stri_opts_brkiter", "rapi/stri_opts_collator", "rapi/stri_opts_fixed", "rapi/stri_opts_regex", "rapi/stri_order", "rapi/stri_pad", "rapi/stri_rand_lipsum", "rapi/stri_rand_shuffle", "rapi/stri_rand_strings", "rapi/stri_rank", "rapi/stri_read_lines", "rapi/stri_read_raw", "rapi/stri_remove_empty", "rapi/stri_replace", "rapi/stri_replace_na", "rapi/stri_replace_rstr", "rapi/stri_reverse", "rapi/stri_sort", "rapi/stri_sort_key", "rapi/stri_split", "rapi/stri_split_boundaries", "rapi/stri_split_lines", "rapi/stri_sprintf", "rapi/stri_startsendswith", "rapi/stri_stats_general", "rapi/stri_stats_latex", "rapi/stri_sub", "rapi/stri_sub_all", "rapi/stri_subset", "rapi/stri_timezone_info", "rapi/stri_timezone_list", "rapi/stri_timezone_set", "rapi/stri_trans_casemap", "rapi/stri_trans_char", "rapi/stri_trans_general", "rapi/stri_trans_list", "rapi/stri_trans_nf", "rapi/stri_trim", "rapi/stri_unescape_unicode", "rapi/stri_unique", "rapi/stri_width", "rapi/stri_wrap", "rapi/stri_write_lines", "weave/basic_operations", "weave/codepoint_comparing", "weave/collation", "weave/design_principles", "weave/example", "weave/input_output", "weave/other_operations", "weave/regular_expressions", "z_bibliography"], "filenames": ["index.md", "install.md", "news.md", "rapi.md", "rapi/about_arguments.md", "rapi/about_encoding.md", "rapi/about_locale.md", "rapi/about_search.md", "rapi/about_search_boundaries.md", "rapi/about_search_charclass.md", "rapi/about_search_coll.md", "rapi/about_search_fixed.md", "rapi/about_search_regex.md", "rapi/about_stringi.md", "rapi/operator_add.md", "rapi/operator_compare.md", "rapi/operator_dollar.md", "rapi/stri_compare.md", "rapi/stri_count.md", "rapi/stri_count_boundaries.md", "rapi/stri_datetime_add.md", "rapi/stri_datetime_create.md", "rapi/stri_datetime_fields.md", "rapi/stri_datetime_format.md", "rapi/stri_datetime_fstr.md", "rapi/stri_datetime_now.md", "rapi/stri_datetime_symbols.md", "rapi/stri_detect.md", "rapi/stri_dup.md", "rapi/stri_duplicated.md", "rapi/stri_enc_detect.md", "rapi/stri_enc_detect2.md", "rapi/stri_enc_fromutf32.md", "rapi/stri_enc_info.md", "rapi/stri_enc_isascii.md", "rapi/stri_enc_isutf16.md", "rapi/stri_enc_isutf8.md", "rapi/stri_enc_list.md", "rapi/stri_enc_mark.md", "rapi/stri_enc_set.md", "rapi/stri_enc_toascii.md", "rapi/stri_enc_tonative.md", "rapi/stri_enc_toutf32.md", "rapi/stri_enc_toutf8.md", "rapi/stri_encode.md", "rapi/stri_escape_unicode.md", "rapi/stri_extract.md", "rapi/stri_extract_boundaries.md", "rapi/stri_flatten.md", "rapi/stri_info.md", "rapi/stri_isempty.md", "rapi/stri_join.md", "rapi/stri_join_list.md", "rapi/stri_length.md", "rapi/stri_list2matrix.md", "rapi/stri_locale_info.md", "rapi/stri_locale_list.md", "rapi/stri_locale_set.md", "rapi/stri_locate.md", "rapi/stri_locate_boundaries.md", "rapi/stri_match.md", "rapi/stri_na2empty.md", "rapi/stri_numbytes.md", "rapi/stri_opts_brkiter.md", "rapi/stri_opts_collator.md", "rapi/stri_opts_fixed.md", "rapi/stri_opts_regex.md", "rapi/stri_order.md", "rapi/stri_pad.md", "rapi/stri_rand_lipsum.md", "rapi/stri_rand_shuffle.md", "rapi/stri_rand_strings.md", "rapi/stri_rank.md", "rapi/stri_read_lines.md", "rapi/stri_read_raw.md", "rapi/stri_remove_empty.md", "rapi/stri_replace.md", "rapi/stri_replace_na.md", "rapi/stri_replace_rstr.md", "rapi/stri_reverse.md", "rapi/stri_sort.md", "rapi/stri_sort_key.md", "rapi/stri_split.md", "rapi/stri_split_boundaries.md", "rapi/stri_split_lines.md", "rapi/stri_sprintf.md", "rapi/stri_startsendswith.md", "rapi/stri_stats_general.md", "rapi/stri_stats_latex.md", "rapi/stri_sub.md", "rapi/stri_sub_all.md", "rapi/stri_subset.md", "rapi/stri_timezone_info.md", "rapi/stri_timezone_list.md", "rapi/stri_timezone_set.md", "rapi/stri_trans_casemap.md", "rapi/stri_trans_char.md", "rapi/stri_trans_general.md", "rapi/stri_trans_list.md", "rapi/stri_trans_nf.md", "rapi/stri_trim.md", "rapi/stri_unescape_unicode.md", "rapi/stri_unique.md", "rapi/stri_width.md", "rapi/stri_wrap.md", "rapi/stri_write_lines.md", "weave/basic_operations.md", "weave/codepoint_comparing.md", "weave/collation.md", "weave/design_principles.md", "weave/example.md", "weave/input_output.md", "weave/other_operations.md", "weave/regular_expressions.md", "z_bibliography.md"], "titles": ["stringi: Fast and Portable Character String Processing in R", "Installing stringi", "Changelog", "R Package stringi Reference", "about_arguments:", "about_encoding:", "about_locale:", "about_search: String Searching", "about_search_boundaries:", "about_search_charclass:", "about_search_coll:", "about_search_fixed:", "about_search_regex:", "about_stringi: Fast and Portable Character String Processing in R", "operator_add: Concatenate Two Character Vectors", "operator_compare: Compare Strings with or without Collation", "operator_dollar: as a Binary Operator", "stri_compare: Compare Strings with or without Collation", "stri_count: Count the Number of Pattern Occurrences", "stri_count_boundaries: Count the Number of Text Boundaries", "stri_datetime_add: Date and Time Arithmetic", "stri_datetime_create: Create a Date-Time Object", "stri_datetime_fields: Get Values for Date and Time Fields", "stri_datetime_format: Date and Time Formatting and Parsing", "stri_datetime_fstr: -Style Format Strings", "stri_datetime_now: Get Current Date and Time", "stri_datetime_symbols: List Localizable Date-Time Formatting Data", "stri_detect: Detect Pattern Occurrences", "stri_dup: Duplicate Strings", "stri_duplicated: Determine Duplicated Elements", "stri_enc_detect: Detect Character Set and Language", "stri_enc_detect2: [DEPRECATED] Detect Locale-Sensitive Character Encoding", "stri_enc_fromutf32: Convert From UTF-32", "stri_enc_info: Query a Character Encoding", "stri_enc_isascii: Check If a Data Stream Is Possibly in ASCII", "stri_enc_isutf16: Check If a Data Stream Is Possibly in UTF-16 or UTF-32", "stri_enc_isutf8: Check If a Data Stream Is Possibly in UTF-8", "stri_enc_list: List Known Character Encodings", "stri_enc_mark: Get Declared Encodings of Each String", "stri_enc_set:", "stri_enc_toascii: Convert To ASCII", "stri_enc_tonative: Convert Strings To Native Encoding", "stri_enc_toutf32: Convert Strings To UTF-32", "stri_enc_toutf8: Convert Strings To UTF-8", "stri_encode: Convert Strings Between Given Encodings", "stri_escape_unicode: Escape Unicode Code Points", "stri_extract: Extract Pattern Occurrences", "stri_extract_boundaries: Extract Data Between Text Boundaries", "stri_flatten: Flatten a String", "stri_info:", "stri_isempty: Determine if a String is of Length Zero", "stri_join: Concatenate Character Vectors", "stri_join_list: Concatenate Strings in a List", "stri_length: Count the Number of Code Points", "stri_list2matrix: Convert a List to a Character Matrix", "stri_locale_info: Query Given Locale", "stri_locale_list: List Available Locales", "stri_locale_set:", "stri_locate: Locate Pattern Occurrences", "stri_locate_boundaries: Locate Text Boundaries", "stri_match: Extract Regex Pattern Matches, Together with Capture Groups", "stri_na2empty: Replace NAs with Empty Strings", "stri_numbytes: Count the Number of Bytes", "stri_opts_brkiter: Generate a List with BreakIterator Settings", "stri_opts_collator: Generate a List with Collator Settings", "stri_opts_fixed: Generate a List with Fixed Pattern Search Engine\u2019s Settings", "stri_opts_regex: Generate a List with Regex Matcher Settings", "stri_order: Ordering Permutation", "stri_pad: Pad (Center/Left/Right Align) a String", "stri_rand_lipsum: A Lorem Ipsum Generator", "stri_rand_shuffle: Randomly Shuffle Code Points in Each String", "stri_rand_strings: Generate Random Strings", "stri_rank: Ranking", "stri_read_lines: Read Text Lines from a Text File", "stri_read_raw: Read Text File as Raw", "stri_remove_empty: Remove All Empty Strings from a Character Vector", "stri_replace: Replace Pattern Occurrences", "stri_replace_na: Replace Missing Values in a Character Vector", "stri_replace_rstr: Convert gsub-Style Replacement Strings", "stri_reverse: Reverse Each String", "stri_sort: String Sorting", "stri_sort_key: Sort Keys", "stri_split: Split a String By Pattern Matches", "stri_split_boundaries: Split a String at Text Boundaries", "stri_split_lines: Split a String Into Text Lines", "stri_sprintf: Format Strings", "stri_startsendswith: Determine if the Start or End of a String Matches a Pattern", "stri_stats_general: General Statistics for a Character Vector", "stri_stats_latex: Statistics for a Character Vector Containing LaTeX Commands", "stri_sub: Extract a Substring From or Replace a Substring In a Character Vector", "stri_sub_all: Extract or Replace Multiple Substrings", "stri_subset: Select Elements that Match a Given Pattern", "stri_timezone_info: Query a Given Time Zone", "stri_timezone_list: List Available Time Zone Identifiers", "stri_timezone_set:", "stri_trans_casemap: Transform Strings with Case Mapping or Folding", "stri_trans_char: Translate Characters", "stri_trans_general: General Text Transforms, Including Transliteration", "stri_trans_list: List Available Text Transforms and Transliterators", "stri_trans_nf: Perform or Check For Unicode Normalization", "stri_trim: Trim Characters from the Left and/or Right Side of a String", "stri_unescape_unicode: Un-escape All Escape Sequences", "stri_unique: Extract Unique Elements", "stri_width: Determine the Width of Code Points", "stri_wrap: Word Wrap Text to Format Paragraphs", "stri_write_lines: Write Text Lines to a Text File", "Basic String Operations", "Code-Pointwise Comparing", "Collation", "General Design Principles", "Example Use Case: Data Preparation", "Input and Output", "Other Operations", "Regular Expressions", "References"], "terms": {"pronounc": 0, "ipa": [0, 98], "strin\u0261i": 0, "i": [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 24, 25, 26, 27, 30, 31, 32, 33, 37, 38, 39, 40, 42, 43, 44, 45, 46, 47, 48, 49, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 62, 63, 64, 65, 66, 67, 68, 69, 71, 72, 73, 74, 75, 76, 77, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113], "THE": [0, 13, 47, 82], "packag": [0, 1, 2, 5, 9, 13, 47, 57, 68, 94, 95, 108, 109, 110, 113, 114], "correct": [0, 2, 6, 10, 11, 13, 89, 108, 111], "consist": [0, 2, 4, 5, 9, 13, 17, 40, 47, 52, 60, 68, 69, 71, 90, 95, 96, 106, 107, 109, 113, 114], "conveni": [0, 2, 13, 18, 27, 32, 46, 57, 58, 60, 63, 64, 65, 66, 68, 76, 77, 82, 86, 91, 97, 100, 106, 107, 109, 110, 111, 112], "text": [0, 2, 3, 5, 7, 8, 9, 10, 12, 13, 23, 30, 31, 37, 63, 68, 69, 82, 85, 87, 88, 89, 95, 99, 103, 106, 108, 109, 110, 113, 114], "ani": [0, 2, 4, 5, 6, 9, 12, 13, 17, 23, 29, 32, 43, 45, 51, 55, 63, 76, 84, 89, 90, 92, 97, 98, 99, 103, 106, 107, 108, 109, 110, 111, 112], "local": [0, 2, 3, 7, 8, 9, 12, 13, 15, 17, 19, 20, 21, 22, 23, 26, 29, 37, 46, 47, 49, 57, 58, 59, 63, 64, 67, 72, 80, 81, 83, 85, 92, 93, 95, 97, 102, 104, 109, 111, 112, 113], "encod": [0, 2, 3, 9, 13, 30, 32, 34, 35, 36, 39, 40, 42, 43, 49, 53, 62, 73, 74, 81, 91, 99, 105, 109], "thank": [0, 2, 109, 111, 114], "icu": [0, 1, 2, 5, 6, 7, 8, 9, 10, 13, 17, 19, 20, 23, 24, 26, 29, 30, 31, 33, 37, 38, 39, 44, 46, 47, 49, 55, 56, 59, 60, 63, 64, 65, 66, 67, 72, 76, 80, 81, 83, 92, 93, 94, 95, 97, 98, 99, 101, 102, 104, 107, 108, 109, 111, 112, 113, 114], "intern": [0, 2, 5, 13, 30, 32, 37, 39, 44, 49, 62, 94], "compon": [0, 13, 26, 31, 33, 49, 92, 109], "unicod": [0, 1, 2, 3, 5, 6, 7, 8, 10, 11, 12, 13, 17, 19, 20, 23, 26, 29, 30, 32, 33, 37, 42, 43, 44, 49, 53, 57, 62, 63, 64, 65, 66, 67, 68, 70, 71, 72, 73, 79, 80, 81, 82, 84, 85, 87, 89, 93, 94, 95, 96, 97, 98, 100, 101, 102, 103, 104, 106, 107, 108, 109, 110, 112, 113, 114], "fulli": [0, 31, 109, 113], "support": [0, 2, 5, 6, 9, 23, 24, 37, 39, 44, 46, 49, 62, 82, 85, 92, 97, 99, 107, 108, 111, 112, 113], "wide": [0, 5, 26, 99, 112], "rang": [0, 5, 9, 12, 23, 89, 90, 97, 110, 112], "standard": [0, 2, 5, 6, 9, 12, 33, 37, 59, 62, 83, 84, 85, 92, 93, 99, 103, 108, 109, 111, 112, 113], "see": [0, 1, 2, 106, 107, 108, 109, 110, 111, 112, 113], "also": [0, 1, 2, 106, 107, 108, 109, 111, 112, 113], "thi": [0, 1, 2, 4, 5, 6, 7, 8, 9, 12, 17, 18, 19, 22, 23, 24, 27, 30, 31, 32, 33, 34, 36, 37, 38, 40, 41, 42, 43, 44, 46, 50, 51, 53, 54, 55, 58, 59, 60, 61, 62, 64, 66, 67, 68, 70, 71, 72, 73, 76, 77, 79, 80, 81, 83, 84, 85, 86, 87, 88, 90, 93, 95, 97, 99, 102, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113], "video": 0, "stri_extract_al": [0, 2, 7, 46, 47, 54, 60, 90, 106, 107], "regex": [0, 2, 3, 4, 7, 9, 18, 27, 46, 58, 76, 82, 86, 91, 107, 109, 113], "p": [0, 9, 11, 12, 18, 27, 46, 48, 51, 52, 56, 63, 71, 76, 80, 82, 83, 84, 85, 86, 97, 98, 100, 107, 109, 111, 112, 113], "emoji": [0, 2, 9, 46, 103, 106, 111, 113], "c": [0, 1, 2, 6, 9, 12, 14, 15, 16, 17, 18, 23, 24, 27, 28, 29, 32, 38, 46, 48, 49, 50, 51, 52, 53, 54, 56, 58, 60, 61, 62, 65, 67, 68, 70, 72, 75, 76, 77, 79, 80, 81, 82, 83, 85, 86, 87, 88, 89, 90, 91, 92, 95, 97, 98, 100, 102, 103, 106, 107, 108, 109, 110, 111, 112, 113, 114], "\u6b61\u8fce": 0, "\u6b22\u8fce": 0, "\u03c7\u03b1\u03af\u03c1\u03b5\u03c4\u03b5": 0, "bienvenido": 0, "spam": [0, 19, 52, 58, 59, 83, 89, 106, 109, 112, 113], "1": [0, 1, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114], "2": [0, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114], "stri_count_fix": [0, 2, 18, 65, 107, 109], "acatgaacgggtacacactg": 0, "aca": [0, 60, 107, 109], "overlap": [0, 2, 9, 46, 58, 60, 65, 76, 107, 113], "true": [0, 1, 2, 5, 9, 12, 15, 17, 19, 21, 23, 24, 27, 29, 34, 36, 37, 43, 44, 46, 47, 48, 49, 50, 51, 52, 54, 58, 59, 64, 65, 66, 67, 68, 69, 71, 72, 75, 76, 80, 82, 83, 84, 85, 86, 89, 90, 91, 92, 93, 97, 100, 104, 106, 107, 108, 109, 110, 111, 113], "3": [0, 9, 13, 14, 16, 18, 23, 26, 27, 29, 34, 36, 37, 46, 48, 50, 51, 53, 54, 58, 59, 60, 62, 64, 67, 70, 72, 76, 80, 82, 83, 85, 87, 88, 90, 93, 98, 101, 104, 106, 107, 108, 109, 110, 111, 112, 113, 114], "stri_sort": [0, 2, 3, 6, 8, 10, 13, 15, 17, 19, 29, 31, 47, 59, 64, 67, 72, 81, 83, 95, 102, 104, 108], "cudn\u00fd": [0, 108], "chladn\u00fd": [0, 108], "hladn\u00fd": [0, 108], "\u010dudn\u00fd": [0, 108], "sk_sk": [0, 17, 46, 56, 58, 67, 72, 80, 81, 92, 108], "come": [0, 2, 8, 95, 106, 112, 113], "numer": [0, 2, 4, 5, 9, 12, 21, 23, 30, 31, 64, 67, 72, 80, 85, 93, 104, 106, 107, 110, 113], "function": [0, 2, 4, 5, 9, 10, 11, 13, 15, 17, 18, 19, 20, 23, 24, 27, 29, 30, 31, 32, 34, 35, 36, 38, 40, 41, 42, 43, 44, 46, 47, 51, 52, 53, 54, 55, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 72, 73, 76, 77, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 97, 99, 100, 102, 103, 104, 105, 107, 108, 109, 110, 111, 112, 113], "relat": [0, 13, 15, 17, 23, 106, 107, 110, 111], "data": [0, 2, 3, 5, 9, 11, 22, 23, 30, 31, 38, 44, 62, 64, 67, 69, 72, 82, 93, 105, 107, 108, 111, 112, 113, 114], "cleans": [0, 110], "inform": [0, 2, 5, 6, 10, 12, 13, 17, 19, 33, 37, 47, 49, 55, 56, 57, 59, 67, 72, 80, 81, 83, 92, 93, 94, 106, 110], "extract": [0, 2, 3, 7, 12, 13, 29, 58, 82, 83, 110], "natur": [0, 2, 5, 7, 11, 13, 17, 29, 64, 102, 104, 108, 109, 113], "languag": [0, 2, 3, 5, 6, 7, 8, 11, 13, 17, 29, 31, 55, 57, 64, 65, 95, 97, 102, 104, 108, 109, 111, 112, 113, 114], "concaten": [0, 2, 3, 5, 13, 28, 106, 109, 113], "pad": [0, 2, 3, 13, 85], "wrap": [0, 2, 3, 8, 13, 68, 90, 109, 110], "substr": [0, 2, 3, 12, 13, 46, 60, 64, 76, 82, 107, 108, 109, 113], "pattern": [0, 2, 3, 4, 7, 10, 11, 12, 13, 23, 30, 66, 71, 96, 100, 108, 109, 112, 113, 114], "search": [0, 1, 2, 3, 4, 5, 6, 9, 11, 12, 13, 18, 19, 27, 29, 46, 47, 58, 59, 60, 63, 64, 66, 71, 76, 82, 83, 86, 87, 91, 100, 103, 109, 112, 113], "e": [0, 1, 2, 4, 5, 6, 7, 9, 12, 13, 14, 17, 19, 20, 22, 23, 30, 33, 37, 38, 39, 40, 42, 43, 44, 46, 47, 48, 51, 53, 54, 55, 56, 57, 59, 60, 63, 64, 66, 77, 79, 80, 81, 82, 83, 85, 86, 87, 88, 89, 92, 93, 94, 95, 98, 99, 100, 101, 104, 106, 107, 108, 109, 110, 111, 112, 113, 114], "g": [0, 1, 2, 4, 5, 6, 7, 9, 12, 14, 17, 20, 22, 23, 24, 30, 33, 38, 42, 44, 46, 48, 51, 53, 54, 55, 57, 63, 64, 66, 77, 80, 81, 82, 83, 85, 87, 88, 97, 99, 100, 106, 107, 108, 109, 110, 111, 112, 113, 114], "java": [0, 10, 12, 13, 33, 98, 113], "like": [0, 1, 2, 4, 5, 9, 12, 13, 14, 19, 23, 24, 31, 47, 51, 59, 68, 76, 83, 90, 102, 106, 107, 108, 109, 110, 111, 112, 113], "regular": [0, 4, 5, 7, 9, 12, 13, 60, 66, 84, 100, 107, 109, 114], "express": [0, 4, 5, 7, 9, 12, 13, 60, 66, 84, 100, 107, 109, 114], "collat": [0, 2, 3, 6, 7, 10, 13, 29, 67, 72, 80, 81, 102, 107, 109], "sort": [0, 2, 3, 5, 6, 13, 37, 64, 67, 90], "rank": [0, 2, 3, 13, 81, 108], "random": [0, 2, 3, 9, 13, 69, 70, 79, 106], "gener": [0, 1, 2, 3, 4, 6, 7, 8, 12, 13, 18, 23, 27, 32, 39, 40, 42, 44, 45, 46, 53, 58, 59, 61, 70, 81, 85, 86, 89, 90, 93, 95, 98, 99, 100, 103, 106, 107, 108, 110, 113], "transliter": [0, 2, 3, 13, 108, 109, 110], "case": [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 17, 19, 24, 27, 30, 31, 43, 44, 46, 47, 51, 53, 55, 58, 60, 63, 64, 65, 66, 70, 76, 82, 83, 89, 97, 99, 104, 106, 107, 109, 111, 113], "map": [0, 2, 3, 5, 6, 13, 40, 43, 55, 65, 106, 113], "fold": [0, 2, 3, 13, 99], "normalis": [0, 2, 64, 104, 108, 109, 112], "date": [0, 2, 3, 13, 24, 85, 93, 94, 108, 109, 113], "time": [0, 2, 3, 5, 9, 11, 12, 13, 14, 24, 28, 29, 66, 82, 85, 94, 96, 106, 107, 108, 109, 113], "format": [0, 2, 3, 8, 9, 12, 13, 16, 30, 99, 106, 108, 111, 113], "pars": [0, 2, 3, 13, 108, 110, 113], "mani": [0, 2, 6, 7, 9, 12, 13, 55, 57, 58, 94, 99, 100, 104, 106, 107, 108, 109, 110, 111, 112, 113], "more": [0, 2, 4, 5, 6, 8, 9, 10, 12, 13, 17, 18, 19, 23, 24, 27, 30, 31, 33, 37, 43, 44, 46, 47, 48, 56, 57, 58, 59, 60, 64, 67, 72, 73, 76, 80, 81, 82, 83, 86, 91, 92, 94, 95, 99, 100, 104, 106, 107, 108, 109, 110, 111, 112, 113], "among": [0, 2, 5, 9, 13, 60, 68], "most": [0, 1, 2, 5, 9, 23, 24, 26, 30, 35, 36, 64, 66, 99, 103, 104, 106, 108, 109, 110, 111, 112, 113], "often": [0, 10, 30, 35, 62, 69, 97, 99, 107, 109, 113], "download": [0, 1, 2, 108, 110], "you": [0, 1, 2, 4, 5, 6, 9, 10, 11, 12, 17, 30, 31, 38, 39, 42, 43, 48, 51, 52, 55, 57, 58, 62, 66, 70, 76, 82, 86, 87, 99, 100, 104, 109, 114], "can": [0, 1, 2, 4, 5, 8, 9, 30, 32, 38, 41, 43, 44, 70, 74, 78, 95, 97, 98, 100, 104, 106, 107, 108, 109, 110, 111, 112, 113], "obtain": [0, 2, 5, 9, 30, 31, 55, 87, 88, 93, 106, 107, 109, 113], "from": [0, 1, 2, 3, 4, 5, 9, 12, 13, 17, 21, 23, 26, 29, 30, 37, 43, 44, 46, 51, 58, 59, 66, 67, 69, 71, 76, 80, 82, 84, 86, 90, 91, 93, 97, 99, 107, 108, 110, 111, 112, 113], "cran": [0, 1, 2, 108], "call": [0, 1, 2, 4, 5, 6, 11, 14, 15, 17, 18, 19, 20, 22, 23, 27, 30, 41, 42, 43, 44, 46, 47, 48, 55, 57, 58, 59, 60, 73, 76, 82, 83, 85, 86, 91, 93, 97, 104, 106, 107, 108, 109, 110, 111, 112, 113], "instal": [0, 2, 108, 109], "": [0, 1, 2, 3, 107, 108, 109, 110, 111, 112, 113, 114], "sourc": [0, 1, 2, 69, 108, 109, 110, 111], "code": [0, 2, 3, 5, 6, 8, 9, 12, 13, 15, 17, 19, 31, 32, 33, 40, 42, 43, 44, 62, 64, 65, 68, 71, 79, 85, 86, 87, 89, 93, 95, 96, 102, 104, 108, 109, 112], "host": 0, "github": [0, 1, 2, 5, 6, 8, 9, 10, 12, 13, 17, 20, 23, 26, 29, 30, 44, 63, 64, 65, 66, 67, 72, 80, 81, 93, 94, 95, 97, 98, 99, 102, 103, 110, 111, 113], "It": [0, 2, 5, 6, 11, 13, 18, 27, 38, 55, 72, 77, 81, 82, 95, 104, 105, 106, 107, 109, 110, 111, 112, 113], "distribut": [0, 2, 13, 69], "under": [0, 2, 5, 13, 110], "open": [0, 2, 9, 73, 74, 105, 106, 107, 108, 109, 110, 111, 112, 113], "bsd": [0, 2, 13], "claus": [0, 2, 13], "licens": [0, 2, 13], "The": [0, 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114], "api": [0, 2, 9, 13, 24, 26, 32, 38, 63, 64, 66, 93, 94, 109], "wa": [0, 2, 13, 29, 46, 49, 60, 68, 99, 104, 106, 107, 108, 109, 110, 111, 112, 113], "inspir": [0, 12, 31, 113], "earli": [0, 2, 109], "pre": [0, 1, 2, 108, 113], "tidyvers": 0, "v0": 0, "6": [0, 14, 16, 18, 22, 26, 30, 37, 47, 48, 51, 56, 58, 59, 67, 72, 76, 83, 85, 93, 98, 106, 108, 109, 110, 112, 113, 114], "version": [0, 2, 20, 32, 37, 44, 49, 75, 80, 89, 90, 101, 102, 106, 107, 108, 109, 111, 112, 113], "hadlei": [0, 114], "wickham": [0, 114], "stringr": [0, 2, 109, 114], "sinc": [0, 9, 12, 25, 46, 76, 93, 109, 113], "2015": [0, 20, 21, 23, 109, 110, 114], "v1": 0, "0": [0, 9, 12, 17, 18, 21, 22, 23, 27, 29, 30, 31, 32, 37, 44, 51, 52, 54, 58, 59, 64, 66, 67, 68, 71, 72, 73, 76, 80, 82, 85, 89, 90, 91, 92, 93, 99, 103, 104, 106, 107, 108, 109, 110, 111, 112, 113, 114], "power": [0, 12, 109], "moreov": [0, 2, 5, 9, 19, 24, 27, 38, 51, 53, 54, 58, 76, 84, 85, 91, 104, 106, 107, 108, 110, 111, 112, 113], "suggest": [0, 2, 104, 105], "quit": [0, 1, 5, 12, 66, 107, 109, 110, 113], "few": [0, 1, 2, 12, 23, 30, 31, 85, 111, 112, 113], "new": [0, 2, 12, 14, 83, 93, 104, 106, 109, 113], "featur": [0, 1, 2, 12, 19, 59, 60, 68, 83, 85, 109, 112, 113], "contribut": [0, 13], "bart\u0142omiej": 0, "tartanu": [0, 13], "other": [0, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 113, 114], "greatli": 0, "appreci": 0, "stringx": [0, 109, 114], "set": [0, 1, 2, 3, 4, 5, 6, 9, 11, 12, 17, 18, 19, 20, 21, 22, 23, 27, 29, 32, 39, 42, 43, 44, 46, 47, 49, 51, 53, 58, 59, 60, 67, 69, 71, 72, 76, 80, 81, 82, 83, 84, 86, 91, 94, 95, 102, 106, 107, 108, 109, 110, 111, 112], "wrapper": [0, 60, 100, 109, 113], "around": [0, 109, 110, 113], "base": [0, 1, 2, 5, 7, 9, 10, 12, 13, 15, 21, 22, 23, 24, 29, 31, 64, 69, 72, 85, 86, 89, 90, 97, 102, 103, 104, 106, 107, 108, 110, 111, 112, 113], "compat": [0, 2, 12, 23, 85, 99, 103, 104, 109, 111, 112, 113], "To": [0, 1, 3, 17, 97, 107, 108, 109, 110, 111, 112, 113], "learn": [0, 106, 107, 108, 109, 110, 111, 112, 113], "about": [0, 2, 106, 107, 108, 109, 110, 111, 112, 113], "check": [0, 1, 2, 3, 5, 6, 9, 17, 30, 31, 38, 46, 64, 68, 85, 86, 106, 107, 108, 109, 110, 111, 112, 113], "out": [0, 1, 2, 5, 9, 46, 50, 68, 69, 89, 100, 106, 107, 108, 109, 110, 111, 112, 113], "marek": [0, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113], "access": [0, 2, 9, 16, 42, 106, 107, 108, 109, 110, 111, 112, 113], "free": [0, 12, 95, 106, 107, 108, 109, 110, 111, 112, 113], "textbook": [0, 106, 107, 108, 109, 110, 111, 112, 113], "deep": [0, 4, 106, 107, 108, 109, 110, 111, 112, 113, 114], "program": [0, 5, 6, 104, 106, 107, 108, 109, 110, 111, 112, 113, 114], "citat": [0, 110], "gagolewski": [0, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 108, 114], "m": [0, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 112, 113, 114], "journal": [0, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114], "statist": [0, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114], "softwar": [0, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114], "103": [0, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 114], "2022": [0, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 114], "59": [0, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 111, 113, 114], "doi": [0, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 114], "10": [0, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 108, 109, 110, 111, 113, 114], "18637": [0, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 114], "jss": [0, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 114], "v103": [0, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 114], "i02": [0, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 114], "In": [1, 2, 3, 4, 5, 6, 9, 12, 13, 19, 23, 29, 38, 44, 46, 47, 51, 55, 58, 69, 76, 78, 82, 83, 90, 91, 93, 97, 104, 107, 108, 109, 111, 112, 113], "simpl": [1, 2, 5, 38, 65, 69, 104, 107, 108], "howev": [1, 2, 5, 6, 9, 12, 14, 30, 35, 36, 44, 54, 55, 60, 62, 76, 97, 107, 108, 109, 112, 113], "due": [1, 4, 5, 37, 106, 107, 108, 109, 111, 113], "overwhelm": 1, "complex": [1, 5, 10, 11, 64, 96, 104, 107], "librari": [1, 2, 17, 31, 49, 100, 108, 109, 110, 111, 113], "upon": [1, 111], "which": [1, 2, 4, 5, 6, 8, 9, 10, 13, 19, 29, 30, 40, 44, 51, 58, 62, 64, 67, 68, 73, 78, 80, 81, 82, 83, 85, 93, 99, 104, 106, 107, 108, 109, 110, 111, 112, 113], "divers": 1, "environ": [1, 2, 41, 88, 113], "oper": [1, 2, 3, 4, 5, 7, 8, 9, 13, 14, 15, 17, 21, 29, 30, 32, 42, 57, 62, 66, 68, 70, 71, 79, 89, 90, 94, 97, 102, 104, 107, 108, 109, 110, 111], "might": [1, 2, 9, 11, 17, 19, 23, 27, 30, 37, 44, 85, 89, 93, 103, 106, 107, 108, 109, 111, 113], "still": [1, 2, 6, 111, 113], "experi": [1, 104, 114], "issu": [1, 2, 4, 13, 42, 44, 109, 113], "hopefulli": 1, "thei": [1, 2, 5, 9, 12, 13, 15, 17, 23, 32, 43, 44, 46, 58, 60, 63, 65, 67, 76, 80, 86, 91, 97, 107, 108, 109, 111, 112, 113], "resolv": [1, 2, 108], "short": [1, 2, 9, 11, 23, 49, 92, 110], "manual": [1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105], "below": [1, 2, 4, 5, 8, 9, 12, 17, 33, 46, 58, 64, 67, 76, 80, 87, 97, 106, 107, 108, 110, 111, 112, 113, 114], "we": [1, 2, 4, 5, 6, 9, 29, 33, 38, 39, 44, 45, 53, 54, 87, 88, 103, 105, 106, 107, 108, 109, 110, 111, 112, 113], "describ": [1, 9, 10, 11, 12, 54, 106, 108, 113], "some": [1, 2, 4, 5, 9, 11, 12, 13, 23, 24, 30, 33, 37, 44, 48, 55, 56, 57, 58, 63, 66, 85, 88, 89, 92, 97, 101, 106, 107, 109, 110, 111, 112, 113], "avail": [1, 2, 3, 6, 7, 9, 12, 23, 37, 46, 65, 66, 76, 85, 92, 97, 107, 108, 109, 111, 112, 113], "tweak": [1, 2, 11, 107], "ar": [1, 2, 4, 5, 6, 7, 9, 10, 12, 13, 15, 16, 17, 19, 21, 23, 24, 25, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 42, 43, 44, 45, 46, 47, 49, 50, 51, 52, 53, 54, 56, 57, 58, 59, 60, 62, 63, 64, 66, 67, 69, 71, 76, 80, 82, 83, 84, 85, 86, 87, 89, 90, 91, 93, 96, 97, 98, 99, 100, 101, 102, 103, 104, 106, 107, 108, 109, 110, 111, 112, 113], "strongli": [1, 9, 113], "encourag": [1, 103, 109], "reli": [1, 2, 5, 86, 100, 107, 108, 109, 110, 111, 113], "our": [1, 2, 4, 5, 100, 107, 109, 110, 113], "custom": [1, 2, 63, 85, 97, 109, 112], "74": [1, 2, 37, 57, 93, 98, 110, 112], "bundl": [1, 2, 6, 26, 57, 108], "configur": [1, 2, 30, 89, 108, 109, 110], "arg": [1, 2, 108, 109], "disabl": [1, 2, 12, 108, 109], "pkg": [1, 2, 108, 109], "config": [1, 2, 108, 109], "ensur": [1, 111], "maximum": [1, 108], "portabl": [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 108, 109, 111, 113, 114], "across": [1, 2, 109, 111], "all": [1, 2, 3, 4, 5, 6, 7, 9, 10, 12, 13, 15, 17, 18, 19, 22, 23, 26, 27, 28, 29, 30, 31, 33, 34, 36, 38, 40, 43, 44, 45, 46, 47, 52, 56, 57, 58, 59, 60, 61, 64, 76, 82, 83, 85, 93, 94, 99, 100, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114], "platform": [1, 2, 5, 6, 13, 38, 84, 94, 105, 108, 109, 111], "window": [1, 2, 5, 30, 33, 36, 37, 62, 92, 93, 101, 105, 108, 109, 111], "maco": [1, 37, 108, 111], "user": [1, 2, 5, 6, 8, 9, 10, 12, 17, 20, 23, 26, 29, 30, 39, 44, 63, 64, 65, 66, 67, 72, 80, 81, 93, 95, 97, 98, 99, 102, 108, 109, 112, 113], "fetch": [1, 92, 93, 110], "compil": [1, 2, 108, 109], "binari": [1, 2, 3, 7, 14, 18, 73, 74, 87, 100, 105, 106, 109, 112, 113], "built": [1, 2, 49, 51, 54, 85, 106, 109, 111, 112], "precis": [1, 2, 5, 6, 66, 93, 106, 107, 111], "wai": [1, 2, 5, 10, 11, 12, 16, 23, 34, 35, 36, 44, 50, 64, 73, 77, 82, 97, 104, 105, 106, 107, 108, 111, 112, 113], "depend": [1, 2, 5, 6, 8, 9, 12, 15, 17, 18, 22, 23, 27, 29, 46, 57, 58, 66, 67, 72, 76, 80, 81, 82, 84, 86, 91, 94, 95, 97, 102, 104, 108, 111, 113], "61": [1, 2, 26, 37, 46, 56, 93, 98, 110, 111], "togeth": [1, 3, 6, 49, 97, 111], "ship": [1, 2, 108], "one": [1, 2, 4, 5, 6, 8, 9, 12, 18, 20, 23, 26, 27, 32, 33, 38, 42, 44, 46, 48, 53, 54, 55, 58, 60, 62, 63, 64, 68, 71, 76, 87, 90, 92, 93, 95, 97, 99, 105, 106, 107, 108, 109, 110, 113], "follow": [1, 2, 4, 5, 6, 7, 9, 12, 13, 19, 22, 26, 29, 30, 31, 33, 45, 47, 49, 55, 59, 63, 69, 84, 85, 87, 88, 92, 95, 97, 99, 101, 103, 104, 106, 107, 108, 109, 110, 111, 112, 113], "requir": [1, 2, 11, 12, 23, 63, 107, 108, 109, 110, 112], "met": [1, 93], "http": [1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 110, 111, 113, 114], "org": [1, 2, 5, 6, 8, 9, 10, 12, 13, 17, 20, 23, 26, 29, 30, 44, 63, 64, 65, 66, 67, 72, 80, 81, 84, 85, 93, 94, 95, 97, 98, 99, 100, 102, 103, 110, 111, 113, 114], "libicu": [1, 2, 108], "devel": [1, 108], "fedora": [1, 108], "cento": [1, 2], "opensus": [1, 2, 108], "dev": [1, 2, 9, 13, 26, 37, 63, 64, 66, 93, 94, 108], "ubuntu": [1, 2, 108, 109], "debian": [1, 108], "etc": [1, 2, 4, 5, 12, 21, 22, 26, 42, 46, 63, 82, 93, 108, 109, 111, 112, 113], "fail": [1, 2, 5, 12, 30, 31, 39, 41, 43, 62, 66], "find": [1, 4, 8, 9, 50, 58, 67, 107, 109, 110, 112, 113], "appropri": [1, 8, 44, 46, 64, 82, 108], "project": [1, 2, 10, 100, 109], "r": [1, 2, 4, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 110, 111, 112, 113, 114], "cmd": [1, 88], "argument": [1, 2, 5, 6, 13, 106, 107, 108, 109], "stringi_disable_pkg_config": [1, 2], "variabl": [1, 2, 64, 106, 108, 113], "non": [1, 2, 4, 5, 9, 10, 12, 17, 19, 20, 21, 22, 23, 27, 29, 45, 47, 59, 64, 67, 69, 70, 71, 79, 80, 83, 87, 89, 91, 101, 102, 104, 106, 108, 109, 111, 112], "zero": [1, 2, 3, 5, 9, 12, 23, 58, 82, 103, 104, 106, 109], "execut": [1, 45, 109], "addit": [1, 2, 17, 18, 19, 23, 27, 29, 46, 47, 58, 59, 60, 67, 72, 76, 80, 81, 82, 83, 86, 91, 93, 95, 102, 110, 113], "option": [1, 2, 6, 15, 17, 29, 30, 43, 51, 52, 67, 72, 80, 81, 102, 106, 109, 112, 113], "script": [1, 2, 9, 12, 68, 71, 97, 112, 113], "enforc": [1, 109], "system": [1, 2, 5, 6, 8, 9, 38, 39, 49, 85, 107, 108, 109, 111, 113], "extra": [1, 64, 96, 108], "cxxflag": 1, "flag": [1, 2, 12, 23, 49, 66, 85], "cppflag": [1, 2], "preprocessor": 1, "ldflag": [1, 2], "linker": 1, "lib": [1, 2, 49], "link": [1, 2, 9, 13, 109, 110], "against": [1, 2, 30, 107, 109], "pkg_config_path": 1, "an": [1, 2, 4, 5, 6, 9, 12, 14, 17, 18, 19, 20, 21, 22, 23, 25, 26, 28, 30, 32, 33, 37, 38, 39, 40, 42, 43, 44, 45, 46, 47, 50, 51, 52, 53, 58, 59, 62, 63, 64, 66, 67, 77, 80, 81, 82, 83, 85, 86, 87, 88, 89, 93, 100, 101, 102, 103, 104, 106, 107, 108, 109, 111, 112, 113], "list": [1, 2, 3, 4, 5, 6, 8, 9, 12, 13, 16, 17, 18, 19, 27, 29, 30, 31, 32, 33, 34, 35, 36, 39, 42, 44, 46, 47, 49, 55, 58, 59, 60, 67, 72, 76, 80, 81, 82, 83, 84, 86, 90, 91, 92, 95, 97, 102, 103, 104, 107, 109, 110, 111, 112, 113], "directori": 1, "pc": [1, 9, 37], "file": [1, 2, 3, 5, 13, 30, 63, 84, 85, 87, 88, 107, 108, 110, 112, 113], "r_home": 1, "overrid": 1, "usr": 1, "lib64": 1, "note": [1, 2, 5, 8, 9, 10, 11, 12, 13, 14, 17, 18, 19, 20, 22, 23, 30, 32, 35, 36, 39, 40, 41, 43, 44, 46, 47, 51, 53, 56, 57, 58, 63, 64, 66, 68, 76, 79, 82, 83, 85, 86, 89, 93, 95, 97, 99, 100, 101, 103, 104, 106, 107, 109, 110, 112], "bin": [1, 2], "point": [1, 2, 3, 5, 8, 9, 12, 13, 15, 17, 19, 31, 32, 33, 40, 42, 44, 62, 64, 65, 68, 71, 79, 85, 86, 87, 89, 93, 95, 96, 102, 104, 107, 108, 109, 112], "cat": [1, 5, 16, 68, 69, 85, 93, 103, 104, 112, 113], "command": [1, 3, 113], "us": [1, 2, 4, 5, 6, 7, 8, 9, 10, 12, 13, 15, 16, 17, 18, 19, 23, 24, 26, 27, 30, 31, 32, 33, 38, 39, 40, 42, 43, 44, 45, 46, 47, 48, 49, 51, 52, 53, 54, 55, 57, 58, 59, 60, 62, 63, 64, 65, 66, 67, 68, 69, 76, 77, 78, 80, 81, 82, 83, 84, 85, 86, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 103, 104, 105, 106, 107, 108, 109, 111, 112, 114], "pkg_config": [1, 2], "necessari": [1, 2, 4, 15, 18, 27, 46, 58, 60, 71, 76, 82, 85, 86, 91, 106, 107, 109], "exist": [1, 2, 5, 12, 109], "stringi_disable_icu_bundl": [1, 2], "stringi_cxxflag": [1, 2], "stringi_cppflag": [1, 2], "stringi_ldflag": [1, 2], "stringi_lib": [1, 2], "If": [1, 2, 3, 4, 6, 12, 18, 27, 30, 31, 32, 37, 39, 40, 42, 43, 44, 46, 48, 49, 51, 52, 53, 54, 58, 60, 64, 66, 67, 71, 76, 80, 82, 83, 84, 85, 86, 89, 90, 93, 96, 101, 104, 106, 107, 108, 109, 111, 113, 114], "do": [1, 2, 5, 12, 33, 37, 39, 55, 62, 63, 70, 85, 93, 109, 113], "manag": [1, 2, 13], "up": [1, 2, 5, 9, 10, 11, 12, 17, 18, 27, 46, 58, 65, 67, 72, 76, 80, 81, 82, 83, 86, 91, 106, 107, 109], "success": 1, "hesit": 1, "bug": [1, 2], "report": [1, 2, 9, 12, 19, 66, 84, 99, 103, 106, 111, 112, 114], "pleas": [1, 5, 9, 10, 17, 24, 44, 63, 100, 114], "archiv": [1, 114], "close": [1, 9, 113], "first": [1, 2, 4, 7, 8, 9, 10, 12, 17, 22, 23, 29, 31, 33, 46, 48, 51, 52, 58, 59, 60, 76, 86, 93, 95, 97, 100, 104, 106, 107, 108, 109, 110, 111, 112, 113], "solut": [1, 109], "your": [1, 4, 5, 6, 9, 38, 39, 62, 86], "problem": [1, 2, 99, 109, 114], "ha": [1, 2, 5, 30, 38, 39, 43, 48, 51, 52, 53, 56, 86, 89, 94, 98, 106, 107, 108, 109, 111, 113], "alreadi": [1, 29, 94, 108, 113], "been": [1, 2, 5, 9, 30, 53, 63, 86, 94, 107, 108, 109, 113], "post": 1, "diagnos": [1, 44], "error": [1, 2, 4, 9, 12, 33, 53, 66, 85, 87, 104, 109, 113], "further": [1, 5, 13, 107, 108, 110, 113], "run": [1, 2, 30, 46, 57, 62, 76, 86, 89, 94], "termin": [1, 12, 27, 63, 66, 113], "submit": 1, "output": [1, 2, 5, 23, 42, 43, 44, 47, 53, 58, 59, 67, 68, 70, 71, 73, 74, 79, 80, 81, 85, 89, 91, 99, 105, 106, 109, 112], "well": [1, 2, 4, 9, 13, 36, 45, 49, 64, 89, 91, 103, 106, 107, 108, 110, 111, 112, 113], "content": [1, 13, 84, 99, 106, 108, 111, 114], "log": [1, 67, 80], "cd": [1, 106, 111], "tmp": 1, "wget": 1, "com": [1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 110, 111, 114], "gagolew": [1, 2, 110, 111], "master": [1, 12, 103, 110, 111, 114], "zip": [1, 2], "unzip": 1, "build": [2, 108], "bugfix": 2, "508": [2, 37, 93, 98], "fix": [2, 3, 10, 11, 12, 18, 27, 43, 46, 49, 58, 62, 66, 76, 82, 86, 91, 109, 113], "jeoren": 2, "kalibera": 2, "string": [2, 3, 4, 5, 6, 8, 9, 11, 12, 14, 16, 18, 19, 20, 21, 22, 23, 25, 26, 27, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 45, 46, 47, 49, 51, 53, 54, 55, 56, 57, 58, 59, 60, 62, 63, 64, 65, 66, 67, 69, 72, 73, 74, 76, 77, 81, 87, 88, 89, 90, 91, 92, 93, 94, 96, 97, 98, 99, 101, 102, 103, 104, 105, 109, 110, 114], "liter": [2, 12, 23, 66, 76, 109, 113], "potenti": [2, 69, 99, 110], "insecur": 2, "warn": [2, 4, 6, 9, 12, 18, 24, 26, 27, 32, 39, 40, 42, 44, 53, 66, 76, 85, 86, 91, 96, 101, 109], "501": [2, 37, 56, 93, 98], "32": [2, 3, 5, 37, 44, 46, 93, 98, 111, 112], "bit": [2, 5, 31, 32, 33, 36, 39, 40, 42, 43, 62, 93], "resolvelocalenam": 2, "502": [2, 37, 93, 98], "pkg_cppflag": 2, "now": [2, 57, 108, 109, 110, 111, 112], "consid": [2, 44, 64, 106, 108, 109, 112, 113], "befor": [2, 9, 12, 26, 30, 45, 64, 92, 104, 108, 110, 111, 113], "same": [2, 5, 6, 9, 13, 17, 29, 33, 38, 39, 50, 53, 54, 55, 57, 62, 64, 72, 81, 82, 91, 93, 99, 102, 103, 107, 108, 109, 113], "type": [2, 5, 8, 9, 19, 44, 53, 59, 63, 74, 82, 83, 89, 90, 95, 105, 106, 107, 108, 109, 111, 112, 113], "make": [2, 5, 8, 86, 90, 95, 99, 107, 108, 109], "what": [2, 5, 8, 9, 11, 12, 17, 39, 43, 58, 60, 107, 110, 113], "happen": [2, 108, 109, 113], "makevar": 2, "doubl": [2, 109], "convers": [2, 11, 13, 24, 30, 44, 74, 85, 97, 111], "loongarch": 2, "restor": [2, 57, 94], "463": [2, 37, 93, 98, 109], "updat": [2, 111], "cldr": 2, "44": [2, 9, 37, 93, 98, 110, 111, 113], "backward": [2, 64, 109], "incompat": 2, "solari": [2, 39], "drop": [2, 4, 110], "longer": [2, 36, 91, 96, 109], "veri": [2, 4, 5, 9, 11, 12, 19, 39, 59, 69, 83, 104, 106, 107, 108, 109, 110, 113], "outdat": 2, "icu55": 2, "A": [2, 3, 5, 9, 12, 13, 23, 26, 35, 36, 40, 43, 46, 47, 48, 63, 64, 65, 66, 71, 79, 80, 84, 90, 93, 95, 106, 107, 109, 111, 112, 113], "least": [2, 4, 12, 27, 30, 31, 68, 71, 87, 109, 112, 113], "469": [2, 37, 93, 98], "miss": [2, 3, 16, 27, 29, 38, 40, 42, 43, 44, 46, 47, 48, 50, 51, 53, 60, 61, 62, 64, 66, 67, 72, 75, 80, 82, 85, 87, 89, 90, 91, 106, 107, 111, 113], "field": [2, 3, 23, 82], "stri_datetime_pars": [2, 23, 24, 109, 112], "stri_datetime_cr": [2, 3, 20, 22, 23, 24, 25, 26, 92, 93, 94, 112], "default": [2, 5, 12, 15, 17, 18, 19, 20, 21, 22, 23, 26, 27, 29, 31, 33, 37, 38, 39, 43, 44, 46, 47, 49, 55, 57, 58, 59, 60, 63, 64, 65, 66, 67, 68, 72, 73, 76, 80, 81, 82, 83, 84, 85, 86, 89, 91, 92, 93, 94, 95, 97, 100, 102, 104, 105, 106, 107, 109, 111, 112, 113], "todai": [2, 23, 113], "midnight": [2, 23], "remov": [2, 3, 5, 9, 17, 30, 37, 43, 67, 76, 80, 82, 84, 97, 98, 99, 100, 102, 107, 108, 110, 111], "long": [2, 4, 23, 92, 93, 110, 112], "deprec": [2, 3, 9, 29, 69, 73, 74, 105], "defunct": 2, "fallback_encod": 2, "paramet": [2, 10, 84, 89, 90, 106, 107, 108], "stri_read_lin": [2, 3, 13, 74, 87, 105, 111], "ellipsi": [2, 36], "stri_opts_col": [2, 3, 6, 7, 8, 10, 13, 15, 17, 18, 19, 27, 29, 31, 46, 47, 58, 59, 67, 72, 76, 80, 81, 82, 83, 86, 91, 95, 102, 104, 108], "stri_opts_regex": [2, 3, 7, 12, 18, 27, 46, 58, 60, 76, 82, 91], "stri_opts_fix": [2, 3, 7, 11, 18, 27, 46, 58, 76, 82, 86, 91, 107], "stri_opts_brkit": [2, 3, 7, 8, 19, 47, 59, 83, 84, 95, 104, 112], "As": [2, 5, 15, 32, 45, 67, 80, 90, 91, 99, 102, 106, 107, 108, 109], "per": [2, 4, 6, 57, 69, 104, 107, 112], "prof": [2, 59, 83], "brian": 2, "riplei": 2, "icudt74l": 2, "littl": [2, 111], "endian": [2, 111], "includ": [2, 3, 6, 7, 8, 9, 12, 13, 18, 26, 27, 46, 58, 60, 62, 76, 82, 86, 88, 89, 91, 103, 107, 109, 110, 113], "tarbal": 2, "compress": 2, "xz": 2, "save": [2, 92, 93], "space": [2, 5, 8, 9, 12, 18, 23, 46, 66, 76, 85, 87, 88, 100, 103, 104, 106, 111, 112, 113], "allow": [2, 5, 9, 10, 12, 17, 18, 21, 27, 32, 46, 58, 60, 66, 85, 89, 104, 106, 108, 113], "stringi": [2, 4, 5, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114], "internet": 2, "476": [2, 37, 56, 93, 98], "break": [2, 8, 19, 47, 59, 63, 83, 95, 104, 112, 114], "iter": [2, 4, 8, 9, 19, 47, 59, 63, 83, 95, 104, 112], "emit": [2, 6, 91], "when": [2, 4, 5, 6, 8, 12, 17, 23, 43, 53, 58, 60, 64, 66, 68, 81, 84, 85, 92, 93, 95, 104, 106, 107, 108, 109, 111, 112, 113], "root": [2, 26], "resourc": [2, 6, 26, 56, 107, 108, 111], "return": [2, 5, 7, 12, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 68, 69, 70, 71, 73, 74, 75, 76, 77, 78, 79, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 112], "explicitli": [2, 6, 44, 89, 108], "request": [2, 5, 6, 24, 56, 108, 111], "pass": [2, 13, 16, 18, 27, 46, 55, 58, 60, 76, 82, 85, 86, 89, 90, 91, 107, 108, 109, 111], "unknown": [2, 5, 6, 30, 33, 38, 113], "null": [2, 6, 17, 18, 19, 20, 21, 22, 23, 26, 27, 29, 31, 32, 33, 39, 41, 42, 44, 46, 47, 51, 52, 55, 57, 58, 59, 60, 63, 64, 67, 72, 73, 76, 80, 81, 82, 83, 85, 86, 91, 92, 94, 95, 98, 102, 104, 105, 106, 108, 109], "stri_enc_get": [2, 5, 38, 39, 41, 43, 44], "amongst": [2, 106, 108, 109, 110, 112, 113], "those": [2, 5, 6, 10, 78, 113], "stri_enc_list": [2, 3, 5, 33, 38, 39, 44, 111], "recommend": [2, 99, 104, 113], "identifi": [2, 3, 9, 19, 20, 21, 22, 23, 24, 26, 31, 33, 37, 47, 55, 56, 59, 92, 94, 95, 97, 98, 104, 107, 108, 109, 112, 113], "en_us_posix": [2, 6, 56], "did": [2, 6], "reset": 2, "calendar": [2, 6, 20, 21, 22, 23, 26, 92, 108, 112], "object": [2, 3, 14, 15, 17, 19, 20, 22, 23, 25, 32, 38, 42, 46, 47, 50, 51, 53, 59, 62, 63, 64, 65, 66, 73, 74, 77, 82, 83, 89, 103, 105, 106, 107, 108, 109, 110, 112], "multipl": [2, 3, 23, 67, 68, 89, 91, 104, 106, 108, 109], "487": [2, 37, 93, 98], "accept": [2, 63], "ascii": [2, 3, 5, 9, 12, 23, 31, 33, 36, 37, 38, 39, 43, 44, 45, 66, 71, 97, 98, 103, 104, 106, 108, 110, 111, 112, 113], "than": [2, 4, 5, 8, 9, 10, 12, 14, 17, 23, 29, 38, 40, 44, 51, 52, 54, 58, 62, 64, 67, 70, 71, 89, 90, 91, 102, 104, 108, 109, 112, 113], "858993457": 2, "charact": [2, 3, 4, 6, 7, 8, 10, 11, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 32, 34, 35, 36, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 52, 53, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 76, 78, 79, 80, 81, 82, 83, 84, 85, 86, 90, 91, 92, 93, 94, 95, 97, 98, 99, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 114], "input": [2, 4, 5, 11, 12, 17, 30, 32, 38, 40, 44, 45, 51, 63, 64, 66, 67, 73, 76, 80, 82, 84, 89, 90, 95, 96, 97, 99, 104, 106, 107, 108, 109, 113], "rchk": 2, "chang": [2, 5, 6, 9, 12, 30, 39, 42, 57, 66, 68, 85, 89, 93, 94, 95, 104, 106, 107, 108, 112], "IF": 2, "72": [2, 37, 59, 93, 98], "word": [2, 3, 8, 9, 12, 19, 47, 59, 63, 66, 69, 76, 83, 88, 91, 95, 106, 108, 109], "detail": [2, 4, 106, 107, 108, 109, 113], "pull": 2, "2256": 2, "document": [2, 4, 8, 9, 13, 26, 63, 64, 66, 93, 94, 99, 113, 114], "paper": [2, 10, 106, 107, 108, 109, 110, 111, 112, 113], "publish": [2, 98, 106, 107, 108, 109, 110, 111, 112, 113], "473": [2, 37, 93, 98], "397": [2, 37, 93, 98], "buffer": 2, "overflow": 2, "stri_dup": [2, 3, 13, 14, 48, 51, 52, 106], "stri_past": [2, 51, 70, 71, 77, 85, 86, 104, 106], "gracious": 2, "attempt": 2, "length": [2, 3, 4, 9, 11, 12, 16, 29, 30, 31, 38, 46, 47, 48, 51, 52, 53, 54, 58, 59, 62, 67, 68, 69, 71, 76, 80, 81, 82, 83, 85, 89, 90, 91, 99, 103, 104, 107, 108, 109, 112, 113], "31": [2, 19, 20, 21, 23, 26, 37, 46, 56, 59, 83, 93, 98, 110], "each": [2, 3, 4, 5, 6, 7, 8, 9, 13, 14, 18, 24, 27, 28, 29, 30, 31, 32, 37, 40, 42, 46, 47, 51, 52, 53, 54, 58, 60, 62, 68, 71, 72, 73, 76, 77, 82, 84, 86, 87, 88, 89, 90, 95, 96, 97, 98, 99, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113], "480": [2, 37, 93, 98], "rf_isnul": 2, "instead": [2, 58, 62, 68, 85, 104, 109], "isnul": 2, "462": [2, 37, 93, 98], "That": 2, "doe": [2, 4, 5, 6, 8, 9, 12, 17, 23, 24, 33, 55, 64, 89, 90, 93, 103, 104, 107, 108, 109, 113], "handl": [2, 5, 6, 8, 13, 30, 38, 50, 53, 62, 77, 89, 97, 101, 108, 109], "neg": [2, 12, 27, 29, 58, 64, 82, 83, 86, 89, 90, 104, 106, 107, 108, 113], "number": [2, 3, 5, 6, 7, 9, 12, 13, 16, 20, 22, 23, 25, 27, 28, 31, 33, 46, 54, 63, 64, 68, 69, 71, 76, 82, 83, 85, 87, 88, 91, 95, 96, 103, 104, 106, 107, 108, 110, 111, 112, 113], "correctli": [2, 5, 39, 108, 111], "mention": [2, 19, 59, 64, 83, 108, 109, 112, 113], "ad": [2, 20, 23, 26, 68, 69, 85, 109], "liuxiang88": 2, "467": [2, 37, 93, 98], "ucrt": [2, 111], "mark": [2, 5, 8, 9, 12, 27, 30, 32, 34, 35, 36, 38, 40, 41, 43, 44, 62, 73, 81, 89, 99, 108, 109, 111, 112, 113], "latin1": [2, 5, 37, 38, 44, 111], "public": [2, 9, 114], "_static": [2, 110, 111], "vignett": [2, 110, 111], "pdf": [2, 114], "draft": [2, 99], "websit": [2, 111], "comprehens": [2, 9, 109, 113], "tutori": [2, 12, 106, 107, 108, 109, 110, 111, 112, 113], "aforement": [2, 106, 109], "site": 2, "move": [2, 64, 108], "457": [2, 37, 93, 98], "autoconf": 2, "macro": 2, "ac_lang_cplusplu": 2, "ac_try_compil": 2, "were": [2, 5, 62, 97, 106, 108, 109, 111, 113], "obsolet": 2, "458": [2, 37, 93, 98], "altrep": 2, "yield": [2, 23, 46, 59, 67, 108, 109, 113], "embed": [2, 44], "nul": [2, 44, 62], "449": [2, 37, 93, 98], "segfault": 2, "stri_sprintf": [2, 3, 16, 50, 53, 62, 68, 103, 112], "No": [2, 9, 69, 95], "defin": [2, 9, 10, 12, 32, 39, 49, 64, 82, 84, 86, 89, 90, 93, 99, 101, 106, 107, 108, 110, 111, 112], "use_rintern": 2, "r_no_remap": 2, "previou": [2, 12, 57, 94, 109], "patch": 2, "caus": [2, 9, 43, 64, 108], "failur": [2, 12, 30, 31], "target": [2, 44], "workaround": [2, 107, 113], "tool": [2, 12, 113], "checkff": 2, "na_character_": [2, 32, 54, 60, 85, 93, 106, 109], "stri": [2, 14, 15, 16, 28], "sprintf": [2, 85, 112], "stri_sub": [2, 3, 13, 58, 59, 90, 106, 107, 109], "stri_sub_al": [2, 3, 58, 59, 89, 107, 109], "provid": [2, 5, 6, 9, 10, 11, 12, 13, 16, 17, 31, 33, 47, 49, 51, 55, 60, 64, 89, 92, 93, 96, 97, 104, 106, 108, 109, 111, 113], "result": [2, 4, 5, 6, 9, 11, 12, 13, 14, 15, 17, 18, 19, 23, 26, 27, 28, 29, 35, 36, 37, 41, 43, 46, 47, 49, 51, 52, 54, 55, 58, 60, 64, 65, 69, 70, 71, 72, 76, 79, 80, 81, 82, 83, 84, 85, 86, 89, 90, 91, 95, 101, 106, 107, 108, 109, 113], "correspond": [2, 4, 9, 15, 17, 27, 32, 34, 36, 42, 51, 53, 60, 72, 76, 84, 85, 89, 90, 93, 96, 106, 107, 108, 109, 111, 113], "being": [2, 5, 12, 23, 55, 64, 89, 104, 107, 108, 109], "alter": [2, 12, 89, 90, 113], "na": [2, 3, 5, 12, 18, 21, 23, 27, 28, 29, 30, 31, 32, 43, 46, 47, 48, 51, 52, 53, 54, 58, 60, 64, 67, 72, 75, 76, 77, 80, 82, 83, 84, 85, 86, 89, 90, 91, 93, 101, 106, 107, 108, 109], "ignore_negative_length": [2, 89, 90], "stri_subset": [2, 3, 7, 27, 107], "replac": [2, 3, 7, 13, 20, 23, 24, 40, 43, 44, 71, 72, 82, 85, 91, 96, 100, 104, 109, 110, 112], "valu": [2, 3, 5, 6, 9, 12, 106, 107, 108, 112, 113], "cannot": [2, 8, 44, 73, 91, 101, 112], "str": [2, 11, 18, 19, 23, 27, 28, 29, 30, 31, 34, 35, 36, 38, 40, 41, 42, 43, 44, 45, 46, 47, 48, 50, 53, 58, 59, 60, 62, 67, 68, 70, 72, 76, 77, 79, 80, 81, 82, 83, 84, 86, 87, 88, 89, 90, 91, 95, 96, 97, 99, 100, 101, 102, 103, 104, 105, 110, 112], "recycl": [2, 4, 15, 18, 27, 46, 58, 60, 71, 76, 82, 86, 90, 91, 106, 107], "matrix": [2, 3, 46, 47, 58, 59, 60, 82, 83, 89, 90, 106, 107, 109, 110, 113], "cbind": [2, 89, 90, 106], "unnam": [2, 89, 90], "column": [2, 22, 54, 58, 60, 67, 89, 90, 103, 106, 107, 108, 109, 110, 113], "name": [2, 4, 5, 9, 12, 17, 18, 19, 20, 21, 22, 23, 26, 27, 29, 30, 31, 33, 37, 39, 44, 46, 47, 55, 57, 58, 59, 60, 63, 64, 65, 66, 67, 72, 73, 74, 76, 80, 81, 82, 83, 86, 87, 88, 89, 90, 91, 92, 93, 95, 97, 98, 102, 105, 106, 107, 108, 110, 111, 113], "interpret": [2, 5, 23, 40, 43, 110, 111, 113], "use_matrix": [2, 89, 90], "special": [2, 5, 9, 24, 45, 63, 66, 113], "treatment": [2, 67, 80], "matric": [2, 58, 59, 60, 89, 90, 107, 109], "clarifi": 2, "syntax": [2, 9, 12, 16, 23, 63, 113], "_charclass": [2, 7, 9, 86], "stri_trim": [2, 3, 7, 13, 76, 112], "differ": [2, 5, 6, 8, 9, 12, 17, 18, 19, 30, 46, 48, 51, 58, 60, 66, 76, 95, 96, 97, 99, 100, 106, 107, 108, 109, 111, 112, 113], "slightli": [2, 12, 86, 88, 107], "class": [2, 7, 8, 13, 20, 21, 22, 23, 25, 26, 64, 69, 71, 93, 94, 100, 112], "420": [2, 37, 93, 98], "alia": [2, 17, 29, 44, 54, 64, 66, 69, 73, 74, 75, 76, 89, 90, 104, 105, 106], "stri_string_format": [2, 85], "awar": [2, 6, 11, 12, 13, 27, 64, 81, 85, 108, 112], "enhanc": [2, 81, 85, 109], "add": [2, 20, 44, 68, 109, 112], "customis": [2, 108], "demand": 2, "comput": [2, 5, 6, 22, 62, 81, 109, 110, 114], "size": [2, 33, 44, 66, 73, 106, 109, 113], "width": [2, 3, 9, 13, 16, 23, 26, 53, 68, 85, 104, 110, 112], "given": [2, 3, 4, 5, 7, 12, 17, 18, 23, 24, 27, 32, 33, 35, 36, 37, 38, 39, 46, 47, 49, 52, 53, 54, 60, 66, 67, 68, 69, 76, 77, 82, 83, 84, 86, 89, 93, 96, 97, 101, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113], "both": [2, 5, 17, 19, 20, 35, 43, 68, 75, 89, 100, 104, 106, 107, 109, 112], "stri_printf": [2, 85], "displai": [2, 5, 8, 9, 23, 69, 106, 108, 111], "153": [2, 37, 93, 98, 109], "stri_match_": [2, 60], "_regex": [2, 7, 12, 58, 60, 76, 113], "captur": [2, 3, 12, 46, 58, 76, 107], "group": [2, 3, 5, 6, 12, 30, 46, 58, 76, 106, 107, 112], "stri_locate_": [2, 7, 58, 59, 106], "have": [2, 5, 6, 8, 9, 12, 29, 31, 33, 39, 44, 54, 63, 68, 85, 103, 104, 106, 107, 108, 109, 110, 111, 112, 113], "capture_group": [2, 58, 113], "posit": [2, 5, 8, 9, 12, 35, 36, 58, 63, 64, 82, 83, 86, 89, 104, 106, 107, 108, 111, 113], "match": [2, 3, 6, 7, 8, 9, 10, 11, 12, 13, 27, 30, 31, 38, 39, 46, 47, 58, 59, 65, 66, 76, 84, 100, 106, 108, 109, 111, 112, 114], "parenthesis": [2, 113], "subexpress": [2, 58], "get_length": [2, 58, 59, 107, 113], "whose": [2, 51, 106, 108, 109, 111, 112, 113], "mai": [2, 4, 5, 6, 7, 8, 9, 11, 12, 17, 19, 20, 21, 22, 23, 24, 26, 30, 33, 35, 38, 39, 40, 42, 43, 44, 53, 54, 55, 56, 57, 58, 62, 63, 66, 68, 70, 71, 76, 77, 79, 82, 83, 85, 86, 87, 88, 89, 95, 98, 99, 100, 104, 106, 107, 108, 109, 110, 111, 112, 113], "ones": [2, 33, 58, 59, 64, 106, 108, 109, 111, 112, 113], "438": [2, 37, 93, 98], "stri_trans_gener": [2, 3, 13, 95, 96, 98, 99, 110, 112], "rule": [2, 4, 19, 47, 59, 63, 64, 84, 90, 93, 97, 99, 106, 107, 108, 109, 112], "revers": [2, 3, 13, 33, 68, 70, 97, 106], "direct": [2, 97], "434": [2, 37, 93, 98], "stri_datetime_format": [2, 3, 13, 20, 21, 22, 24, 25, 26, 92, 93, 94, 112], "vectoris": [2, 106, 107, 110], "respect": [2, 4, 9, 12, 18, 23, 27, 46, 47, 58, 59, 72, 76, 82, 83, 86, 89, 90, 91, 96, 106, 107, 108, 109, 111, 112, 113], "stri_datetime_fstr": [2, 3, 20, 21, 22, 23, 25, 26, 92, 93, 94, 112], "ignore_speci": [2, 24], "stri_datetime_add": [2, 3, 21, 22, 23, 24, 25, 26, 92, 93, 94, 112], "stri_datetime_field": [2, 3, 20, 21, 23, 24, 25, 26, 92, 93, 94], "posixct": [2, 20, 21, 22, 23, 25, 112], "eagerli": [2, 108], "negat": [2, 9, 12, 27, 86, 91, 100, 107, 108, 113], "stri_replace_rstr": [2, 3, 7, 76, 100], "convert": [2, 3, 4, 5, 9, 23, 24, 31, 37, 45, 97, 99, 106, 109, 110, 112], "gsub": [2, 3], "style": [2, 3, 9, 23, 30, 85, 109], "stri_replac": [2, 3, 7, 78, 100, 113], "stri_prepare_arg": 2, "refactor": 2, "overrun": 2, "except": [2, 9, 12, 23, 104, 109, 111, 113], "subsystem": 2, "avoid": [2, 6, 9, 99, 107, 109], "stri_length": [2, 3, 13, 16, 19, 50, 62, 68, 85, 96, 103, 106], "stri_enc_toutf32": [2, 3, 5, 32, 40, 41, 43, 44, 111], "throw": 2, "invalid": [2, 43], "utf": [2, 3, 13, 17, 30, 31, 33, 37, 38, 39, 40, 41, 44, 49, 51, 53, 57, 62, 73, 91, 99, 101, 105, 109, 111], "byte": [2, 3, 5, 7, 12, 13, 16, 30, 31, 32, 33, 34, 35, 36, 38, 40, 41, 42, 43, 44, 53, 66, 81, 89, 101, 111, 113], "sequenc": [2, 3, 5, 11, 12, 23, 30, 32, 34, 36, 40, 42, 43, 44, 45, 53, 58, 66, 84, 97, 99, 104, 106, 107, 108, 111, 112, 113], "mere": [2, 46, 60, 107, 109, 113], "honour": [2, 113], "y": [2, 23, 24, 46, 48, 51, 80, 83, 85, 106, 109, 111, 112, 114], "d": [2, 9, 12, 16, 23, 24, 26, 46, 48, 51, 54, 69, 76, 79, 80, 82, 83, 84, 85, 93, 104, 107, 108, 110, 111, 112, 113, 114], "complet": [2, 108, 109, 113], "rewritten": [2, 109], "stri_wrap": [2, 3, 6, 7, 8, 10, 13, 15, 17, 19, 29, 31, 47, 59, 63, 64, 67, 68, 69, 72, 80, 81, 83, 84, 95, 102, 112], "recognis": [2, 113], "certain": [2, 23, 45, 111, 113], "simplifi": [2, 30, 37, 46, 47, 69, 82, 83, 98, 104, 106, 107, 108, 109], "425": [2, 37, 93, 98], "stri_locale_list": [2, 3, 6, 55, 57, 108], "stri_timezone_list": [2, 3, 20, 21, 22, 23, 24, 25, 26, 92, 94], "stri_trans_list": [2, 3, 95, 96, 97, 99, 112], "428": [2, 37, 93, 98], "stri_flatten": [2, 3, 13, 14, 28, 30, 51, 52, 69, 106], "na_empti": [2, 48, 75], "omit": [2, 48, 63, 84], "431": [2, 37, 56, 93, 98], "9": [2, 9, 12, 19, 26, 27, 30, 37, 46, 51, 58, 59, 68, 70, 71, 76, 81, 83, 85, 89, 90, 91, 93, 98, 104, 107, 108, 109, 110, 111, 112, 113, 114], "gcc": 2, "max_align_t": 2, "std": [2, 85], "possibl": [2, 4, 5, 12, 31, 35, 36, 38, 65, 82, 83, 86, 99, 104, 106, 107, 108, 109, 111, 113], "429": [2, 37, 93, 98], "stri_width": [2, 3, 13, 16, 50, 53, 62, 68, 85, 104, 106, 112], "misclassifi": 2, "grave": 2, "accent": [2, 9, 10, 11, 97, 98, 108], "eszett": [2, 95], "categori": [2, 5, 7, 12, 18, 38, 39, 63, 100, 103, 111, 113], "sk": [2, 9, 56, 98], "symbol": [2, 9, 23, 103, 108, 113], "modifi": [2, 6, 9, 20, 23, 57, 85, 88, 90, 91, 106, 107], "uchar_east_asian_width": [2, 103], "u_ea_ambigu": 2, "354": [2, 37, 93, 98], "charsxp": 2, "copi": [2, 4, 89, 90, 91, 102], "thu": [2, 5, 23, 26, 82, 99, 105, 109], "could": [2, 6, 30], "garbag": 2, "collect": [2, 106, 109], "so": [2, 5, 8, 9, 12, 13, 17, 18, 27, 38, 42, 46, 56, 58, 59, 60, 66, 68, 76, 82, 83, 86, 89, 91, 103, 104, 106, 107, 108, 109, 110, 111, 112, 113], "meanwhil": 2, "jimhest": 2, "401": [2, 37, 56, 93, 98], "icu4c": [2, 9, 13, 26, 57, 63, 64, 66, 93, 94], "69": [2, 37, 46, 93, 98, 110, 111], "upgrad": 2, "o": [2, 5, 11, 12, 18, 23, 26, 48, 51, 56, 76, 80, 83, 94, 96, 105, 107, 113, 114], "x": [2, 4, 5, 12, 16, 20, 23, 24, 37, 48, 51, 52, 54, 58, 61, 66, 72, 75, 77, 78, 80, 85, 89, 90, 91, 97, 101, 106, 107, 108, 109, 110, 111, 112, 113], "nix": 2, "equip": [2, 58, 113], "battl": 2, "test": [2, 6, 9, 15, 17, 19, 27, 29, 30, 39, 59, 77, 83, 86, 102, 111, 113], "55": [2, 12, 26, 37, 46, 76, 85, 93, 98], "bring": 2, "39": [2, 37, 46, 83, 93, 98, 103, 109, 110], "cxx_std": 2, "cxx11": 2, "cxx1x": 2, "408": [2, 37, 93, 98], "stri_trans_casefold": [2, 95], "perform": [2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 15, 17, 19, 29, 47, 56, 57, 59, 62, 63, 64, 66, 67, 74, 80, 83, 85, 95, 97, 106, 107, 108, 109, 110, 111], "two": [2, 3, 5, 6, 9, 12, 15, 17, 23, 53, 58, 72, 84, 85, 89, 90, 93, 95, 96, 99, 106, 107, 108, 109, 111, 112, 113], "piec": [2, 9, 10, 19, 82, 83, 95, 112], "onli": [2, 4, 5, 9, 12, 23, 30, 31, 33, 38, 39, 46, 48, 51, 52, 58, 59, 60, 63, 66, 68, 76, 81, 82, 83, 84, 85, 89, 90, 91, 93, 95, 100, 104, 106, 107, 108, 109, 111, 113], "ident": [2, 93, 95, 106, 107, 108, 111], "handi": [2, 95, 106], "compar": [2, 3, 5, 6, 12, 13, 29, 60, 62, 76, 85, 95, 108, 109, 111, 112, 113, 114], "421": [2, 37, 56, 93, 98], "stri_rank": [2, 3, 6, 8, 10, 13, 15, 17, 19, 29, 31, 47, 59, 64, 67, 80, 81, 83, 95, 102, 104, 108], "vector": [2, 3, 5, 7, 13, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 27, 28, 29, 30, 31, 32, 34, 35, 36, 37, 38, 40, 41, 42, 43, 44, 45, 46, 47, 48, 50, 52, 53, 54, 56, 58, 59, 60, 61, 62, 67, 68, 69, 70, 71, 72, 73, 74, 76, 78, 79, 80, 81, 82, 83, 84, 85, 86, 90, 91, 93, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 107, 108, 109, 110, 111, 112], "order": [2, 3, 5, 6, 9, 12, 13, 17, 27, 30, 31, 43, 44, 64, 70, 72, 73, 79, 80, 81, 89, 99, 106, 107, 109, 110, 111, 113], "frame": [2, 22, 30, 31, 67, 72, 93, 108, 110], "regard": [2, 29, 67, 108, 109, 113], "criteria": [2, 67, 72, 106, 108], "219": [2, 37, 93, 98], "266": [2, 37, 56, 93, 98], "stri_sort_kei": [2, 3, 6, 8, 10, 15, 17, 19, 29, 31, 47, 59, 64, 67, 72, 80, 83, 95, 102, 104], "415": [2, 37, 93, 98], "equival": [2, 5, 9, 10, 12, 15, 16, 17, 19, 29, 38, 42, 48, 51, 59, 64, 65, 66, 76, 77, 81, 84, 91, 99, 102, 103, 107, 109, 110, 111, 112, 113], "414": [2, 37, 93, 98], "level": [2, 64, 106, 108], "sxpinfo": 2, "gp": 2, "directli": [2, 58, 81, 86, 113], "lukaszdaniel": 2, "home": [2, 13], "page": [2, 4, 5, 7, 13, 24, 45, 110, 111], "refer": [2, 18, 24, 27, 46, 58, 60, 76, 82, 86, 91, 107, 108, 109, 111], "400": [2, 37, 93, 98], "399": [2, 37, 93, 98], "purpos": [2, 5, 8, 84, 95, 107, 108, 112, 113], "355": [2, 37, 93, 98], "time_limit": [2, 66, 113], "stack_limit": [2, 66, 113], "prevent": [2, 63], "malform": [2, 9, 55], "malici": 2, "too": [2, 4, 58, 85, 108, 113], "345": [2, 37, 93, 98, 109], "stri_startswith": [2, 7, 27, 86, 107], "stri_endswith": [2, 27, 86, 107], "382": [2, 37, 93, 98], "incorrect": [2, 43, 44, 53, 67, 72, 80], "eas": 2, "debug": 2, "347": [2, 37, 93, 98], "futur": [2, 23, 85, 87, 88, 109, 111], "stri_dupl": [2, 3, 6, 8, 10, 13, 15, 17, 19, 31, 47, 59, 64, 67, 72, 80, 81, 83, 95, 102, 104, 108], "fromlast": [2, 29], "renam": 2, "from_last": [2, 29, 108], "its": [2, 4, 5, 6, 9, 12, 13, 15, 17, 29, 37, 85, 89, 90, 102, 106, 108, 109, 110, 112, 113], "schedul": 2, "stri_enc_detect2": [2, 3, 5, 6, 8, 10, 15, 17, 19, 29, 30, 34, 35, 36, 47, 59, 64, 67, 72, 80, 81, 83, 95, 102, 104], "stri_enc_detect": [2, 3, 5, 31, 34, 35, 36, 74, 111], "stri_enc_isutf8": [2, 3, 5, 30, 31, 34, 35, 111], "stri_enc_isascii": [2, 3, 5, 30, 31, 35, 36, 111], "stri_write_lin": [2, 3, 13, 73, 74, 111, 112], "stri_read_raw": [2, 3, 13, 73, 105, 111], "con": [2, 73, 74, 105, 106], "fname": [2, 73, 74, 105], "auto": 2, "anymor": 2, "nparagraph": [2, 69], "stri_rand_lipsum": [2, 3, 13, 70, 71, 112], "n_paragraph": [2, 69], "398": [2, 37, 93, 98], "altern": [2, 4, 9, 12, 58, 81, 85, 89, 90, 110, 111], "british": [2, 92, 93], "spell": [2, 108], "introduc": [2, 99, 108, 109, 113], "normal": [2, 3, 5, 9, 13, 17, 37, 53, 62, 64, 69, 70, 71, 79, 85, 89, 97, 100, 102, 103, 104], "393": [2, 37, 93, 98], "stri_read_bin": 2, "187": [2, 26, 37, 93, 98], "connect": [2, 9, 54, 73, 74, 85, 105, 111, 112], "386": [2, 37, 56, 93, 98], "kei": [2, 3, 5, 64, 108, 113], "origin": [2, 81, 88], "davisvaughan": 2, "138": [2, 37, 93, 98, 109], "stri_encod": [2, 3, 5, 30, 32, 40, 41, 42, 43, 73, 74, 111], "stri_rand_str": [2, 3, 9, 13, 69, 70, 109, 112], "much": [2, 10, 17, 29, 73, 97, 102, 109, 111, 113], "larger": [2, 5, 107], "indent": [2, 104, 112], "use_width": 2, "369": [2, 37, 93, 98], "stri_c": [2, 51, 106], "empti": [2, 3, 4, 6, 9, 12, 16, 18, 27, 31, 46, 47, 48, 50, 51, 82, 83, 84, 86, 89, 91, 106, 109], "collaps": [2, 4, 30, 48, 51, 52, 69, 70, 106, 109], "370": [2, 37, 93, 98], "stri_prepare_arg_posixct": 2, "372": [2, 37, 93, 98], "usag": [2, 9], "366": [2, 37, 56, 93, 98], "363": [2, 37, 93, 98], "348": [2, 37, 93, 98], "nil": 2, "362": [2, 37, 93, 98], "cxxcpp": 2, "318": [2, 37, 93, 98], "protect": 2, "gcing": 2, "344": [2, 37, 93, 98], "364": [2, 37, 93, 98], "icu61": 2, "common": [2, 40, 92, 109], "cstring": 2, "h": [2, 12, 17, 22, 23, 24, 48, 51, 63, 80, 82, 83, 107, 108, 109, 112, 113, 114], "statu": [2, 19, 47, 59], "regexmatch": 2, "after": [2, 12, 30, 64, 108, 111, 113], "friendli": [2, 5, 33, 39, 89, 90, 107, 109], "stri_sub_replace_al": [2, 90, 106], "stri_sub_replac": [2, 89, 106], "stri_remove_empti": [2, 3, 54, 61, 77], "stri_omit_empty_na": [2, 75], "stri_remove_empty_na": [2, 75], "stri_omit_empti": [2, 75], "stri_remove_na": [2, 75], "stri_omit_na": [2, 75, 106, 109], "343": [2, 37, 93, 98, 109], "stri_trans_char": [2, 3, 13, 95, 97, 98, 99, 112], "warnfix": 2, "205": [2, 26, 37, 93, 98], "ac": [2, 69, 103], "335": [2, 37, 93, 98], "314": [2, 37, 93, 98], "design": [2, 5, 23, 97, 111], "had": [2, 5, 108, 113], "u_charset_is_utf8": [2, 39, 49], "stri_enc_set": [2, 3, 5, 33, 37, 38], "state": [2, 9, 20, 68, 92, 104, 106, 108, 109, 113], "232": [2, 26, 37, 93, 98], "stri_detect_": [2, 7], "max_count": [2, 27, 107, 110], "stop": [2, 27, 66, 107, 113], "occurr": [2, 3, 7, 31, 44, 108, 109, 113], "338": [2, 37, 93, 98], "easili": [2, 42, 105, 110, 112], "pipabl": 2, "yutannihil": 2, "bastienfr": 2, "334": [2, 37, 93, 98], "icudt61b": 2, "dat": 2, "big": [2, 71], "dimitri": 2, "john": [2, 106, 109], "ledkov": 2, "xnox": 2, "296": [2, 37, 56, 93, 98, 109], "box": [2, 111], "stage": 2, "341": [2, 37, 56, 93, 98], "strncpy": 2, "within": [2, 4, 6, 8, 12, 18, 23, 27, 30, 46, 58, 60, 66, 89, 90, 91, 104, 108, 112, 113], "325": [2, 37, 93, 98], "made": 2, "work": [2, 5, 30, 31, 41, 57, 65, 85, 89, 99, 107, 111, 112], "dash": [2, 9], "319": [2, 37, 93, 98], "stri_rand_shuffl": [2, 3, 13, 69, 71, 79, 106], "337": [2, 37, 93, 98], "stri_split_regex": [2, 82], "rais": [2, 33], "317": [2, 37, 93, 98], "icudt61l": 2, "solv": 2, "frequent": [2, 30, 108], "icudt": [2, 108], "releas": [2, 87, 88, 109, 111], "oldrel": 2, "revert": 2, "winbuild": 2, "chain": [2, 69, 97, 109, 112], "behaviour": [2, 107, 108, 109, 113], "broken": 2, "mirror": 2, "193": [2, 26, 37, 93, 98], "288": [2, 37, 93, 98], "stri_match": [2, 3, 7, 12, 46], "188": [2, 37, 93, 98], "289": [2, 37, 93, 98], "how": [2, 4, 5, 6, 7, 9, 10, 13, 17, 55, 67, 72, 80, 81, 93, 106, 108, 109, 111, 112, 113], "omit_empti": [2, 48, 82, 84, 107], "stri_na2empti": [2, 3, 54, 75, 77], "285": [2, 37, 93, 98], "coercion": [2, 85], "trivial": [2, 109], "atom": [2, 4, 12, 16, 51, 54, 109, 110, 113], "wparenthes": 2, "38": [2, 37, 88, 93, 98, 110, 114], "63": [2, 37, 46, 93, 98], "i18n": [2, 13, 31], "windtfmt": 2, "cpp": [2, 31], "signific": [2, 6, 23, 108, 110], "winnmfmt": 2, "suppress": 2, "import": [2, 4, 109], "diagnost": 2, "src": [2, 103], "decnumb": 2, "specif": [2, 6, 8, 9, 10, 11, 13, 17, 20, 23, 31, 56, 86, 93, 99, 106, 113], "270": [2, 37, 93, 98], "1252": [2, 5, 30, 37], "codec": 2, "euro": [2, 6, 37], "sign": [2, 5, 9, 20, 25, 85, 110, 113], "263": [2, 37, 93, 98, 109], "267": [2, 37, 93, 98], "omit_na": [2, 89, 90, 91, 107], "ignor": [2, 5, 6, 9, 10, 11, 12, 17, 19, 23, 25, 30, 44, 47, 51, 52, 59, 64, 71, 82, 89, 90, 91, 93, 96, 99, 113], "unprotect": 2, "stack": [2, 66, 113], "imbal": 2, "52": [2, 23, 26, 37, 93, 98, 109, 110], "clang": 2, "ubsan": 2, "stri_brkit": 2, "238": [2, 37, 93, 98], "220": [2, 26, 37, 93, 98], "try": [2, 31, 113], "258": [2, 37, 93, 98, 109], "254": [2, 37, 93, 98], "dir": 2, "stri_install_check": 2, "stri_install_icudt": 2, "export": 2, "227": [2, 37, 93, 98], "231": [2, 37, 56, 93, 98], "linux": [2, 5, 108, 109, 111], "unix": [2, 5, 9, 66, 85, 108, 113], "read": [2, 3, 5, 13, 38, 41, 109, 112], "stringi_cflag": 2, "stringi_disable_cxx11": 2, "253": [2, 37, 93, 98], "r_usedynamicsymbol": 2, "230": [2, 37, 93, 98], "242": [2, 37, 93, 98], "_count": 2, "_limit": 2, "enum": [2, 66], "constant": [2, 12, 66], "58": [2, 23, 26, 37, 83, 93, 98], "accordingli": [2, 60], "round": [2, 60, 76, 113], "snprintf": [2, 85], "98": [2, 37, 93, 98, 109], "214": [2, 26, 37, 93, 98], "210": [2, 37, 93, 98], "stri_replace_all_fix": [2, 76, 107, 110], "199": [2, 26, 37, 93, 98], "locat": [2, 3, 7, 8, 10, 11, 19, 23, 44, 47, 83, 108, 110, 112], "207": [2, 37, 93, 98], "insert": [2, 106], "via": [2, 11, 12, 30, 38, 51, 65, 85, 106, 107, 108, 111, 113], "124": [2, 26, 37, 93, 98], "216": [2, 37, 56, 93, 98], "stri_detect": [2, 3, 7, 86, 91, 107, 109], "175": [2, 26, 37, 93, 98], "stri_join_list": [2, 3, 14, 28, 48, 51, 106], "conjunct": [2, 107], "stri_extract_all_regex": [2, 46, 52, 60, 109, 113], "stri_extract_all_word": [2, 8, 12, 19, 47, 52, 59, 112], "88": [2, 26, 37, 85, 93, 98, 109], "rcpp": 2, "examplercppstringi": 2, "exampl": [2, 5, 6, 8, 9, 11, 12, 106, 107, 108, 109, 111, 112, 113], "183": [2, 37, 93, 98, 109], "float": [2, 85], "180": [2, 37, 93, 98], "incorrectli": 2, "element": [2, 3, 4, 6, 13, 15, 17, 18, 27, 30, 31, 34, 36, 37, 42, 46, 47, 48, 50, 51, 53, 54, 58, 60, 67, 71, 76, 80, 82, 84, 86, 87, 88, 90, 105, 106, 107, 108, 109, 110], "suppos": 2, "176": [2, 37, 56, 93, 98, 109], "sy": [2, 5, 38, 39, 85, 109, 111], "feature_test": 2, "copyright": [2, 13], "sun": [2, 26], "microsystem": 2, "applic": [2, 5, 89, 90, 109, 111], "2001": [2, 37], "posix": [2, 65, 85, 109], "forc": [2, 64, 85, 108], "condition": 2, "_xpg6": 2, "conform": [2, 12, 73, 108, 113], "174": [2, 37, 93, 98], "violat": [2, 4], "sep": [2, 14, 16, 23, 48, 51, 52, 68, 69, 77, 85, 104, 105, 106, 109, 110, 112], "170": [2, 37, 93, 98], "setdatadirectori": 2, "169": [2, 26, 37, 93, 98], "tri": [2, 5, 8, 12, 31, 37, 39, 113], "switch": [2, 5, 107], "win": 2, "biarch": 2, "mimic": 2, "ac_subst": 2, "ac_config_fil": 2, "process": [2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 107, 108, 109, 110, 111, 113, 114], "similar": [2, 5, 6, 9, 12, 16, 43, 54, 55, 93, 108, 110, 111, 112, 113], "stri_info": [2, 3, 39], "give": [2, 5, 11, 12, 13, 23, 29, 37, 38, 49, 57, 58, 59, 60, 67, 68, 70, 71, 77, 79, 81, 82, 83, 86, 87, 88, 89, 90, 96, 104, 106, 107, 110, 111, 112, 113], "second": [2, 17, 20, 21, 22, 23, 25, 58, 60, 89, 90, 93, 106, 107, 108, 110, 113], "stri_pad_": [2, 68], "stri_extract_": [2, 7, 46, 47], "_boundari": [2, 7, 59], "between": [2, 3, 5, 9, 10, 12, 17, 24, 48, 64, 82, 100, 104, 106, 108, 113], "boundari": [2, 3, 7, 8, 12, 13, 63, 66, 82, 95, 104], "46": [2, 26, 37, 56, 93, 98, 110], "flavour": [2, 108, 112, 113], "chartr": 2, "approxim": [2, 13, 103, 106], "ish": [2, 107, 112], "fashion": [2, 17], "nchar": [2, 103, 110], "149": [2, 37, 93, 98, 109], "stri_pad": [2, 3, 13, 104, 112], "get": [2, 3, 4, 5, 6, 33, 45, 51, 52, 53, 55, 64, 75, 87, 94, 97, 100, 104, 107, 109], "rid": [2, 75], "133": [2, 26, 37, 93, 98], "silent": [2, 4, 5, 17, 43, 51, 52, 89, 111], "strwrap": [2, 104, 112], "139": [2, 26, 37, 93, 98], "gain": [2, 109], "whitespace_onli": [2, 104], "137": [2, 37, 93, 98], "known": [2, 3, 5, 31, 45, 56, 66, 101, 111, 113], "zone": [2, 3, 13, 20, 21, 22, 23, 94], "stri_timezone_set": [2, 3], "stri_timezone_get": [2, 20, 21, 22, 23, 24, 25, 26, 92, 93, 94], "current": [2, 3, 6, 9, 12, 21, 22, 23, 39, 41, 44, 49, 57, 62, 69, 73, 85, 92, 94, 97, 105, 108, 109, 111, 112, 113], "stri_timezone_info": [2, 3, 20, 21, 22, 23, 24, 25, 26, 93, 94], "basic": [2, 5, 8, 23, 33, 54, 55, 92], "stri_datetime_symbol": [2, 3, 20, 21, 22, 23, 24, 25, 92, 93, 94], "localiz": [2, 3], "strptime": [2, 23, 24, 112], "construct": [2, 21, 106, 113], "represent": [2, 5, 21, 33, 81, 92, 94, 108, 111, 114], "stri_datetime_now": [2, 3, 20, 21, 22, 23, 24, 26, 92, 93, 94, 112], "unit": [2, 5, 8, 9, 20, 92, 95, 108, 109, 110, 112], "144": [2, 37, 93, 98], "improv": 2, "affect": [2, 82, 83, 97], "stri_loc": [2, 3, 7, 59, 107], "index": [2, 29, 58, 59, 86, 89, 90, 107, 108, 110], "143": [2, 37, 93, 98], "stri_": [2, 4, 7, 9, 10, 12, 65, 86, 109], "_fix": [2, 7, 65, 86, 108, 113], "libc": [2, 81], "implement": [2, 6, 10, 11, 12, 44, 69, 73, 86, 88, 95, 107, 108, 109, 113], "strchr": 2, "strstr": 2, "fast": [2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 107, 108, 112, 114], "glibc": [2, 85], "sse2": 2, "instruct": 2, "141": [2, 37, 56, 93, 98], "165": [2, 37, 93, 98], "specifi": [2, 5, 6, 9, 12, 20, 21, 22, 23, 24, 37, 44, 63, 71, 76, 85, 97, 99, 100, 104, 109, 111, 112, 114], "intellig": 2, "gregorian": [2, 20, 21, 22, 23, 26, 92], "expand": [2, 109], "default_local": 2, "134": [2, 37, 93, 98], "132": [2, 37, 93, 98], "stri_locate_regex": 2, "73": [2, 26, 37, 46, 93, 98], "strsxp": 2, "fals": [2, 5, 15, 17, 21, 23, 24, 27, 29, 30, 34, 35, 36, 37, 43, 44, 46, 47, 48, 49, 50, 51, 54, 58, 59, 60, 63, 64, 65, 66, 67, 68, 69, 75, 76, 79, 80, 82, 83, 84, 85, 86, 89, 90, 91, 93, 95, 97, 100, 104, 107, 108, 109, 110, 111, 113], "164": [2, 37, 93, 98], "shall": [2, 106, 107], "168": [2, 37, 93, 98], "135": [2, 37, 93, 98, 113], "becaus": [2, 6, 11, 14, 30, 31, 36, 44, 65, 73, 99, 107, 108, 109, 113], "part": [2, 9, 38, 39, 76, 89, 90, 107, 113], "154": [2, 26, 37, 93, 98], "attribut": [2, 37, 58, 64, 102, 106, 109, 113], "coerc": [2, 37, 48, 54, 67, 80, 106], "u_init": 2, "dynlib": 2, "load": [2, 5, 30, 87, 88, 110], "157": [2, 26, 37, 93, 98, 109], "overful": 2, "hbox": 2, "n_max": 2, "stri_split_": [2, 7], "n": [2, 9, 11, 12, 16, 18, 23, 26, 30, 45, 48, 51, 67, 68, 69, 71, 76, 80, 81, 82, 83, 85, 87, 93, 97, 100, 101, 104, 105, 106, 107, 110, 111, 112, 113], "stri_extract_all_": [2, 46, 47], "stri_list2matrix": [2, 3, 46, 47, 61, 75, 77, 82, 83, 106], "fill": [2, 46, 47, 54, 82, 83, 106, 110], "120": [2, 37, 93, 98], "stri_extract_word": 2, "stri_locate_boundari": [2, 3], "stri_locate_all_boundari": [2, 6, 7, 8, 10, 15, 17, 19, 29, 31, 47, 58, 59, 63, 64, 67, 72, 80, 81, 83, 84, 89, 90, 95, 102, 104], "stri_locate_word": 2, "stri_locate_all_word": [2, 19, 59], "stri_locate_first_boundari": [2, 59], "stri_locate_last_boundari": [2, 59], "stri_locate_first_word": [2, 59], "stri_locate_last_word": [2, 59], "stri_extract_first_word": [2, 47], "stri_extract_last_word": [2, 47], "111": [2, 37, 56, 93, 98, 111], "opts_regex": [2, 18, 27, 46, 58, 60, 66, 76, 82, 91], "opts_col": [2, 17, 18, 27, 29, 46, 58, 64, 67, 72, 76, 80, 81, 82, 86, 91, 102], "opts_fix": [2, 18, 27, 46, 58, 65, 76, 82, 86, 91], "opts_brkit": [2, 19, 47, 59, 83, 95], "suppli": [2, 12, 30, 31, 76, 109], "individu": [2, 6, 13, 42, 46, 82, 109, 111, 112], "simpli": [2, 106], "stri_detect_regex": [2, 27, 66, 86, 113], "case_insensit": [2, 27, 46, 58, 65, 66, 76, 107, 110, 113], "110": [2, 37, 93, 98], "engin": [2, 3, 7, 9, 11, 12, 13, 18, 27, 30, 46, 58, 76, 82, 86, 91, 113], "suitabl": [2, 104, 107, 108, 109], "yet": [2, 99, 108, 111, 113], "again": [2, 9, 106, 107, 109], "stri_extract_all_fix": [2, 46, 65, 107], "stri_count": [2, 3, 7, 19, 107], "stri_locate_all_fix": [2, 58, 65, 107, 109], "look": [2, 12, 14, 15, 17, 30, 58, 82, 86, 109], "129": [2, 37, 93, 98], "cg_miss": [2, 60], "117": [2, 37, 93, 98, 109], "stri_locate_all_": [2, 58, 59], "stri_match_all_": [2, 60], "omit_no_match": [2, 46, 47, 52, 58, 59, 60, 90, 107, 109], "118": [2, 26, 37, 93, 98], "exdent": [2, 104, 112], "initi": [2, 5, 6, 9, 31, 104, 108, 109], "prefix": [2, 104, 109, 111, 112], "knuth": [2, 11, 104, 114], "dynam": [2, 104, 106, 112, 114], "algorithm": [2, 9, 10, 11, 13, 67, 80, 81, 88, 99, 104, 107, 108, 112, 113], "assum": [2, 4, 5, 38, 39, 40, 43, 44, 99, 107, 109, 110, 111], "cost": [2, 104], "print": [2, 5, 8, 9, 20, 53, 68, 85, 90, 91, 103, 104, 106, 107, 112, 113], "last": [2, 7, 12, 29, 46, 58, 59, 60, 76, 84, 86, 89, 96, 100, 104, 106, 107, 108, 109, 110], "line": [2, 3, 8, 9, 12, 13, 19, 30, 59, 63, 66, 68, 74, 83, 87, 88, 93, 104, 111, 112, 113, 114], "128": [2, 37, 93, 98], "122": [2, 37, 93, 98, 111], "n_min": [2, 54, 82, 83, 106], "126": [2, 37, 56, 93, 98], "stri_split": [2, 3, 7, 54, 83, 84, 107], "abl": [2, 7], "act": [2, 14, 35, 63, 68, 93, 104, 107], "just": [2, 5, 6, 8, 12, 19, 29, 31, 41, 47, 58, 59, 69, 76, 90, 102, 108, 109, 110, 112, 113], "str_split_fix": 2, "119": [2, 37, 93, 98], "stri_split_boundari": [2, 3, 6, 7, 8, 10, 15, 17, 19, 29, 31, 47, 59, 63, 64, 67, 72, 80, 81, 82, 84, 95, 102, 104, 112], "tokens_onli": [2, 82, 83], "addition": [2, 5, 13, 17, 37, 38, 60], "116": [2, 37, 56, 93, 98], "ignore_nul": [2, 51], "past": [2, 48, 51, 77, 106, 109], "123": [2, 14, 18, 27, 37, 47, 50, 51, 52, 53, 62, 76, 79, 83, 91, 93, 95, 96, 98], "usedynlib": 2, "speed": [2, 5, 66, 107, 109, 113], "114": [2, 37, 93, 98, 110, 111, 114], "94": [2, 26, 37, 85, 93, 98, 109], "du_disable_renam": 2, "memori": [2, 5, 62, 74], "alloc": 2, "unicodestr": 2, "asan": 2, "saniti": [2, 85], "87": [2, 37, 46, 93, 98, 109, 110], "pipe": [2, 89, 90, 107, 109], "magrittr": [2, 109], "108": [2, 37, 93, 98, 110], "breakiter": [2, 3, 8, 19, 47, 59, 83, 95, 104], "analysi": [2, 7, 8, 12, 13, 19, 47, 59, 63, 83, 104, 112], "control": [2, 8, 9, 12, 64, 66, 67, 80, 86, 101, 103, 106, 108, 113], "aim": [2, 9, 19, 44, 73, 91, 106, 107, 109, 112], "stri_trans_totitl": [2, 8, 95, 112], "109": [2, 26, 37, 93, 98, 109], "stri_count_boundari": [2, 3, 6, 7, 8, 10, 13, 15, 17, 18, 29, 31, 47, 53, 59, 63, 64, 67, 72, 80, 81, 83, 84, 95, 102, 104, 112], "stri_count_word": [2, 19, 47, 59, 112], "count": [2, 3, 7, 8, 13, 23, 86, 88, 89, 106, 109, 112], "41": [2, 37, 46, 56, 59, 93, 98, 109, 110, 111], "stri_startswith_": [2, 7], "stri_endswith_": [2, 7], "determin": [2, 3, 5, 9, 13, 17, 19, 27, 30, 40, 82, 84, 94, 99, 104, 106, 107, 108, 113], "whether": [2, 6, 17, 23, 27, 29, 31, 34, 35, 36, 38, 44, 46, 49, 50, 58, 64, 66, 82, 84, 86, 89, 90, 91, 92, 99, 102, 107, 108, 113], "start": [2, 3, 7, 8, 9, 27, 46, 58, 59, 66, 68, 69, 76, 89, 90, 100, 104, 106, 107, 112, 113], "end": [2, 3, 7, 8, 9, 12, 13, 27, 32, 46, 57, 58, 59, 62, 63, 66, 67, 76, 80, 84, 88, 89, 90, 93, 94, 100, 104, 106, 107, 108, 112], "102": [2, 37, 93, 98], "stri_replace_all_": [2, 76], "vectorize_al": [2, 76], "91": [2, 26, 37, 56, 93, 98], "stri_subset_": [2, 7, 91], "effici": [2, 4, 10, 12, 43, 107, 109, 111], "substitut": [2, 5, 40, 44, 73, 82, 89, 90, 104, 105, 107, 112], "100": [2, 12, 26, 37, 64, 67, 72, 80, 93, 98, 108, 109], "stri_split_fix": [2, 55, 82, 106, 107, 109], "stri_split_charclass": [2, 82], "stri_split_col": [2, 82], "105": [2, 37, 93, 98, 109], "stri_extract": [2, 3, 7, 58, 60, 107, 113], "107": [2, 37, 93, 98], "106": [2, 26, 37, 56, 93, 98], "byrow": [2, 46, 47, 54, 82, 83, 106, 109], "77": [2, 37, 46, 59, 83, 93, 98, 103, 112], "pseudo": [2, 13, 69, 70, 71], "dummi": [2, 69], "lorem": [2, 3, 18, 52, 76, 82, 87, 88, 104, 112], "ipsum": [2, 3, 18, 52, 76, 82, 87, 88, 104, 112], "indic": [2, 4, 7, 15, 17, 29, 31, 34, 36, 44, 46, 47, 49, 58, 59, 60, 83, 89, 90, 102, 106, 107, 108], "should": [2, 5, 6, 21, 23, 29, 30, 38, 39, 44, 48, 49, 54, 58, 63, 65, 67, 68, 69, 75, 76, 80, 82, 84, 85, 89, 90, 91, 104, 107, 108, 110, 113], "86": [2, 37, 56, 93, 98, 110], "_coll": [2, 7, 10, 86, 108], "99": [2, 23, 37, 93, 98, 109], "stri_replace_al": [2, 7, 76, 78, 100, 107], "112": [2, 26, 37, 93, 98], "led": 2, "spontan": 2, "servic": [2, 5, 6, 10, 56, 64, 93, 97, 109, 111, 112], "leak": 2, "detect": [2, 3, 7, 13, 35, 38, 39, 42, 53, 60, 65, 74, 87, 108, 112], "valgrind": 2, "memcheck": 2, "full": [2, 23, 65, 82, 83, 95, 97, 103, 112, 113], "extens": 2, "clean": 2, "though": [2, 12, 85, 89, 90, 108, 111, 113], "misalign": 2, "address": [2, 113], "stri_cmp": [2, 13, 17, 64], "stri_cmp_eq": [2, 17, 95, 107], "stri_cmp_neq": [2, 17, 107], "independ": [2, 7, 13, 15, 17, 34, 35, 36, 76, 95, 97, 107, 108], "comparison": [2, 5, 6, 15, 17, 64, 67, 80, 108, 109], "stri_cmp_equiv": [2, 15, 17, 108], "stri_cmp_nequiv": [2, 17, 108], "canon": [2, 10, 15, 17, 29, 33, 37, 99, 102, 108, 111, 113], "exact": [2, 12, 107], "wise": [2, 7, 13], "cours": [2, 4, 30, 31, 86], "routin": [2, 5, 113], "reason": [2, 4, 5, 43, 44, 109], "behind": [2, 12], "usearch": 2, "poor": 2, "task": [2, 7, 12, 13, 97, 98, 107, 109, 112], "suffici": 2, "anywai": 2, "morri": [2, 11, 114], "pratt": [2, 11, 114], "drastic": 2, "stri_enc_nf": 2, "stri_enc_isnf": 2, "famili": [2, 37, 63, 107, 111], "stri_trans_nf": [2, 3], "stri_trans_isnf": [2, 99], "deal": [2, 4, 5, 42, 53, 106, 109, 112, 113], "transform": [2, 3, 13, 96, 99, 110], "split": [2, 3, 7, 12, 13, 73, 74, 104, 111, 112], "stri_pad_left": [2, 68], "stri_pad_right": [2, 68], "stri_pad_both": [2, 16, 50, 53, 62, 68, 85, 103], "paragraph": [2, 3, 8, 9, 69, 84, 112, 114], "greedi": [2, 104, 112, 113], "minim": [2, 33, 54, 68, 104, 109], "ragged": [2, 104, 112], "sole": [2, 5], "unicodeset": [2, 97], "previous": [2, 39, 57, 94], "charclass": [2, 9, 18, 27, 46, 58, 71, 76, 82, 86, 87, 91, 100, 103, 112], "becam": 2, "familiar": 2, "observ": [2, 5, 6, 43, 71, 72, 93, 107, 108], "nice": 2, "none": [2, 87, 104], "preserv": [2, 100, 104, 109], "stri_uniqu": [2, 3, 6, 8, 10, 13, 15, 17, 19, 29, 31, 47, 59, 64, 67, 72, 80, 81, 83, 95, 104, 108], "uniqu": [2, 3, 6, 8, 29, 37, 96, 108, 113], "stri_duplicated_ani": [2, 29, 108], "duplic": [2, 3, 37, 102, 108], "stri_replace_na": [2, 3, 54, 61, 75, 109], "emul": 2, "permut": [2, 3, 70, 79, 108], "stri_cmp_lt": [2, 17, 108], "stri_cmp_l": [2, 15, 17, 108], "stri_cmp_gt": [2, 17], "stri_cmp_g": [2, 17], "stri_enc_mark": [2, 3, 5, 33, 37, 39, 40, 41, 43, 44, 111], "declar": [2, 3, 5, 39, 40, 41, 43, 44], "seen": [2, 38, 113], "stri_enc_ton": [2, 3, 5, 32, 40, 42, 43, 44], "stri_ord": [2, 3, 6, 8, 10, 13, 15, 17, 19, 29, 31, 47, 59, 64, 72, 80, 81, 83, 95, 102, 104, 108], "na_last": [2, 67, 80], "stri_replace_all_charclass": [2, 76], "stri_extract_all_charclass": [2, 46], "stri_locate_all_charclass": [2, 58], "merg": [2, 30, 46, 58, 76], "white": [2, 9, 12, 13, 18, 46, 66, 76, 87, 88, 100, 104, 113], "singl": [2, 5, 8, 9, 16, 19, 20, 21, 22, 23, 26, 27, 29, 30, 31, 32, 33, 37, 39, 40, 43, 44, 46, 47, 48, 49, 51, 52, 54, 55, 57, 58, 59, 60, 63, 64, 65, 67, 68, 69, 71, 73, 76, 77, 80, 81, 82, 83, 84, 85, 86, 89, 90, 91, 92, 93, 94, 95, 96, 97, 100, 104, 106, 107, 108, 109, 110, 113], "stri_enc_toutf8": [2, 3, 5, 32, 40, 41, 42, 44, 53, 77], "valid": [2, 5, 6, 17, 31, 34, 35, 36, 37, 43, 101], "rare": [2, 4, 5], "where": [2, 5, 12, 17, 23, 24, 32, 39, 42, 43, 45, 51, 58, 62, 63, 67, 76, 80, 84, 86, 87, 88, 91, 93, 100, 104, 106, 107, 108, 110, 113], "want": [2, 6, 42, 43], "alias": [2, 9, 37, 51, 52, 111], "stricontainerutf8": 2, "stricontainerutf16": 2, "stri_join": [2, 3, 4, 13, 14, 28, 48, 52, 106, 109, 113], "stri_trans_to": 2, "3rd": [2, 26, 106, 109, 112], "u_missing_resource_error": 2, "messag": [2, 12, 112], "striexcept": 2, "bom": [2, 5, 17, 37, 43, 44], "re": [2, 5, 27, 38, 39, 62, 73, 85, 105, 109, 110], "nativ": [2, 3, 5, 9, 13, 38, 39, 43, 44, 49, 62, 99, 109, 111], "rf_error": 2, "guarante": [2, 109, 111, 112, 113], "gcmask": 2, "uint32_t": 2, "arrai": 2, "over": [2, 5, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 27, 28, 30, 31, 46, 47, 51, 58, 59, 60, 68, 71, 76, 82, 83, 84, 85, 86, 89, 90, 91, 95, 96, 100, 104, 107, 109, 111], "string8": 2, "uninitialis": 2, "server": 2, "50": [2, 37, 59, 93, 98, 111], "need": [2, 4, 5, 12, 30, 62, 85, 89, 90, 93, 106, 107, 108, 109, 110, 111, 113], "icudt52b": 2, "subset": [2, 5, 7, 9, 27, 33, 91, 106, 113], "while": [2, 5, 6, 8, 17, 39, 109], "prepar": 2, "submiss": 2, "stubdata": 2, "icu52dt": 2, "extern": [2, 5, 111], "static": 2, "intens": 2, "student": 2, "warsaw": [2, 92, 93, 94, 112], "univers": [2, 5, 13, 93, 100, 111], "technologi": 2, "oracl": 2, "studio": 2, "By": [2, 3, 23, 68, 76, 89, 104, 106, 108, 112, 113], "mileston": 2, "about_argu": [3, 5, 6, 7, 8, 9, 10, 11, 12, 13], "about_encod": [3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44], "about_local": [3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 19, 29, 31, 47, 55, 56, 57, 59, 64, 67, 72, 80, 81, 83, 95, 102, 104], "about_search_boundari": [3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 15, 17, 19, 29, 31, 47, 59, 63, 64, 67, 72, 80, 81, 83, 84, 95, 102, 104], "about_search_charclass": [3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 100], "about_search_col": [3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 15, 17, 19, 29, 31, 47, 59, 64, 67, 72, 80, 81, 83, 95, 102, 104], "about_search_fix": [3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 65], "about_search_regex": [3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 66], "about_search": [3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 18, 19, 27, 46, 47, 58, 59, 60, 63, 64, 65, 66, 76, 78, 82, 83, 84, 86, 91, 95, 100, 104], "about_stringi": [3, 4, 5, 6, 7, 8, 9, 10, 11, 12], "operator_add": 3, "operator_compar": 3, "without": [3, 6, 21, 23, 66, 110, 113], "operator_dollar": 3, "stri_compar": [3, 6, 8, 10, 15, 19, 29, 31, 47, 59, 64, 67, 72, 80, 81, 83, 95, 102, 104], "arithmet": [3, 109], "creat": [3, 5, 14, 56, 112, 113], "sensit": [3, 7, 10, 13, 23, 57, 65, 66, 85, 95, 108, 112, 113], "stri_enc_fromutf32": [3, 5, 40, 41, 42, 43, 44, 46, 103, 111], "stri_enc_info": [3, 5, 37, 38, 39, 49], "queri": [3, 6, 56, 94, 107], "stream": [3, 40, 43], "possibli": [3, 12, 63, 106, 107, 112, 113], "stri_enc_isutf16": 3, "16": [3, 26, 33, 37, 44, 49, 56, 58, 93, 98, 110, 111], "8": [3, 13, 17, 18, 19, 21, 22, 23, 26, 30, 31, 32, 33, 37, 38, 39, 40, 41, 42, 44, 45, 49, 51, 53, 57, 59, 62, 68, 71, 72, 73, 81, 83, 91, 93, 98, 99, 101, 105, 106, 108, 109, 110, 111, 112, 114], "stri_enc_toascii": [3, 5, 32, 41, 42, 43, 44], "stri_escape_unicod": [3, 13, 101, 111], "escap": [3, 12, 13, 23, 66, 76, 111, 113], "stri_extract_boundari": 3, "flatten": 3, "stri_isempti": [3, 16, 53, 62, 68, 85, 103, 106], "stri_locale_info": [3, 6, 49, 56, 57], "stri_locale_set": [3, 6, 55, 56, 108], "stri_numbyt": [3, 16, 19, 50, 53, 68, 85, 103], "matcher": [3, 4, 113], "center": [3, 93], "left": [3, 9, 24, 46, 58, 64, 66, 76, 85, 104, 107, 108, 110, 112, 113], "right": [3, 9, 46, 58, 76, 108, 110, 112, 113], "align": [3, 85, 112], "randomli": [3, 69, 108], "shuffl": 3, "raw": [3, 5, 30, 31, 34, 35, 36, 42, 44, 92, 93, 110, 111], "stri_revers": [3, 13, 70, 106], "stri_split_lin": [3, 7, 8, 13, 19, 47, 59, 63, 82, 83, 95, 104, 112], "Into": 3, "stri_startsendswith": 3, "stri_stats_gener": [3, 13, 88], "stri_stats_latex": [3, 13, 87], "contain": [3, 9, 49, 63, 66, 76, 81, 87, 104, 107, 109, 113], "latex": 3, "select": [3, 5, 6, 22, 31, 33, 58, 69, 104, 106, 108, 109, 112], "stri_trans_casemap": 3, "translat": [3, 5, 13, 33, 112], "For": [3, 4, 5, 6, 8, 9, 10, 12, 17, 19, 23, 24, 30, 32, 36, 37, 43, 44, 45, 46, 47, 53, 58, 59, 60, 62, 63, 66, 67, 72, 76, 80, 81, 83, 85, 86, 89, 90, 92, 94, 95, 97, 100, 101, 106, 107, 108, 109, 110, 111, 112, 113], "trim": [3, 13, 86], "side": [3, 68, 85, 104, 109, 112, 113], "stri_unescape_unicod": [3, 45, 62], "un": [3, 93], "write": [3, 8, 13, 107, 109, 112, 113], "explain": [4, 5, 6, 7, 107], "clearli": 4, "discuss": [4, 5, 39, 44, 55, 108, 111, 113], "expect": [4, 6, 9, 66, 108, 109, 111, 113], "factor": [4, 20, 22, 23, 85, 109], "coercibl": [4, 14, 15, 17, 19, 32, 38, 42, 47, 50, 51, 53, 59, 62, 77, 83, 85, 103], "otherwis": [4, 23, 27, 29, 44, 45, 46, 47, 49, 51, 52, 54, 58, 59, 66, 71, 82, 83, 87, 92, 93, 100, 104, 113], "logic": [4, 15, 17, 21, 23, 27, 29, 30, 34, 35, 36, 37, 43, 44, 46, 47, 48, 49, 50, 51, 54, 58, 59, 60, 63, 64, 65, 66, 67, 68, 69, 76, 80, 82, 83, 84, 85, 86, 89, 90, 91, 99, 104, 106, 107, 108, 109, 113], "integ": [4, 5, 17, 18, 19, 20, 21, 27, 28, 29, 32, 42, 53, 54, 58, 59, 62, 64, 66, 67, 68, 69, 71, 80, 82, 83, 85, 86, 87, 88, 89, 90, 103, 104, 106, 108, 111, 113], "almost": [4, 5, 93, 109], "appli": [4, 9, 12, 14, 82, 84, 85, 90, 93, 103, 104, 106, 108, 109, 111, 113], "whenev": [4, 5, 65, 111], "properti": [4, 7, 12, 18, 87, 100, 103, 113], "instanc": [4, 5, 18, 23, 27, 36, 37, 46, 58, 60, 85, 86, 89, 100, 106, 107, 108, 109, 110, 111, 112, 113], "th": [4, 18, 27, 34, 36, 46, 56, 58, 60, 82, 83, 90, 106], "took": 4, "great": 4, "care": [4, 89, 109, 110], "reus": 4, "establish": [4, 57, 64, 94], "onc": [4, 27, 74, 107, 108, 109, 113], "behavior": [4, 6, 8, 12, 43, 51, 63, 64, 65, 66, 67, 80, 93], "man": [4, 7, 9, 13, 26, 45, 85, 113], "particular": [4, 5, 6, 8, 9, 12, 13, 63, 78, 89, 97, 106, 108, 109, 110, 111, 112, 113], "interest": [4, 13, 27, 86, 91, 107], "dim": [4, 110], "notat": [4, 111, 113], "sometim": [4, 35, 53, 84, 113], "contributor": [4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105], "offici": [4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105], "onlin": [4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105], "stringi_general_top": [4, 5, 6, 7, 8, 9, 10, 11, 12, 13], "variou": [5, 68, 85, 104, 106, 108, 111], "let": [5, 106, 107, 108, 109, 110, 113], "coexist": [5, 111], "consol": [5, 53, 68, 85, 104, 112], "ever": [5, 109], "even": [5, 8, 12, 23, 30, 54, 55, 107, 108, 109, 111, 112, 113], "alwai": [5, 9, 17, 31, 39, 40, 44, 51, 54, 56, 57, 71, 73, 85, 93, 99, 104, 107, 109, 111, 113], "regardless": [5, 109], "optim": 5, "competit": 5, "better": [5, 12, 29, 65, 70, 102], "especi": [5, 10, 30, 89, 108], "best": [5, 6, 30, 31, 108], "cascad": 5, "quot": [5, 9, 12, 23, 45, 109, 113], "guid": [5, 6, 8, 9, 10, 12, 17, 20, 23, 26, 29, 30, 44, 63, 64, 65, 66, 67, 72, 80, 81, 93, 95, 97, 98, 99, 102, 108, 112, 113], "hundr": [5, 30, 31], "develop": [5, 13, 113, 114], "year": [5, 20, 21, 22, 23, 92, 93, 110, 111], "small": [5, 71, 88, 95, 97, 108], "storag": [5, 66, 113], "knowledg": 5, "written": [5, 30, 66, 113], "either": [5, 9, 12, 18, 23, 24, 26, 27, 44, 45, 46, 63, 82, 86, 91, 93, 95, 100, 106, 107, 108, 109, 113], "them": [5, 6, 17, 30, 33, 85, 98, 108, 110, 113], "cover": [5, 12, 31, 112], "major": [5, 109, 110], "world": [5, 99, 107, 110], "machin": [5, 39, 113], "form": [5, 6, 9, 12, 16, 23, 24, 36, 40, 42, 49, 55, 57, 60, 64, 76, 84, 89, 99, 101, 106, 108, 111, 113], "scheme": [5, 9, 33, 107], "fit": [5, 8, 63, 109], "protocol": 5, "interoper": [5, 99, 109], "iso": [5, 6, 9, 13, 23, 30, 37, 93, 108, 111, 113], "8859": [5, 30, 37, 111], "easier": [5, 91, 109, 111], "Such": [5, 29, 85, 89, 90, 102, 106, 107, 108, 111], "store": [5, 62, 108, 110, 111, 113], "somehow": 5, "u": [5, 6, 9, 23, 24, 37, 44, 48, 51, 66, 80, 83, 84, 93, 103, 106, 107, 108, 109, 110, 111, 113], "0000": [5, 9, 92, 111], "10ffff": [5, 9, 111], "amount": [5, 20, 30, 93], "21": [5, 21, 37, 46, 51, 56, 58, 85, 93, 98, 106, 110, 111], "repres": [5, 9, 17, 23, 25, 30, 32, 33, 36, 37, 46, 58, 60, 66, 84, 85, 87, 88, 93, 108, 109, 111, 113], "four": [5, 106, 108, 112], "faq": 5, "thought": [5, 111, 113], "superset": [5, 39, 111], "spectrum": 5, "choic": [5, 111], "127": [5, 22, 26, 34, 37, 38, 40, 43, 93, 98, 109], "multi": [5, 9, 30], "4": [5, 12, 18, 20, 23, 26, 28, 37, 45, 46, 51, 54, 57, 58, 59, 60, 62, 64, 67, 72, 76, 82, 83, 85, 87, 89, 90, 93, 98, 101, 106, 107, 108, 109, 110, 111, 112, 113, 114], "unfortun": 5, "realli": [5, 55, 109], "mind": [5, 109], "therefor": [5, 9, 17, 84, 106, 108, 109, 110, 111, 113], "decid": [5, 111], "ambigu": 5, "ogonek": [5, 36, 79, 99, 108, 111, 113], "graphem": [5, 12], "semant": 5, "stri_trans_nfc": [5, 13, 53, 89, 95, 96, 97, 98, 99, 103, 104, 111], "denorm": 5, "appear": [5, 6, 23, 63, 71, 82, 84, 87, 88, 108], "typic": [5, 14, 15, 86, 93, 99, 108], "activ": [5, 9, 62, 99, 108, 113], "incident": 5, "utf8": [5, 37, 49, 111], "en": [5, 6, 26, 56, 85, 97, 99, 108, 110], "understand": [5, 55], "central": [5, 92, 93, 111], "european": [5, 6, 92, 93, 111], "177": [5, 37, 93, 98], "polish": [5, 6, 17, 30, 108, 109, 112, 113], "western": [5, 93, 111], "denot": [5, 9, 12, 22, 48, 58, 76, 86, 89, 104, 106, 111, 113], "plu": [5, 9, 12, 112], "minu": [5, 85, 110], "commun": [5, 6, 108, 111], "overal": [5, 12, 108], "mechan": [5, 38], "There": [5, 106, 107, 108, 109, 113], "implicit": [5, 9, 38], "assumpt": [5, 38, 40], "extend": [5, 9, 23, 36, 38, 40, 43, 111, 113], "automat": [5, 9, 38, 44, 99, 108, 111], "manipul": [5, 13, 109], "greater": [5, 17, 36, 38, 40, 51, 52, 62, 71, 104, 109], "k": [5, 12, 23, 38, 48, 51, 56, 80, 97, 104, 113, 114], "mislead": [5, 53, 111], "explicit": 5, "examin": [5, 27], "lc_ctype": [5, 38, 39, 111], "getlocal": [5, 38, 39, 111], "intuit": [5, 38, 67, 80, 109], "stdin": [5, 38], "keyboard": [5, 38], "sens": [5, 112], "encount": [5, 12, 39, 111], "unless": [5, 9, 27, 39, 51, 52, 58, 89, 90, 94, 113], "know": [5, 39, 106, 107, 111, 113], "carefulli": [5, 109], "These": [5, 7, 8, 9, 14, 15, 17, 18, 19, 23, 27, 35, 44, 46, 47, 51, 52, 58, 59, 60, 68, 76, 82, 84, 85, 86, 91, 95, 99, 100, 107, 113], "is_unknown_8bit": [5, 43], "final": [5, 6, 9, 12, 103], "properli": [5, 10, 38, 50, 53, 62, 64, 108], "shown": [5, 9, 12], "apart": [5, 37, 108, 112, 113], "insensit": [5, 9, 11, 12, 17, 65, 66, 107, 108, 113], "lead": [5, 9, 12, 17, 113], "digit": [5, 9, 12, 13, 23, 45, 64, 71, 93, 98, 101, 108, 110, 111, 113], "alphanumer": 5, "utf_8": 5, "tf08": 5, "exactli": [5, 12, 17, 32, 33, 38, 42, 68, 107, 113], "plai": [5, 108], "role": 5, "autom": [5, 110], "meaning": [5, 108], "imprecis": [5, 30, 31, 111], "consider": 5, "speak": 5, "io": [5, 6, 8, 9, 10, 12, 13, 17, 20, 23, 26, 29, 30, 44, 63, 64, 65, 66, 67, 72, 80, 81, 88, 93, 94, 95, 97, 98, 99, 102, 113], "userguid": [5, 6, 8, 9, 10, 12, 17, 20, 23, 26, 29, 30, 44, 63, 64, 65, 66, 67, 72, 80, 81, 93, 95, 97, 98, 99, 102, 113], "html": [5, 6, 9, 10, 12, 26, 30, 63, 64, 65, 66, 84, 93, 94, 95, 110, 113], "technic": [5, 8, 12, 84, 99, 113, 114], "www": [5, 6, 9, 12, 13, 84, 99, 103, 111, 114], "utf_bom": 5, "encoding_manag": [5, 33, 37, 38, 39], "encoding_detect": [5, 30, 31, 34, 35, 36], "stri_enc_isutf16b": [5, 30, 31, 34, 35, 36], "encoding_convers": [5, 32, 40, 41, 42, 43, 44], "section": [6, 9, 12, 66, 106, 108, 109, 110, 111], "fundament": 6, "concept": [6, 113], "who": [6, 114], "cultur": [6, 108], "human": [6, 92], "interact": 6, "region": [6, 93, 108, 110, 112], "verifi": [6, 107], "ask": [6, 107], "must": [6, 8, 12, 76, 90, 111, 112, 113], "back": [6, 9, 12, 23, 89], "necessarili": [6, 108, 109, 113], "parametr": 6, "deliv": [6, 108], "language_countri": [6, 55, 57, 108], "language_country_vari": [6, 57, 108], "en_u": [6, 56, 57, 59, 83, 95, 108], "letter": [6, 8, 9, 10, 11, 12, 14, 18, 23, 24, 30, 34, 36, 48, 50, 51, 53, 62, 63, 64, 66, 70, 71, 80, 85, 93, 95, 97, 103, 106, 108, 109, 111, 113], "639": [6, 37, 98, 108], "stand": [6, 9, 22, 23, 26, 113], "english": [6, 10, 30, 106, 108, 112, 113], "pl": [6, 55, 56, 93, 97, 98], "fr": [6, 37, 56], "french": [6, 30, 64, 93, 108], "de": [6, 37, 56, 93, 98, 106, 111, 112], "german": [6, 30, 95, 108], "countri": [6, 55, 93, 108, 110], "3166": [6, 93, 108], "reflect": [6, 33, 108], "convent": [6, 19, 45, 47, 59, 95, 104, 108, 109], "australian": [6, 93, 108], "en_au": [6, 56, 57, 108], "currenc": [6, 9, 108], "sever": [6, 30], "circul": 6, "variant": [6, 55, 76, 89, 90, 108, 111], "_euro": 6, "keyword": [6, 13, 20, 21, 22, 23], "Their": [6, 12, 113], "util": [6, 12, 54, 61, 75, 77, 94, 104, 108, 112, 113], "recogn": [6, 45, 66, 101], "phonebook": [6, 17, 108], "islam": [6, 26], "civil": 6, "synonym": [6, 28, 85, 106, 111, 113], "desir": [6, 66, 71, 77, 97, 106, 111, 112, 113], "referenc": 6, "dure": [6, 56, 82, 93, 108, 109], "improp": [6, 108], "One": [6, 113], "tune": [6, 10, 11, 12, 17, 18, 27, 46, 58, 63, 64, 65, 66, 67, 72, 76, 80, 81, 82, 86, 91, 107, 109], "choos": 6, "nor": [6, 39, 43, 108, 113], "es_": [6, 56], "v": [6, 17, 23, 45, 48, 51, 80, 81, 83, 101, 106, 108, 109, 114], "stri_trans_tolow": [6, 7, 8, 10, 13, 15, 17, 19, 29, 31, 47, 59, 63, 64, 67, 72, 80, 81, 83, 84, 95, 96, 97, 98, 99, 102, 104, 112], "locale_manag": [6, 55, 56, 57], "locale_sensit": [6, 8, 10, 15, 17, 19, 29, 31, 47, 59, 64, 67, 72, 80, 81, 83, 95, 102, 104], "stri_extract_all_boundari": [6, 7, 8, 10, 15, 17, 19, 29, 31, 46, 47, 59, 60, 63, 64, 67, 72, 80, 81, 83, 84, 95, 102, 104], "stringsearch": [7, 10], "occur": [7, 8, 12, 30, 44, 107, 108, 109, 112], "stri_count_": 7, "stri_replace_": [7, 76], "chunk": [7, 90, 106, 112], "text_boundari": [7, 8, 19, 47, 59, 63, 83, 84, 95, 104], "search_regex": [7, 12, 66], "search_fix": [7, 11, 65], "search_col": [7, 10, 64], "search_charclass": [7, 9, 100], "stri_trim_both": [7, 9, 76, 78, 100], "search_detect": [7, 27, 86], "search_count": [7, 18, 19], "search_loc": [7, 58, 59], "stri_locate_al": [7, 58, 59, 89, 90, 107], "search_replac": [7, 76, 78, 100], "search_split": [7, 82, 83, 84], "search_subset": [7, 91], "search_extract": [7, 46, 47, 60], "stri_match_al": [7, 46, 47, 60, 107], "linguist": [8, 9, 112], "margin": 8, "sentenc": [8, 19, 59, 63, 69, 83, 95, 112], "capit": [8, 95], "third": [8, 60, 64, 106, 108], "japanes": [8, 9, 26, 30, 97, 106, 112], "chines": [8, 9, 23, 30, 37, 106, 108, 112], "separ": [8, 9, 23, 47, 48, 51, 52, 55, 58, 63, 73, 82, 84, 85, 86, 87, 88, 97, 105, 106, 107, 108, 109, 110, 111, 112, 113], "middl": [8, 9, 89, 93, 109, 112], "punctuat": [8, 9, 10, 11, 23, 112, 113], "diacrit": [8, 9, 17, 112], "taken": [8, 30, 109, 110], "account": [8, 10, 17, 30, 65, 68, 85, 92, 104, 108], "would": [8, 62, 66, 100, 109, 110], "think": 8, "whole": [8, 60, 65, 107, 109, 110], "line_break": [8, 19, 47, 59, 63, 83, 112], "boundaryanalysi": [8, 63], "here": [9, 10, 11, 12, 17, 30, 38, 41, 43, 53, 58, 60, 85, 91, 106, 107, 108, 109, 111, 112, 113], "faster": [9, 44, 86, 91, 107, 109, 113], "briefli": 9, "summar": [9, 12], "bibliograph": 9, "recal": [9, 106, 107, 111, 113], "legal": 9, "inclus": [9, 89, 106], "seri": [9, 97, 109, 113], "bound": [9, 89], "squar": [9, 104, 106, 112, 113], "bracket": [9, 12, 30, 106, 112, 113], "emploi": 9, "perl": [9, 12, 98, 109, 113], "u0105": [9, 17, 29, 34, 36, 45, 50, 53, 62, 79, 85, 95, 97, 99, 101, 102, 103, 109], "0105": [9, 108], "abc": [9, 12, 14, 27, 28, 46, 50, 51, 53, 62, 79, 89, 90, 95, 107, 109, 113], "b": [9, 12, 15, 16, 18, 26, 29, 45, 46, 48, 51, 54, 56, 61, 72, 75, 76, 80, 82, 83, 85, 90, 101, 106, 107, 108, 109, 112, 113], "z": [9, 12, 18, 23, 27, 46, 48, 51, 71, 80, 82, 100, 106, 109, 111, 113], "through": 9, "theoret": [9, 12, 113], "complement": 9, "pat1": 9, "pat2": 9, "union": [9, 12, 113], "intersect": [9, 12], "asymmetr": 9, "slash": 9, "freeli": 9, "clariti": 9, "f": [9, 12, 23, 26, 30, 45, 48, 51, 54, 79, 80, 83, 85, 101, 104, 107, 110, 112, 113, 114], "mean": [9, 23, 35, 36, 57, 66, 87, 92, 93, 94, 106, 107, 108, 109, 110, 113], "acd": 9, "fm": 9, "disallow": [9, 44], "preced": [9, 12, 113], "backslash": [9, 66, 76, 111, 113], "glanc": [9, 10], "accord": [9, 38, 44, 46, 62, 64, 72, 80, 82, 95, 108, 111, 112, 113], "regexp": [9, 12, 66, 113], "u0000": 9, "u0010ffff": [9, 12], "general_categori": [9, 12], "l": [9, 10, 12, 18, 23, 48, 51, 52, 80, 83, 84, 97, 109, 111, 112, 113, 114], "upper": [9, 13, 64, 95, 97, 98, 108, 112, 113], "everyth": [9, 12], "numeric_valu": [9, 12], "cyril": [9, 12, 37, 97, 98, 108], "latin": [9, 12, 37, 68, 69, 71, 97, 98, 108, 111, 112, 113], "za": [9, 12, 56, 71, 113], "z0": [9, 12, 71], "greek": [9, 30, 37, 97, 98], "abov": [9, 31, 54, 60, 64, 83, 106, 107, 108, 109, 110, 111, 112, 113], "predefin": [9, 69], "lu": [9, 18, 27, 56, 111, 113], "uppercas": [9, 97, 113], "white_spac": [9, 18, 76, 82, 87], "larg": 9, "databas": [9, 13, 113], "classif": 9, "fall": [9, 23], "cc": [9, 23, 103, 106], "c0": [9, 103], "c1": [9, 103], "cf": [9, 103], "cn": [9, 30, 37], "reserv": [9, 23], "unassign": 9, "co": 9, "privat": 9, "surrog": 9, "lc": 9, "ll": [9, 18, 23, 27, 46, 71, 108, 111, 113], "lt": [9, 56, 98], "lowercas": [9, 97, 109, 113], "lm": 9, "lo": [9, 23, 56], "syllabl": 9, "ideograph": [9, 63], "digraph": 9, "mc": 9, "combin": [9, 12, 55, 97, 99, 108, 109, 111], "advanc": [9, 12, 63, 111, 113], "me": [9, 86, 103], "enclos": [9, 12, 23], "mn": [9, 56, 98, 103, 106], "nd": [9, 12, 56, 113], "decim": [9, 12, 111, 113], "nl": [9, 37, 56, 98], "pd": 9, "hyphen": [9, 103], "pair": [9, 108, 113], "pe": 9, "tie": 9, "po": 9, "pi": [9, 85, 112], "quotat": 9, "pf": 9, "sm": 9, "mathemat": [9, 97], "sc": [9, 56], "zl": 9, "2028": [9, 84], "zp": 9, "2029": [9, 84], "alphabet": [9, 12, 112, 113], "ascii_hex_digit": 9, "9a": [9, 113], "fa": [9, 56, 98], "bidi_control": 9, "bidi": 9, "bidirect": [9, 70, 71, 79, 89], "bidi_mirror": 9, "kind": [9, 107, 113], "default_ignorable_code_point": 9, "2060": 9, "206f": 9, "fff0": 9, "fffb": 9, "e0000": 9, "e0fff": 9, "discourag": 9, "anoth": [9, 97, 106, 109, 111, 113], "shape": 9, "hex_digit": 9, "commonli": [9, 30], "hexadecim": [9, 111], "katakana": [9, 63, 97, 98, 112], "dot": [9, 85, 108, 109, 113], "id_continu": 9, "continu": [9, 107], "id_start": 9, "cjkv": 9, "korean": [9, 30, 37, 93, 97, 98, 106], "vietnames": 9, "math": 9, "noncharacter_code_point": 9, "quotation_mark": 9, "soft_dot": 9, "soft": [9, 63, 103], "j": [9, 12, 26, 46, 48, 51, 54, 80, 107, 113, 114], "place": [9, 89, 90, 91, 107, 109], "disappear": 9, "terminal_punctu": 9, "textual": [9, 108], "tab": [9, 12, 84, 104], "cr": [9, 63, 84, 104], "lf": [9, 63, 84, 104], "zwsp": 9, "zwnbsp": 9, "case_sensit": 9, "posix_alnum": 9, "posix_blank": 9, "posix_graph": 9, "posix_print": 9, "posix_xdigit": 9, "case_ignor": 9, "changes_when_lowercas": 9, "changes_when_uppercas": 9, "changes_when_titlecas": 9, "changes_when_casefold": 9, "changes_when_casemap": 9, "changes_when_nfkc_casefold": 9, "57": [9, 37, 46, 93, 98], "emoji_present": 9, "emoji_modifi": 9, "emoji_modifier_bas": 9, "punct": [9, 113], "someth": [9, 76, 108], "ispunct": [9, 113], "iec": [9, 111, 113], "9899": [9, 113], "1990": [9, 113], "c90": [9, 113], "isalnum": [9, 113], "belong": 9, "flavor": 9, "annex": [9, 99, 103, 108, 112, 113], "tr44": 9, "migrat": [9, 65], "unidata": 9, "txt": [9, 30, 111], "doc": [9, 10, 13, 26, 63, 64, 66, 93, 94, 110, 111], "apidoc": [9, 13, 26, 63, 64, 66, 93, 94], "classicu_1_1unicodeset": 9, "facil": [10, 11, 30, 31, 66, 101, 109, 113], "interestingli": [10, 109], "seem": 10, "notion": [10, 17, 103], "take": [10, 17, 65, 68, 85, 92, 104, 106, 108], "conjoin": [10, 11, 108], "slower": [10, 14, 29, 76, 102, 108], "werner": 10, "1999": [10, 23, 37], "efficient_text_searching_in_java": 10, "worst": [11, 107], "Be": [11, 27], "actual": [11, 104, 108, 111], "bitwis": 11, "done": [11, 71, 110, 113], "usual": [11, 15, 16, 32, 45, 51, 53, 67, 80, 90, 91, 99, 102, 107], "abstract": [12, 108, 111, 113], "fragment": 12, "With": [12, 55, 95], "Its": [12, 36, 89, 90, 95], "loos": 12, "jdk": [12, 113], "18": [12, 37, 58, 84, 88, 93, 98, 99, 106, 113], "good": [12, 46, 111], "introduct": [12, 108, 109, 113, 114], "friedl": [12, 114], "2002": [12, 37, 108], "topic": [12, 13, 111, 113], "prefer": [12, 108], "less": [12, 17, 54, 58, 108, 109], "retri": [12, 113], "fewer": 12, "possess": [12, 113], "parenthes": [12, 58, 60, 76, 110], "sub": [12, 60, 91], "somewhat": [12, 67, 80, 106, 107, 112], "comment": [12, 66, 113], "ahead": 12, "assert": 12, "unbound": 12, "angl": [12, 30, 113], "ismwx": 12, "evalu": [12, 85], "enabl": [12, 30, 65, 66, 107, 108, 112, 113], "portion": 12, "bell": [12, 114], "u0007": 12, "begin": [12, 13, 67, 80, 88, 93, 109], "transit": [12, 113], "w": [12, 23, 24, 26, 48, 51, 58, 60, 66, 80, 93, 109, 111, 113], "cx": [12, 101], "u001b": 12, "q": [12, 23, 48, 51, 80], "feed": [12, 84], "u000c": 12, "horizont": [12, 104], "space_separ": 12, "u0009": 12, "u000a": 12, "until": 12, "carriag": [12, 84], "u000d": 12, "t": [12, 18, 23, 26, 45, 48, 51, 80, 83, 97, 101, 109, 112, 113, 114], "tabul": 12, "uhhhh": 12, "hex": [12, 45, 97, 98, 101], "hhhh": 12, "uhhhhhhhh": 12, "hhhhhhhh": 12, "eight": 12, "largest": 12, "decimal_numb": 12, "connector_punctu": 12, "u200c": 12, "u200d": 12, "six": 12, "xhh": 12, "hh": [12, 23, 24, 112], "cluster": 12, "whatev": [12, 113], "nth": 12, "total": [12, 31, 68, 85, 87, 100, 104, 112], "0ooo": 12, "octal": [12, 101], "ooo": [12, 101], "three": [12, 23, 30, 31, 93, 95, 107, 108], "0377": 12, "distinguish": [12, 108], "newlin": [12, 73, 84, 105, 113], "outsid": [12, 23], "treat": [12, 23, 48, 51, 64, 66, 75, 85, 97, 108, 109, 113], "insid": [12, 23, 66], "context": [12, 23, 26, 65, 88, 95, 107, 108, 112], "whitespac": 12, "capabl": [12, 97], "offer": [12, 109], "natch": 12, "On": [12, 82, 83, 90, 106, 108, 109, 111, 113], "wish": [12, 48, 76, 82, 86, 110, 113], "lookup": [12, 26], "reilli": [12, 114], "tr18": [12, 84], "info": 12, "predict": 13, "everi": [13, 60, 76, 79, 104, 107, 109, 111, 113], "internation": 13, "l10n": 13, "homepag": 13, "accompani": 13, "ucd": 13, "seek": [13, 113], "pace": 13, "therein": [13, 109, 113], "gather": [13, 110], "fanci": [13, 48], "joy": 13, "lower": [13, 64, 95, 97, 98, 108, 111, 112, 113], "titl": [13, 95, 97, 98, 112], "bartek": 13, "ibm": [13, 33, 37, 114], "inc": [13, 114], "consortium": 13, "10646": [13, 37, 111], "rfc": [13, 23, 99], "3629": 13, "editor": [13, 99, 113, 114], "rfc3629": 13, "join": [14, 28, 48, 51, 52], "feel": [14, 15, 17, 86], "e1": [14, 15, 16, 17, 28], "e2": [14, 15, 16, 17, 28], "e3": 14, "temporari": 14, "xy": 14, "abca": [14, 109], "123b": 14, "xyc": 14, "abcd": [14, 16, 60, 68, 85, 106, 107, 109, 112], "123e": 14, "xyf": 14, "id_": 14, "5": [14, 18, 22, 23, 28, 30, 37, 46, 51, 54, 58, 59, 67, 70, 71, 72, 80, 83, 84, 85, 89, 90, 93, 98, 99, 100, 103, 106, 107, 108, 109, 110, 111, 112, 113, 114], "id_1": 14, "id_2": 14, "id_3": 14, "id_4": 14, "id_5": 14, "friend": 15, "consequ": [15, 39], "pairwis": 15, "shorter": [15, 18, 27, 46, 58, 60, 76, 82, 86, 90, 91, 106, 109], "python": [16, 106, 109, 112], "overload": [16, 112], "propag": [16, 109], "atomic_vector": 16, "u00df": [16, 19, 29, 95, 97, 102, 108, 111], "u00b5": 16, "u0001f970": 16, "abcdef": 16, "\u00df\u00b5": 16, "equal": [17, 23, 29, 30, 31, 51, 52, 64, 68, 71, 82, 83, 102, 103, 108, 111, 113], "clever": [17, 44, 113], "lexicograph": [17, 67, 72, 80, 108], "strcmp": [17, 81], "hold": [17, 38], "ch": [17, 37, 98, 108], "hladni": [17, 58, 67, 72, 80, 81], "chladni": [17, 67, 72, 80, 81, 108], "pl_pl": [17, 23, 26, 55, 56, 67, 72, 80, 81, 108, 109, 112], "slovak": [17, 108], "strength": [17, 29, 46, 58, 64, 86, 102], "hladn": [17, 58], "u00fd": [17, 46, 58], "mario": 17, "u00e1rio": 17, "case_level": [17, 64, 108], "2l": 17, "1l": [17, 20, 82, 83, 86, 89, 90], "stri_trans_nfkd": [17, 19, 29, 53, 68, 99, 102, 103, 111], "u105": 17, "ligatur": [17, 108], "ufb00": [17, 108], "ff": [17, 56, 84, 108], "u00e4rtn": 17, "gaertner": 17, "de_d": [17, 56, 95, 108], "coll": [18, 27, 46, 58, 64, 65, 76, 82, 86, 91, 109], "stri_count_charclass": 18, "stri_count_col": 18, "stri_count_regex": [18, 66, 111, 113], "supplementari": [18, 27, 46, 58, 60, 76, 82, 86, 91], "underli": [18, 27, 46, 58, 60, 76, 81, 82, 86, 91, 110, 111, 113], "dolor": [18, 52, 69, 76, 82, 87, 88, 104, 112], "sit": [18, 52, 69, 76, 82, 87, 88, 104, 112], "amet": [18, 52, 69, 76, 82, 87, 88, 104, 112], "consectetur": [18, 69, 76, 87, 88, 104], "adipis": [18, 76, 87, 88, 104], "elit": [18, 69, 76, 87, 88, 104, 112], "7": [18, 23, 26, 30, 37, 46, 51, 58, 59, 70, 72, 76, 83, 85, 93, 98, 106, 107, 108, 109, 110, 112, 113, 114], "babab": 18, "strrringi": [18, 27], "el": [18, 56, 76, 98, 111], "bab": [18, 109], "baab": 18, "baaab": 18, "ubrk_word_non": [19, 47, 59], "skip_word_non": [19, 59, 63, 83], "u00a0abov": [19, 59, 83, 112], "egg": [19, 58, 59, 60, 83, 89, 106, 112, 113], "bacon": [19, 52, 59, 60, 83, 89, 106, 109, 113], "83": [19, 37, 46, 93, 98, 109], "13": [19, 23, 26, 37, 46, 51, 59, 83, 84, 93, 98, 106, 112, 113, 114], "test2": 19, "u03c0": [19, 85], "u0153": 19, "u0119": [19, 109], "u00a9": 19, "u2190": 19, "u2193": 19, "u2192": 19, "20": [19, 20, 37, 58, 80, 83, 85, 93, 98, 104, 109, 110, 111, 112, 113], "tz": [20, 21, 22, 23, 92, 93, 94, 112], "posixlt": [20, 22, 23], "month": [20, 21, 22, 23, 26, 110], "week": [20, 23], "dai": [20, 21, 22, 23, 110, 112], "hour": [20, 21, 22, 23, 92, 93, 110], "minut": [20, 21, 22, 23], "millisecond": [20, 21, 22, 23, 66, 109, 113], "timezon": [20, 23, 92, 93, 94], "januari": [20, 22, 26], "februari": [20, 26], "28": [20, 22, 23, 26, 37, 93, 98, 110, 111, 112], "29": [20, 21, 23, 37, 46, 66, 93, 98, 108, 110, 112, 113], "datetim": [20, 21, 22, 23, 24, 25, 26, 92, 93, 94], "2024": [20, 21, 22, 85], "07": [20, 23, 93], "06": [20, 21, 85, 93], "14": [20, 22, 37, 58, 71, 85, 93, 98, 109, 112, 113], "48": [20, 22, 23, 37, 47, 85, 93, 98], "12": [20, 21, 22, 23, 37, 51, 58, 59, 68, 85, 89, 90, 93, 98, 106, 109, 112, 113, 114], "cest": [20, 21, 23, 112], "05": [20, 21, 23, 85, 93, 111], "2014": [20, 37], "04": [20, 23, 93, 109], "hebrew": [20, 21, 22, 26, 30, 37, 98, 108, 112], "09": [20, 23, 93, 110, 111, 112], "2016": [20, 110], "02": [20, 21, 23, 93], "cet": [20, 21, 23, 93], "0l": [21, 66], "lenient": [21, 23], "1bce": 21, "2bce": 21, "fraction": [21, 23, 85, 113], "23": [21, 23, 37, 46, 93, 98, 100, 109, 110, 113], "999": [21, 26, 37], "5775": 21, "nisan": [21, 22, 26, 112], "03": [21, 23, 37, 93], "01": [21, 23, 25, 92, 93, 96, 111], "15": [21, 23, 37, 46, 57, 58, 93, 98, 99, 106, 108, 110, 112, 113], "00": [21, 23, 25, 92, 93, 111], "attr": [22, 58, 113], "tzone": 22, "1bc": 22, "2bc": 22, "24": [22, 23, 37, 59, 93, 98, 109, 110, 111], "clock": [22, 23], "weekofyear": 22, "weekofmonth": 22, "dayofyear": 22, "dayofweek": 22, "sundai": [22, 26], "hour12": 22, "ampm": [22, 26], "era": [22, 23, 26, 113], "810": [22, 26, 37], "19": [22, 23, 26, 37, 46, 59, 83, 93, 98, 113], "5784": 22, "814": [22, 37], "35": [22, 37, 46, 59, 93, 98], "234": [22, 37, 93, 98], "vice": [23, 113], "versa": [23, 113], "uuuu": 23, "mm": [23, 24, 110, 112], "dd": [23, 24, 112], "ss": [23, 24, 59, 83, 95, 108, 112], "unspecifi": 23, "strftime": [23, 24, 112], "dt_style": 23, "dt_relative_styl": 23, "dt": 23, "medium": 23, "rel": [23, 81, 110, 112], "yy": [23, 46], "produc": [23, 44, 65, 107, 112], "wherea": [23, 109, 110, 113], "yyyi": [23, 24, 112], "abbrevi": [23, 26], "adjac": 23, "becom": [23, 78, 82, 105, 112], "gg": [23, 107], "ggg": 23, "gggg": 23, "anno": [23, 26], "domini": [23, 26], "ggggg": 23, "96": [23, 37, 56, 88, 93, 98], "1996": [23, 37], "4601": 23, "cyclic": 23, "lunar": 23, "quarter": [23, 26], "qq": 23, "qqq": 23, "q2": [23, 26], "qqqq": 23, "2nd": [23, 26, 58, 89, 90, 106, 107, 109, 113], "qqqqq": 23, "alon": [23, 108, 113], "mmm": 23, "mmmm": [23, 112], "septemb": [23, 26, 108], "mmmmm": 23, "lll": 23, "llll": 23, "lllll": 23, "ww": 23, "27": [23, 37, 46, 88, 93, 98, 110], "189": [23, 37, 93, 98], "wed": [23, 26], "juli": [23, 26], "julian": 23, "2451334": 23, "ee": [23, 56], "eee": 23, "tue": [23, 26], "eeee": 23, "tuesdai": [23, 26], "eeeee": [23, 106], "eeeeee": 23, "tu": 23, "mondai": [23, 26], "1st": [23, 26, 106, 107, 109, 110], "ccc": [23, 106, 109], "cccc": 23, "ccccc": 23, "cccccc": 23, "am": [23, 26, 56, 59, 83, 98, 113], "pm": [23, 26, 112], "marker": [23, 44, 73], "kk": [23, 56, 98], "11": [23, 26, 37, 46, 51, 56, 58, 59, 67, 71, 72, 80, 85, 93, 98, 103, 104, 107, 109, 110, 112, 113, 114], "truncat": [23, 69], "append": [23, 85, 108], "sss": 23, "235": [23, 26, 37, 85, 93, 98], "ssss": 23, "2350": 23, "61201235": 23, "zz": 23, "zzz": 23, "pdt": 23, "zzzz": 23, "pacif": [23, 93], "daylight": [23, 92, 93], "iso8601": 23, "hm": 23, "822": [23, 37], "0800": 23, "gmt": [23, 92, 93], "oooo": 23, "08": [23, 93], "xxxxx": 23, "zzzzz": 23, "pt": [23, 56], "vvvv": 23, "angel": 23, "id": [23, 56, 69, 92, 93, 96, 97, 107, 109, 112], "uslax": 23, "vv": 23, "america": [23, 93], "los_angel": [23, 93], "exemplar": 23, "citi": [23, 110], "vvv": 23, "0530": 23, "xx": [23, 85], "xxx": [23, 48, 101], "xxxx": 23, "075258": 23, "noth": [23, 105], "row": [23, 46, 47, 54, 58, 59, 60, 82, 83, 107, 109, 110], "real": [23, 85, 107, 108, 112, 113], "czw": 23, "gru": 23, "yyyyi": 23, "aaa": [23, 28, 46, 100, 109], "grudnia": [23, 26], "ssz": 23, "31t23": 23, "0100": [23, 92], "8601": 23, "guidelin": [23, 73, 84], "format_pars": [23, 26], "17": [23, 37, 46, 58, 93, 98, 110, 112, 113], "lipca": [23, 26], "date_long": [23, 112], "datetime_relative_medium": 23, "datetime_ful": 24, "date_relative_short": 24, "formatt": 24, "circumst": 24, "inconsist": 24, "1970": [25, 114], "utc": [25, 93], "leap": [25, 93], "weekdai": 26, "standalon": 26, "narrow": 26, "selector": 26, "dateformatsymbol": 26, "classicu_1_1dateformatsymbol": 26, "march": 26, "april": 26, "june": 26, "august": 26, "octob": 26, "novemb": 26, "decemb": 26, "wednesdai": 26, "thursdai": 26, "fridai": 26, "saturdai": 26, "4th": [26, 106, 109], "christ": 26, "tishri": [26, 112], "heshvan": [26, 112], "kislev": [26, 112], "tevet": [26, 112], "shevat": [26, 112], "adar": [26, 112], "iyar": [26, 112], "sivan": [26, 112], "tamuz": [26, 112], "av": [26, 112], "elul": [26, 112], "ii": [26, 56], "he_il": [26, 56], "\u05ea\u05e9\u05e8\u05d9": 26, "\u05d7\u05e9\u05d5\u05d5\u05df": 26, "\u05db\u05e1\u05dc\u05d5": 26, "\u05d8\u05d1\u05ea": 26, "\u05e9\u05d1\u05d8": 26, "\u05d0\u05d3\u05e8": 26, "\u05d0": 26, "\u05e0\u05d9\u05e1\u05df": 26, "\u05d0\u05d9\u05d9\u05e8": 26, "\u05e1\u05d9\u05d5\u05d5\u05df": 26, "\u05ea\u05de\u05d5\u05d6": 26, "\u05d0\u05d1": 26, "\u05d0\u05dc\u05d5\u05dc": 26, "\u05d1": 26, "\u05d9\u05d5\u05dd": 26, "\u05e8\u05d0\u05e9\u05d5\u05df": 26, "\u05e9\u05e0\u05d9": 26, "\u05e9\u05dc\u05d9\u05e9\u05d9": 26, "\u05e8\u05d1\u05d9\u05e2\u05d9": 26, "\u05d7\u05de\u05d9\u05e9\u05d9": 26, "\u05e9\u05d9\u05e9\u05d9": 26, "\u05e9\u05d1\u05ea": 26, "\u05e8\u05d1\u05e2\u05d5\u05df": 26, "\u05dc\u05e4\u05e0\u05d4": 26, "\u05e6": 26, "\u05d0\u05d7\u05d4": 26, "\u05dc\u05d1\u05e8\u05d9\u05d0\u05ea": 26, "\u05d4\u05e2\u05d5\u05dc\u05dd": 26, "muharram": 26, "safar": 26, "rabi\u02bb": 26, "jumada": 26, "rajab": 26, "sha\u02bbban": 26, "ramadan": 26, "shawwal": 26, "dhu\u02bbl": 26, "qi\u02bbdah": 26, "hijjah": 26, "ah": 26, "persian": [26, 98], "farvardin": 26, "ordibehesht": 26, "khordad": 26, "tir": 26, "mordad": 26, "shahrivar": 26, "mehr": 26, "aban": 26, "azar": 26, "dei": 26, "bahman": 26, "esfand": 26, "ap": 26, "indian": [26, 93], "chaitra": 26, "vaisakha": 26, "jyaistha": 26, "asadha": 26, "sravana": 26, "bhadra": 26, "asvina": 26, "kartika": 26, "agrahayana": 26, "pausa": 26, "magha": 26, "phalguna": 26, "saka": 26, "coptic": 26, "tout": 26, "baba": 26, "hator": 26, "kiahk": 26, "toba": 26, "amshir": 26, "baramhat": 26, "baramouda": 26, "bashan": 26, "paona": 26, "epep": 26, "mesra": 26, "nasi": 26, "era0": 26, "era1": 26, "taika": 26, "645": [26, 37, 98], "650": [26, 37, 98, 111], "hakuchi": 26, "671": [26, 37, 56, 98], "hakuh\u014d": 26, "672": [26, 37, 98], "686": [26, 37, 56, 98], "shuch\u014d": 26, "701": [26, 37, 56, 98], "taih\u014d": 26, "704": [26, 37, 98, 114], "keiun": 26, "708": [26, 37, 98], "wad\u014d": 26, "715": [26, 37, 98], "reiki": 26, "717": [26, 37, 98], "y\u014dr\u014d": 26, "724": [26, 37, 98], "jinki": 26, "729": [26, 37, 98], "tenpy\u014d": 26, "749": [26, 37, 98], "kamp\u014d": 26, "sh\u014dh\u014d": 26, "757": [26, 37], "h\u014dji": 26, "765": [26, 37], "jingo": 26, "767": [26, 37], "770": [26, 37], "h\u014dki": 26, "780": [26, 37], "ten": 26, "\u014d": 26, "781": [26, 37, 56], "782": [26, 37], "enryaku": 26, "806": [26, 37, 56], "daid\u014d": 26, "k\u014dnin": 26, "824": [26, 37], "22": [26, 37, 58, 93, 98, 110, 113], "tench\u014d": 26, "834": [26, 37, 109], "j\u014dwa": 26, "848": [26, 37], "kaj\u014d": 26, "851": [26, 37, 56], "25": [26, 37, 46, 51, 67, 72, 80, 83, 93, 98, 110, 111], "ninju": 26, "854": [26, 37], "saik\u014d": 26, "857": [26, 37], "859": [26, 37], "j\u014dgan": 26, "877": [26, 37], "gangy\u014d": 26, "885": [26, 37], "ninna": 26, "889": [26, 37], "kanpy\u014d": 26, "898": [26, 37], "sh\u014dtai": 26, "901": [26, 37], "engi": 26, "923": [26, 37], "34": [26, 37, 93, 98, 113], "ench\u014d": 26, "931": [26, 37], "j\u014dhei": 26, "938": [26, 37], "tengy\u014d": 26, "947": [26, 37], "37": [26, 37, 46, 59, 83, 93, 98, 113], "tenryaku": 26, "957": [26, 37], "tentoku": 26, "961": [26, 37], "\u014dwa": 26, "964": [26, 37], "40": [26, 37, 59, 93, 98, 109, 110, 114], "k\u014dh\u014d": 26, "968": [26, 37], "anna": 26, "970": [26, 37], "tenroku": 26, "973": [26, 37], "43": [26, 37, 46, 93, 98, 111], "976": [26, 37], "j\u014dgen": 26, "978": [26, 37, 114], "tengen": 26, "983": [26, 37], "eikan": 26, "985": [26, 37], "kanna": 26, "987": [26, 37], "eien": 26, "989": [26, 37], "49": [26, 37, 46, 93, 98, 109, 110], "eiso": 26, "990": [26, 37], "sh\u014dryaku": 26, "995": [26, 37, 109], "ch\u014dtoku": 26, "ch\u014dh\u014d": 26, "1004": [26, 37], "kank\u014d": 26, "1012": [26, 37], "ch\u014dwa": 26, "1017": [26, 37], "kannin": 26, "1021": [26, 37], "jian": 26, "1024": [26, 37], "manju": 26, "1028": [26, 37], "ch\u014dgen": 26, "1037": [26, 37], "ch\u014dryaku": 26, "1040": [26, 37], "ch\u014dky\u016b": 26, "1044": [26, 37], "kantoku": 26, "1046": [26, 37], "eish\u014d": 26, "1053": [26, 37], "tengi": 26, "1058": [26, 37], "64": [26, 37, 93, 98], "k\u014dhei": 26, "1065": [26, 37], "jiryaku": 26, "1069": [26, 37], "enky\u016b": 26, "1074": [26, 37], "67": [26, 37, 44, 46, 73, 93, 98, 111], "sh\u014dho": 26, "1077": [26, 37], "1081": [26, 37], "eih\u014d": 26, "1084": [26, 37], "70": [26, 37, 93, 98, 109, 110], "\u014dtoku": 26, "1087": [26, 37], "kanji": 26, "1094": [26, 37], "kah\u014d": 26, "1096": [26, 37], "eich\u014d": 26, "1097": [26, 37], "j\u014dtoku": 26, "1099": [26, 37], "k\u014dwa": 26, "1104": [26, 37], "76": [26, 37, 56, 93, 98], "ch\u014dji": 26, "1106": [26, 37], "kash\u014d": 26, "1108": [26, 37], "tennin": 26, "1110": [26, 37], "79": [26, 37, 46, 59, 85, 93, 98], "ei": 26, "1113": [26, 37], "eiky\u016b": 26, "1118": [26, 37], "gen": 26, "1120": [26, 37], "82": [26, 37, 59, 93, 98], "h\u014dan": 26, "1124": [26, 37], "tenji": 26, "1126": [26, 37], "daiji": 26, "1131": [26, 37], "85": [26, 36, 37, 46, 84, 93, 98, 110, 111], "tensh\u014d": 26, "1132": [26, 37], "ch\u014dsh\u014d": 26, "1135": [26, 37], "h\u014den": 26, "1141": [26, 37], "eiji": 26, "1142": [26, 37], "k\u014dji": 26, "1144": [26, 37], "y\u014d": 26, "1145": [26, 37], "ky\u016ban": 26, "1151": [26, 37], "ninpei": 26, "1154": [26, 37], "ky\u016bju": 26, "1156": [26, 37], "h\u014dgen": 26, "1159": [26, 37], "heiji": 26, "1160": [26, 37], "eiryaku": 26, "1161": [26, 37], "97": [26, 37, 93, 98, 111], "\u014dho": 26, "1163": [26, 37], "ch\u014dkan": 26, "1165": [26, 37], "eiman": 26, "1166": [26, 37], "nin": 26, "1169": [26, 37], "ka\u014d": 26, "1171": [26, 37], "sh\u014dan": 26, "1175": [26, 37], "angen": 26, "1177": [26, 37], "jish\u014d": 26, "1181": [26, 37], "y\u014dwa": 26, "1182": [26, 37], "juei": 26, "1184": [26, 37, 104, 114], "genryaku": 26, "1185": [26, 37], "bunji": 26, "1190": [26, 37], "kenky\u016b": 26, "1199": [26, 37], "sh\u014dji": 26, "1201": [26, 37], "kennin": 26, "1204": [26, 37], "genky\u016b": 26, "1206": 26, "ken": 26, "1207": 26, "1211": 26, "115": [26, 37, 93, 98, 110], "kenryaku": 26, "1213": [26, 37], "kenp\u014d": 26, "1219": 26, "j\u014dky\u016b": 26, "1222": 26, "j\u014d\u014d": 26, "1224": 26, "gennin": 26, "1225": 26, "karoku": 26, "1227": 26, "121": [26, 37, 56, 93, 98], "antei": 26, "1229": 26, "kanki": 26, "1232": [26, 37], "j\u014dei": 26, "1233": [26, 37], "tenpuku": 26, "1234": [26, 37, 76], "bunryaku": 26, "1235": [26, 37], "katei": 26, "1238": 26, "ryakunin": 26, "1239": 26, "1240": 26, "ninji": 26, "1243": 26, "130": [26, 37, 93, 98], "kangen": 26, "1247": 26, "1249": 26, "kench\u014d": 26, "1256": [26, 30, 37], "k\u014dgen": 26, "1257": [26, 37], "sh\u014dka": 26, "1259": 26, "sh\u014dgen": 26, "1260": 26, "136": [26, 37, 56, 93, 98], "bun": 26, "1261": 26, "k\u014dch\u014d": 26, "1264": 26, "1275": 26, "kenji": 26, "1278": 26, "k\u014dan": 26, "1288": 26, "sh\u014d\u014d": 26, "1293": 26, "142": [26, 37, 85, 87, 93, 98, 112], "einin": 26, "1299": 26, "1302": 26, "kengen": 26, "1303": 26, "145": [26, 37, 93, 98], "kagen": 26, "1306": 26, "tokuji": 26, "1308": 26, "enky\u014d": 26, "1311": 26, "148": [26, 37, 93, 98], "\u014dch\u014d": 26, "1312": 26, "sh\u014dwa": 26, "1317": 26, "bunp\u014d": 26, "1319": 26, "151": [26, 37, 56, 93, 98], "gen\u014d": 26, "1321": 26, "genk\u014d": 26, "1324": 26, "sh\u014dch\u016b": 26, "1326": 26, "karyaku": 26, "1329": 26, "gentoku": 26, "1331": 26, "1334": 26, "kenmu": 26, "1336": 26, "engen": 26, "1340": 26, "k\u014dkoku": 26, "1346": 26, "160": [26, 37, 93, 98], "sh\u014dhei": 26, "1370": 26, "kentoku": 26, "1372": 26, "bunch\u016b": 26, "1375": [26, 37], "163": [26, 37, 87, 93, 98], "tenju": 26, "1379": 26, "k\u014dryaku": 26, "1381": 26, "1384": 26, "166": [26, 37, 56, 93, 98], "gench\u016b": 26, "1392": [26, 37], "meitoku": 26, "1387": 26, "kakei": 26, "1389": 26, "k\u014d\u014d": 26, "1390": [26, 37], "1394": 26, "\u014dei": 26, "1428": 26, "172": [26, 37, 93, 98], "sh\u014dch\u014d": 26, "1429": 26, "eiky\u014d": 26, "1441": 26, "kakitsu": 26, "1444": 26, "1449": 26, "h\u014dtoku": 26, "1452": 26, "ky\u014dtoku": 26, "1455": 26, "178": [26, 37, 93, 98, 110], "k\u014dsh\u014d": 26, "1457": 26, "ch\u014droku": 26, "1460": 26, "kansh\u014d": 26, "1466": 26, "181": [26, 37, 56, 93, 98], "bunsh\u014d": 26, "1467": 26, "\u014dnin": 26, "1469": 26, "bunmei": 26, "1487": 26, "184": [26, 37, 93, 98], "ch\u014dky\u014d": 26, "1489": 26, "entoku": 26, "1492": 26, "mei\u014d": 26, "1501": 26, "bunki": 26, "1504": 26, "1521": 26, "taiei": 26, "1528": 26, "190": [26, 37, 69, 93, 98], "ky\u014droku": 26, "1532": 26, "tenbun": 26, "1555": 26, "1558": 26, "eiroku": 26, "1570": 26, "genki": 26, "1573": 26, "1592": 26, "196": [26, 37, 56, 93, 98], "bunroku": 26, "1596": 26, "keich\u014d": 26, "1615": 26, "genna": 26, "1624": 26, "kan": 26, "1644": 26, "1648": 26, "keian": 26, "1652": 26, "202": [26, 37, 93, 98], "1655": 26, "meireki": 26, "1658": 26, "manji": 26, "1661": 26, "kanbun": 26, "1673": 26, "enp\u014d": 26, "1681": 26, "tenna": 26, "1684": 26, "208": [26, 37, 93, 98], "j\u014dky\u014d": 26, "1688": 26, "genroku": 26, "1704": 26, "h\u014dei": 26, "1711": 26, "211": [26, 37, 56, 93, 98], "sh\u014dtoku": 26, "1716": 26, "ky\u014dh\u014d": 26, "1736": 26, "genbun": 26, "1741": 26, "kanp\u014d": 26, "1744": 26, "1748": 26, "1751": 26, "217": [26, 37, 93, 98], "h\u014dreki": 26, "1764": 26, "meiwa": 26, "1772": 26, "1781": [26, 111], "tenmei": 26, "1789": 26, "kansei": 26, "1801": 26, "ky\u014dwa": 26, "1804": 26, "223": [26, 37, 93, 98], "bunka": 26, "1818": 26, "bunsei": 26, "1830": 26, "tenp\u014d": 26, "1844": 26, "226": [26, 37, 56, 93, 98], "k\u014dka": 26, "1848": 26, "kaei": 26, "1854": 26, "ansei": 26, "1860": 26, "229": [26, 37, 93, 98], "1861": 26, "bunky\u016b": 26, "1864": 26, "genji": 26, "1865": 26, "kei\u014d": 26, "1868": 26, "meiji": 26, "taish\u014d": 26, "heisei": 26, "reiwa": 26, "ja_jp_tradit": 26, "1\u6708": 26, "2\u6708": 26, "3\u6708": 26, "4\u6708": 26, "5\u6708": 26, "6\u6708": 26, "7\u6708": 26, "8\u6708": 26, "9\u6708": 26, "10\u6708": 26, "11\u6708": 26, "12\u6708": 26, "\u65e5\u66dc\u65e5": 26, "\u6708\u66dc\u65e5": 26, "\u706b\u66dc\u65e5": 26, "\u6c34\u66dc\u65e5": 26, "\u6728\u66dc\u65e5": 26, "\u91d1\u66dc\u65e5": 26, "\u571f\u66dc\u65e5": 26, "\u7b2c1\u56db\u534a\u671f": 26, "\u7b2c2\u56db\u534a\u671f": 26, "\u7b2c3\u56db\u534a\u671f": 26, "\u7b2c4\u56db\u534a\u671f": 26, "\u5348\u524d": 26, "\u5348\u5f8c": 26, "\u7d00\u5143\u524d": 26, "\u897f\u66a6": 26, "th_th_tradit": 26, "buddhist": 26, "\u0e21\u0e01\u0e23\u0e32\u0e04\u0e21": 26, "\u0e01": 26, "\u0e21\u0e20\u0e32\u0e1e": 26, "\u0e19\u0e18": 26, "\u0e21": 26, "\u0e19\u0e32\u0e04\u0e21": 26, "\u0e40\u0e21\u0e29\u0e32\u0e22\u0e19": 26, "\u0e1e\u0e24\u0e29\u0e20\u0e32\u0e04\u0e21": 26, "\u0e16": 26, "\u0e19\u0e32\u0e22\u0e19": 26, "\u0e01\u0e23\u0e01\u0e0e\u0e32\u0e04\u0e21": 26, "\u0e2a": 26, "\u0e07\u0e2b\u0e32\u0e04\u0e21": 26, "\u0e19\u0e22\u0e32\u0e22\u0e19": 26, "\u0e15": 26, "\u0e25\u0e32\u0e04\u0e21": 26, "\u0e1e\u0e24\u0e28\u0e08": 26, "\u0e01\u0e32\u0e22\u0e19": 26, "\u0e18": 26, "\u0e19\u0e27\u0e32\u0e04\u0e21": 26, "\u0e27": 26, "\u0e19\u0e2d\u0e32\u0e17": 26, "\u0e15\u0e22": 26, "\u0e19\u0e08": 26, "\u0e19\u0e17\u0e23": 26, "\u0e19\u0e2d": 26, "\u0e07\u0e04\u0e32\u0e23": 26, "\u0e19\u0e1e": 26, "\u0e19\u0e1e\u0e24\u0e2b": 26, "\u0e2a\u0e1a\u0e14": 26, "\u0e19\u0e28": 26, "\u0e01\u0e23": 26, "\u0e19\u0e40\u0e2a\u0e32\u0e23": 26, "\u0e44\u0e15\u0e23\u0e21\u0e32\u0e2a": 26, "\u0e2d\u0e19\u0e40\u0e17": 26, "\u0e22\u0e07": 26, "\u0e2b\u0e25": 26, "\u0e07\u0e40\u0e17": 26, "\u0e1b": 26, "\u0e2d\u0e19\u0e04\u0e23": 26, "\u0e2a\u0e15\u0e01\u0e32\u0e25": 26, "\u0e04\u0e23": 26, "\u0e2a\u0e15": 26, "\u0e28": 26, "\u0e01\u0e23\u0e32\u0e0a": 26, "stycznia": 26, "lutego": 26, "marca": 26, "kwietnia": 26, "maja": 26, "czerwca": 26, "sierpnia": 26, "wrze\u015bnia": [26, 112], "pa\u017adziernika": 26, "listopada": 26, "niedziela": 26, "poniedzia\u0142ek": 26, "wtorek": 26, "\u015broda": 26, "czwartek": 26, "pi\u0105tek": 26, "sobota": 26, "kwarta\u0142": 26, "iii": 26, "iv": 26, "przed": 26, "nasz\u0105": 26, "er\u0105": 26, "naszej": 26, "eri": 26, "stycze\u0144": 26, "luti": 26, "marzec": 26, "kwiecie\u0144": 26, "maj": 26, "czerwiec": 26, "lipiec": 26, "sierpie\u0144": 26, "wrzesie\u0144": 26, "pa\u017adziernik": 26, "listopad": 26, "grudzie\u0144": 26, "jan": [26, 110], "feb": [26, 110], "mar": [26, 110], "apr": [26, 110], "aug": [26, 110], "sept": 26, "oct": [26, 110], "nov": [26, 110], "dec": [26, 110], "mon": 26, "fri": 26, "sat": [26, 56, 98], "q1": 26, "q3": 26, "q4": 26, "bc": [26, 109], "stri_detect_fix": [27, 65, 107, 110], "stri_detect_charclass": 27, "stri_detect_col": [27, 64, 108], "rather": [27, 44, 66, 68, 86, 91, 99, 107], "inspect": 27, "sting": 27, "uninspect": 27, "singleton": 27, "consecut": [27, 46, 58, 76, 104], "alpha": [27, 109], "zc1": 27, "def": [27, 107, 109], "ghi": [27, 109], "456": [27, 37, 52, 56, 76, 83, 93, 98], "789": [27, 37, 52, 76, 83, 85, 89, 90], "jkl": 27, "aa": [28, 46, 106], "aaaa": [28, 46, 76, 113], "aaaaa": 28, "ba": [28, 56, 86, 113], "babababa": 28, "pqrst": 28, "abcabcabcabc": 28, "pqrstpqrst": 28, "unlik": [29, 38, 42, 102, 106, 107], "anydupl": 29, "bytewis": [29, 64, 102, 111], "henc": [29, 85, 91, 102, 106, 107, 108, 109, 110, 113], "significantli": [29, 102], "suit": [29, 102], "counterpart": [29, 102, 108, 109], "found": [29, 40, 44, 46, 58, 107, 109, 113], "gro": [29, 97, 102, 108], "gross": [29, 97, 102, 107, 108, 112, 113], "filter_angle_bracket": 30, "filter": [30, 83, 106], "xml": [30, 37, 98], "markup": 30, "readlin": [30, 73, 87, 88, 111], "fact": [30, 37, 109], "imag": 30, "heurist": [30, 31, 111], "mostli": [30, 113], "limit": [30, 66, 107, 108, 109, 113], "along": 30, "techniqu": 30, "legibl": 30, "interfer": 30, "main": 30, "tabl": [30, 107, 108, 110, 113], "show": 30, "character_set": 30, "16be": [30, 31, 35, 37, 111], "16le": [30, 31, 35, 37, 111], "32be": [30, 31, 35, 37], "32le": [30, 31, 35, 37], "shift_ji": [30, 37], "jp": [30, 37], "kr": [30, 37], "gb18030": [30, 37], "big5": [30, 37], "tradit": [30, 66, 98, 108, 113], "euc": [30, 37], "danish": 30, "dutch": [30, 112], "italian": 30, "norwegian": 30, "portugues": 30, "swedish": 30, "czech": 30, "hungarian": 30, "romanian": 30, "russian": [30, 93, 98], "arab": [30, 37, 93, 98, 112], "turkish": [30, 37, 112], "1250": [30, 36, 37, 109, 111], "1251": [30, 37], "1253": [30, 37], "1254": [30, 37], "1255": [30, 37], "koi8": [30, 37], "ibm420": [30, 37], "ibm424": [30, 37], "guess": [30, 31, 111], "confid": [30, 31, 111], "higher": [30, 31, 109], "decreas": [30, 31, 67, 80], "Not": [30, 46, 57, 62, 76, 89, 94, 109], "rawtochar": [30, 44], "readbin": 30, "100000": [30, 109], "roughli": [31, 42, 77, 91, 103], "csrucod": 31, "greatest": 31, "hit": 31, "vec": [32, 56, 98, 110], "inttoutf8": 32, "dual": [32, 42, 112], "ill": [32, 40, 42, 101, 113], "decod": [32, 97], "arbitrari": [32, 86, 100, 113], "enc": [33, 39], "mime": 33, "utr22": 33, "iana": 33, "unavail": [33, 56, 60, 108], "1to1": 33, "charsiz": 33, "8bit": 33, "min": [33, 72, 109, 110], "max": [33, 85, 109, 110], "uchar": 33, "uchar32": 33, "maxim": [33, 44, 66, 73, 82, 83, 104, 111, 113], "u0104": [34, 36, 50, 53, 62, 95, 97, 109], "stri_enc_isutf16l": 35, "stri_enc_isutf32b": 35, "stri_enc_isutf32l": 35, "sure": [35, 109], "classifi": 35, "proper": 36, "certainli": 36, "c4": [36, 111], "umlaut": 36, "impli": 36, "inde": 36, "u1234": 36, "u0222": 36, "entri": [37, 66, 112], "037": 37, "273": [37, 93, 98], "277": [37, 93, 98], "278": [37, 93, 98], "280": [37, 93, 98], "284": [37, 93, 98], "297": [37, 93, 98], "424": [37, 93, 98], "437": [37, 93, 98], "500": [37, 93, 98], "646": [37, 56, 98], "737": [37, 98], "775": 37, "813": 37, "819": 37, "838": 37, "850": 37, "852": 37, "855": 37, "856": 37, "860": 37, "26": [37, 56, 58, 93, 98, 110], "861": 37, "862": 37, "863": 37, "865": 37, "30": [37, 93, 98, 109, 111, 113], "866": 37, "868": 37, "869": 37, "33": [37, 46, 59, 93, 98, 110], "871": 37, "875": 37, "912": 37, "36": [37, 56, 93, 98, 110, 111], "913": 37, "914": 37, "915": 37, "916": 37, "920": 37, "921": 37, "42": [37, 59, 93, 98], "922": 37, "930": 37, "45": [37, 46, 93, 98, 110, 111], "933": 37, "935": 37, "47": [37, 46, 59, 93, 98, 110, 113], "937": 37, "939": 37, "943": 37, "949": 37, "51": [37, 46, 56, 93, 98, 110], "950": 37, "53": [37, 46, 59, 85, 93, 98], "54": [37, 85, 93, 98, 109, 111], "1006": 37, "1025": 37, "56": [37, 56, 59, 83, 93, 98], "1026": 37, "1047": 37, "1089": 37, "60": [37, 93, 98, 111], "1098": 37, "1112": 37, "62": [37, 59, 93, 98, 111], "1122": 37, "1123": 37, "65": [37, 46, 59, 93, 98, 110, 111], "1383": 37, "66": [37, 56, 93, 98, 110], "5601": 37, "8859_1": 37, "68": [37, 59, 93, 98], "8859_2": 37, "8859_3": 37, "8859_4": 37, "71": [37, 46, 56, 85, 93, 98, 109], "8859_5": 37, "8859_6": 37, "8859_7": 37, "8859_8": 37, "75": [37, 46, 59, 93, 98, 111], "8859_9": 37, "8859_13": 37, "8859_15": 37, "78": [37, 93, 98, 109], "33722": 37, "adob": 37, "80": [37, 69, 93, 98, 110], "ansi_x3": 37, "1968": 37, "81": [37, 46, 56, 93, 98, 111], "1986": 37, "ansi1251": 37, "84": [37, 93, 98, 109], "ascii7": 37, "asmo": 37, "hksc": 37, "89": [37, 46, 85, 93, 98, 109], "unicode3": 37, "90": [37, 93, 98, 109, 110], "big5hk": 37, "bocu": 37, "92": [37, 93, 98, 109], "ccsid00858": 37, "93": [37, 93, 98], "ccsid01140": 37, "ccsid01141": 37, "95": [37, 85, 93, 98], "ccsid01142": 37, "ccsid01143": 37, "ccsid01144": 37, "ccsid01145": 37, "ccsid01146": 37, "ccsid01147": 37, "101": [37, 56, 67, 72, 80, 93, 98], "ccsid01148": 37, "ccsid01149": 37, "cesu": 37, "104": [37, 93, 98, 109], "cns11643": 37, "compound_text": 37, "cp": [37, 109], "gr": 37, "cp037": 37, "cp37": 37, "cp273": 37, "113": [37, 93, 98], "cp277": 37, "cp278": 37, "cp280": 37, "cp284": 37, "cp285": 37, "cp290": 37, "cp297": 37, "cp367": 37, "cp420": 37, "cp424": 37, "cp437": 37, "cp500": 37, "125": [37, 93, 98, 114], "cp737": 37, "cp775": 37, "cp803": 37, "cp813": 37, "cp819": 37, "cp838": 37, "131": [37, 56, 93, 98], "cp850": 37, "cp851": 37, "cp852": 37, "cp855": 37, "cp856": 37, "cp857": 37, "cp00858": 37, "cp858": 37, "cp860": 37, "140": [37, 93, 98, 111], "cp861": 37, "cp862": 37, "cp863": 37, "cp864": 37, "cp865": 37, "cp866": 37, "146": [37, 56, 93, 98], "cp868": 37, "147": [37, 93, 98], "cp869": 37, "cp870": 37, "cp871": 37, "150": [37, 93, 98], "cp874": 37, "cp875": 37, "152": [37, 93, 98], "cp878": 37, "cp912": 37, "cp913": 37, "155": [37, 93, 98], "cp914": 37, "156": [37, 56, 93, 98], "cp915": 37, "cp916": 37, "158": [37, 93, 98], "cp918": 37, "159": [37, 93, 98], "cp920": 37, "cp921": 37, "161": [37, 56, 93, 98], "cp922": 37, "162": [37, 93, 98], "cp923": 37, "cp930": 37, "cp932": 37, "cp933": 37, "cp935": 37, "167": [37, 93, 98], "cp936": 37, "cp937": 37, "cp939": 37, "cp943": 37, "171": [37, 56, 93, 98, 109], "cp943c": 37, "cp949": 37, "173": [37, 93, 98], "cp949c": 37, "cp950": 37, "cp964": 37, "cp970": 37, "cp1006": 37, "cp1025": 37, "179": [37, 93, 98], "cp1026": 37, "cp1047": 37, "cp1089": 37, "182": [37, 93, 98, 109], "cp1097": 37, "cp1098": 37, "cp1112": 37, "185": [37, 93, 98], "cp1122": 37, "186": [37, 56, 93, 98], "cp1123": 37, "cp1124": 37, "cp1125": 37, "cp1131": 37, "cp01140": 37, "191": [37, 56, 93, 98, 110], "cp1140": 37, "192": [37, 93, 98], "cp01141": 37, "cp1141": 37, "194": [37, 93, 98], "cp01142": 37, "195": [37, 93, 98], "cp1142": 37, "cp01143": 37, "197": [37, 93, 98], "cp1143": 37, "198": [37, 93, 98], "cp01144": 37, "cp1144": 37, "200": [37, 93, 98], "cp01145": 37, "201": [37, 56, 93, 98], "cp1145": 37, "cp01146": 37, "203": [37, 93, 98], "cp1146": 37, "204": [37, 93, 98], "cp01147": 37, "cp1147": 37, "206": [37, 56, 93, 98], "cp01148": 37, "cp1148": 37, "cp01149": 37, "209": [37, 93, 98], "cp1149": 37, "cp1200": 37, "cp1201": 37, "212": [37, 93, 98], "cp1208": 37, "213": [37, 93, 98], "cp1250": 37, "cp1251": 37, "215": [37, 93, 98], "cp1252": 37, "cp1253": 37, "cp1254": 37, "218": [37, 93, 98], "cp1255": 37, "cp1256": 37, "cp1257": 37, "221": [37, 56, 93, 98], "cp1258": 37, "222": [37, 93, 98], "cp1363": 37, "cp1383": 37, "224": [37, 93, 98], "cp1386": 37, "225": [37, 93, 98], "cp33722": 37, "cpibm37": 37, "cpibm284": 37, "228": [37, 93, 98, 109], "cpibm285": 37, "cpibm297": 37, "csadobestandardencod": 37, "csascii": 37, "csbig5": 37, "233": [37, 93, 98], "csbocu": 37, "cseuckr": 37, "cseucpkdfmtjapanes": 37, "236": [37, 56, 93, 98], "csgb2312": 37, "237": [37, 93, 98], "cshproman8": 37, "csibm037": 37, "239": [37, 93, 98], "csibm273": 37, "240": [37, 93, 98], "csibm277": 37, "241": [37, 56, 93, 98], "csibm278": 37, "csibm280": 37, "243": [37, 93, 98, 109], "csibm284": 37, "244": [37, 93, 98], "csibm285": 37, "245": [37, 93, 98], "csibm290": 37, "246": [37, 56, 93, 98], "csibm297": 37, "247": [37, 93, 98], "csibm420": 37, "248": [37, 93, 98], "csibm424": 37, "249": [37, 93, 98], "csibm500": 37, "250": [37, 93, 98, 109], "csibm855": 37, "251": [37, 56, 93, 98], "csibm857": 37, "252": [37, 93, 98], "csibm860": 37, "csibm861": 37, "csibm863": 37, "255": [37, 93, 98, 111], "csibm864": 37, "256": [37, 56, 93, 98], "csibm865": 37, "257": [37, 93, 98], "csibm866": 37, "csibm868": 37, "259": [37, 93, 98], "csibm869": 37, "260": [37, 93, 98], "csibm870": 37, "261": [37, 56, 93, 98, 109, 111], "csibm871": 37, "262": [37, 93, 98, 109], "csibm918": 37, "csibm1026": 37, "264": [37, 93, 98], "csibmthai": 37, "265": [37, 93, 98, 109], "csiso58gb231280": 37, "csiso2022cn": 37, "csiso2022jp": 37, "268": [37, 93, 98], "csiso2022jp2": 37, "269": [37, 93, 98], "csiso2022kr": 37, "csisolatin0": 37, "271": [37, 56, 93, 98], "csisolatin1": 37, "272": [37, 93, 98], "csisolatin2": 37, "csisolatin3": 37, "274": [37, 93, 98], "csisolatin4": 37, "275": [37, 93, 98], "csisolatin5": 37, "276": [37, 56, 93, 98], "csisolatin6": 37, "csisolatin9": 37, "csisolatinarab": 37, "279": [37, 93, 98, 110], "csisolatincyril": 37, "csisolatingreek": 37, "281": [37, 56, 93, 98], "csisolatinhebrew": 37, "282": [37, 93, 98], "csjisencod": 37, "283": [37, 93, 98], "cskoi8r": 37, "csksc56011987": 37, "csmacintosh": 37, "286": [37, 56, 93, 98], "cspc8codepage437": 37, "287": [37, 93, 98], "cspc775baltic": 37, "cspc850multilingu": 37, "cspc851": 37, "290": [37, 93, 98], "cspc862latinhebrew": 37, "291": [37, 56, 93, 98], "cspcp852": 37, "292": [37, 93, 98], "cspcp855": 37, "293": [37, 93, 98], "csshiftji": 37, "294": [37, 93, 98], "csucs4": 37, "295": [37, 93, 98], "csunicod": 37, "cswindows31j": 37, "298": [37, 93, 98], "720": [37, 98], "299": [37, 93, 98], "300": [37, 93, 98], "ebcdic": 37, "301": [37, 56, 93, 98], "ar1": 37, "302": [37, 93, 98], "ar2": 37, "303": [37, 93, 98], "304": [37, 93, 98], "ca": [37, 56, 69, 114], "305": [37, 93, 98], "306": [37, 56, 93, 98], "dk": 37, "307": [37, 93, 98], "308": [37, 93, 98], "fi": [37, 56], "309": [37, 93, 98], "310": [37, 93, 98], "gb": [37, 44, 73, 93], "311": [37, 56, 93, 98], "he": [37, 56, 98], "312": [37, 93, 98], "313": [37, 93, 98], "315": [37, 93, 98], "NO": [37, 95], "316": [37, 56, 93, 98], "roec": 37, "se": [37, 56, 93, 107], "wt": 37, "320": [37, 93, 98], "yu": 37, "321": [37, 56, 79, 93, 98], "322": [37, 93, 98], "323": [37, 93, 98, 114], "324": [37, 93, 98], "326": [37, 56, 93, 98], "327": [37, 93, 98], "328": [37, 93, 98, 114], "329": [37, 93, 98], "330": [37, 93, 98, 109], "331": [37, 56, 93, 98], "332": [37, 93, 98], "333": [37, 93, 98], "kana": [37, 63, 98, 112], "336": [37, 56, 93, 98], "sv": [37, 56], "339": [37, 93, 98], "340": [37, 93, 98], "ecma": 37, "342": [37, 93, 98, 109], "elot_928": 37, "346": [37, 56, 93, 98, 114], "2007": 37, "349": [37, 93, 98], "tw": 37, "350": [37, 93, 98, 114], "351": [37, 56, 93, 98], "eucji": 37, "352": [37, 93, 98], "eucth": 37, "353": [37, 93, 98], "extended_unix_code_packed_format_for_japanes": 37, "gb_2312": 37, "gb2312": 37, "356": [37, 56, 93, 98], "1980": 37, "357": [37, 93, 98], "358": [37, 93, 98], "359": [37, 93, 98], "360": [37, 93, 98], "gbk": 37, "361": [37, 56, 93, 98], "greek8": 37, "gsm": 37, "2009": 37, "gsm0338": 37, "365": [37, 93, 98, 110], "hebrew8": 37, "367": [37, 93, 98], "hkbig5": 37, "368": [37, 93, 98], "hp": 37, "roman8": 37, "hp15cn": 37, "371": [37, 56, 93, 98], "hz": 37, "2312": 37, "373": [37, 93, 98], "374": [37, 93, 98], "375": [37, 93, 98], "37_p100": 37, "1995": 37, "376": [37, 56, 93, 98], "swaplfnl": 37, "377": [37, 93, 98], "s390": 37, "378": [37, 93, 98], "379": [37, 93, 98], "273_p100": 37, "380": [37, 93, 98], "381": [37, 56, 93, 98], "277_p100": 37, "383": [37, 93, 98], "278_p100": 37, "384": [37, 93, 98], "385": [37, 93, 98], "280_p100": 37, "387": [37, 93, 98], "284_p100": 37, "388": [37, 93, 98], "389": [37, 85, 93, 98], "285_p100": 37, "390": [37, 93, 98], "391": [37, 56, 93, 98], "290_p100": 37, "392": [37, 93, 98], "297_p100": 37, "394": [37, 93, 98], "395": [37, 93, 98], "396": [37, 56, 93, 98], "420_x120": 37, "424_p100": 37, "437_p100": 37, "402": [37, 93, 98], "500_p100": 37, "403": [37, 93, 98], "404": [37, 93, 98], "720_p100": 37, "1997": 37, "405": [37, 93, 98], "406": [37, 56, 93, 98], "737_p100": 37, "407": [37, 93, 98], "775_p100": 37, "409": [37, 93, 98], "803": 37, "410": [37, 93, 98, 109], "803_p100": 37, "411": [37, 56, 93, 98], "412": [37, 93, 98], "813_p100": 37, "413": [37, 93, 98], "838_p100": 37, "416": [37, 56, 93, 98], "417": [37, 93, 98], "850_p100": 37, "418": [37, 93, 98], "419": [37, 93, 98], "851_p100": 37, "852_p100": 37, "422": [37, 93, 98], "423": [37, 93, 98], "855_p100": 37, "856_p100": 37, "426": [37, 56, 93, 98], "427": [37, 93, 98], "857_p100": 37, "858": 37, "858_p100": 37, "430": [37, 93, 98], "860_p100": 37, "432": [37, 93, 98], "433": [37, 93, 98], "861_p100": 37, "435": [37, 93, 98], "862_p100": 37, "436": [37, 56, 93, 98], "863_p100": 37, "864": 37, "439": [37, 93, 98], "864_x110": 37, "440": [37, 93, 98], "441": [37, 56, 93, 98], "865_p100": 37, "442": [37, 93, 98], "443": [37, 93, 98], "866_p100": 37, "444": [37, 93, 98], "867": 37, "445": [37, 93, 98], "867_p100": 37, "1998": 37, "446": [37, 56, 93, 98], "447": [37, 93, 98], "868_p100": 37, "448": [37, 93, 98], "869_p100": 37, "450": [37, 93, 98], "870": [37, 85], "451": [37, 56, 93, 98], "870_p100": 37, "452": [37, 93, 98], "453": [37, 93, 98], "871_p100": 37, "454": [37, 93, 98], "874": 37, "455": [37, 93, 98], "874_p100": 37, "875_p100": 37, "878": 37, "459": [37, 93, 98], "878_p100": 37, "460": [37, 93, 98], "461": [37, 56, 93, 98], "901_p100": 37, "902": 37, "902_p100": 37, "464": [37, 93, 98], "465": [37, 93, 98], "912_p100": 37, "466": [37, 56, 93, 98], "913_p100": 37, "2000": 37, "468": [37, 93, 98], "914_p100": 37, "470": [37, 93, 98], "471": [37, 56, 93, 98], "915_p100": 37, "472": [37, 93, 98], "916_p100": 37, "474": [37, 93, 98], "918": 37, "475": [37, 93, 98], "918_p100": 37, "477": [37, 93, 98], "920_p100": 37, "478": [37, 93, 98], "479": [37, 93, 98], "921_p100": 37, "481": [37, 56, 93, 98], "922_p100": 37, "482": [37, 93, 98], "483": [37, 93, 98], "923_p100": 37, "484": [37, 93, 98], "485": [37, 93, 98], "930_p120": 37, "486": [37, 56, 93, 98], "932": 37, "488": [37, 93, 98], "932_vsub_vpua": 37, "489": [37, 93, 98], "490": [37, 93, 98, 109], "933_p110": 37, "491": [37, 56, 93, 98], "492": [37, 93, 98], "935_p110": 37, "493": [37, 93, 98], "494": [37, 93, 98], "937_p110": 37, "495": [37, 93, 98], "496": [37, 56, 93, 98], "939_p120": 37, "497": [37, 93, 98], "942": 37, "498": [37, 93, 98], "942_p12a": 37, "499": [37, 93, 98], "942_vsub_vpua": 37, "943_p15a": 37, "2003": 37, "943_p130": 37, "503": [37, 93, 98], "943_vascii_vsub_vpua": 37, "504": [37, 93, 98], "943_vsub_vpua": 37, "505": [37, 93, 98], "943c": 37, "506": [37, 56, 93, 98], "507": [37, 93, 98], "949_p11a": 37, "949_p110": 37, "509": [37, 93, 98], "949_vascii_vsub_vpua": 37, "510": [37, 93, 98], "949_vsub_vpua": 37, "511": [37, 56, 93, 98], "949c": 37, "512": [37, 93, 98], "513": [37, 93, 98], "950_p110": 37, "514": [37, 93, 98], "954": 37, "515": [37, 93, 98], "954_p101": 37, "516": [37, 56, 93, 98], "517": [37, 93, 98, 109], "964_p110": 37, "518": [37, 93, 98], "964_vpua": 37, "519": [37, 93, 98], "520": [37, 93, 98], "970_p110_p110": 37, "2006_u2": 37, "521": [37, 56, 93, 98], "970_vpua": 37, "522": [37, 93, 98], "971": 37, "523": [37, 93, 98], "971_p100": 37, "524": [37, 93, 98], "971_vpua": 37, "525": [37, 93, 98], "526": [37, 56, 93, 98], "1006_p100": 37, "527": [37, 93, 98], "528": [37, 93, 98], "1025_p100": 37, "529": [37, 93, 98], "530": [37, 93, 98], "1026_p100": 37, "531": [37, 56, 93, 98], "532": [37, 93, 98], "1047_p100": 37, "533": [37, 93, 98], "534": [37, 93, 98], "535": [37, 93, 98], "1051": 37, "536": [37, 56, 93, 98], "1051_p100": 37, "537": [37, 93, 98], "538": [37, 93, 98], "1089_p100": 37, "539": [37, 93, 98], "540": [37, 93, 98], "1097_p100": 37, "541": [37, 56, 93, 98], "542": [37, 93, 98], "1098_p100": 37, "543": [37, 93, 98], "544": [37, 93, 98], "1112_p100": 37, "545": [37, 93, 98], "546": [37, 56, 93, 98], "1122_p100": 37, "547": [37, 93, 98], "548": [37, 93, 98], "1123_p100": 37, "549": [37, 93, 98], "550": [37, 93, 98], "1124_p100": 37, "551": [37, 56, 93, 98], "1125": 37, "552": [37, 93, 98], "1125_p100": 37, "553": [37, 93, 98], "1129": 37, "554": [37, 93, 98], "1129_p100": 37, "555": [37, 93, 98], "1130": 37, "556": [37, 56, 93, 98], "1130_p100": 37, "557": [37, 93, 98], "558": [37, 93, 98], "1131_p100": 37, "559": [37, 93, 98], "560": [37, 93, 98], "1132_p100": 37, "561": [37, 56, 93, 98, 109], "1133": 37, "562": [37, 93, 98], "1133_p100": 37, "563": [37, 93, 98], "1137": 37, "564": [37, 93, 98], "1137_p100": 37, "565": [37, 93, 98], "1140": 37, "566": [37, 56, 93, 98], "1140_p100": 37, "567": [37, 93, 98], "568": [37, 93, 98], "569": [37, 93, 98], "570": [37, 93, 98], "1141_p100": 37, "571": [37, 56, 93, 98], "572": [37, 93, 98], "573": [37, 93, 98], "574": [37, 93, 98], "1142_p100": 37, "575": [37, 93, 98], "576": [37, 56, 93, 98], "577": [37, 93, 98], "1143": 37, "578": [37, 93, 98], "1143_p100": 37, "579": [37, 93, 98], "580": [37, 93, 98], "581": [37, 56, 93, 98], "582": [37, 93, 98], "1144_p100": 37, "583": [37, 93, 98], "584": [37, 93, 98], "585": [37, 93, 98], "586": [37, 56, 93, 98], "1145_p100": 37, "587": [37, 93, 98, 109], "588": [37, 93, 98], "589": [37, 93, 98], "1146": 37, "590": [37, 93, 98], "1146_p100": 37, "591": [37, 56, 93, 98], "592": [37, 93, 98], "593": [37, 93, 98], "1147": 37, "594": [37, 93, 98], "1147_p100": 37, "595": [37, 93, 98], "596": [37, 56, 93, 98], "597": [37, 93, 98], "1148": 37, "598": [37, 93, 98], "1148_p100": 37, "599": [37, 93, 98], "600": [37, 93, 98, 110], "601": [37, 56, 93, 98], "1149": 37, "602": [37, 93, 98], "1149_p100": 37, "603": [37, 93, 98], "604": [37, 93, 98], "605": [37, 93, 98], "1153": 37, "606": [37, 56, 93, 98], "1153_p100": 37, "607": [37, 93, 98], "608": [37, 93, 98, 109], "609": [37, 93, 98], "610": [37, 93, 98], "1154_p100": 37, "611": [37, 56, 93, 98], "1155": 37, "612": [37, 93, 98], "1155_p100": 37, "613": [37, 93, 98], "614": [37, 93, 98], "1156_p100": 37, "615": [37, 93, 98], "1157": 37, "616": [37, 56, 93, 98], "1157_p100": 37, "617": [37, 93, 98], "1158": 37, "618": [37, 93, 98], "1158_p100": 37, "619": [37, 93, 98], "620": [37, 93, 98], "1160_p100": 37, "621": [37, 56, 93, 98], "1162": [37, 109], "622": [37, 93, 98], "1162_p100": 37, "623": [37, 93, 98], "1164": 37, "624": [37, 93, 98], "1164_p100": 37, "625": [37, 93, 98], "1168": 37, "626": [37, 56, 93, 98], "1168_p100": 37, "627": [37, 93, 98], "1200": 37, "628": [37, 93, 98], "629": [37, 93, 98, 113], "1202": 37, "630": [37, 93, 98, 108], "1203": 37, "631": [37, 56, 93, 98, 109], "632": [37, 93, 98], "1205": 37, "633": [37, 93, 98], "1208": 37, "634": [37, 93, 98], "1209": 37, "635": [37, 93, 98], "1212": 37, "636": [37, 56, 93, 98], "637": [37, 93, 98], "1214": 37, "638": [37, 98], "1215": 37, "640": [37, 98], "641": [37, 56, 98], "642": [37, 98], "643": [37, 98], "1236": 37, "644": [37, 98], "1237": 37, "1250_p100": 37, "647": [37, 98], "648": [37, 98], "1251_p100": 37, "649": [37, 98], "1252_p100": 37, "651": [37, 56, 98], "652": [37, 98], "1253_p100": 37, "653": [37, 98], "654": [37, 98], "1254_p100": 37, "655": [37, 98], "656": [37, 56, 98], "1255_p100": 37, "657": [37, 98], "658": [37, 98], "1256_p110": 37, "659": [37, 98], "660": [37, 98], "1257_p100": 37, "661": [37, 56, 98], "1258": 37, "662": [37, 98], "1258_p100": 37, "663": [37, 98], "1276": 37, "664": [37, 98], "1276_p100": 37, "665": [37, 98], "1363": 37, "666": [37, 56, 98], "1363_p11b": 37, "667": [37, 89, 90, 98], "1363_p110": 37, "668": [37, 98], "1363_vascii_vsub_vpua": 37, "669": [37, 98], "1363_vsub_vpua": 37, "670": [37, 98], "1364": 37, "1364_p110": 37, "1371": 37, "673": [37, 98], "1371_p100": 37, "674": [37, 98], "1373": 37, "675": [37, 98], "1373_p100": 37, "676": [37, 56, 98], "677": [37, 98], "1375_p100": 37, "2008": [37, 114], "678": [37, 98, 113], "679": [37, 98], "1383_p110": 37, "680": [37, 98], "1383_vpua": 37, "681": [37, 56, 98, 109], "1386": 37, "682": [37, 98], "1386_p100": 37, "683": [37, 98], "1386_vsub_vpua": 37, "684": [37, 98], "1388": 37, "685": [37, 98], "1388_p103": 37, "687": [37, 98], "1390_p110": 37, "688": [37, 98, 109], "689": [37, 98], "1399": 37, "690": [37, 98], "1399_p110": 37, "691": [37, 56, 98], "4517": 37, "692": [37, 98], "4517_p100": 37, "2005": 37, "693": [37, 98], "4899": 37, "694": [37, 98], "4899_p100": 37, "695": [37, 98], "4902": 37, "696": [37, 56, 98], "4909": 37, "697": [37, 98], "4909_p100": 37, "698": [37, 98], "4971": 37, "699": [37, 98], "4971_p100": 37, "700": [37, 98], "5012": 37, "5012_p100": 37, "702": [37, 98], "5026": 37, "703": [37, 98], "5035": 37, "5050": 37, "705": [37, 98], "5054": 37, "706": [37, 56, 98], "5123": 37, "707": [37, 98], "5123_p100": 37, "5304": 37, "709": [37, 98], "5305": 37, "710": [37, 98], "5346": 37, "711": [37, 56, 98], "5346_p100": 37, "712": [37, 98], "5347": 37, "713": [37, 98], "5347_p100": 37, "714": [37, 98], "5348": 37, "5348_p100": 37, "716": [37, 56, 98], "5349": 37, "5349_p100": 37, "718": [37, 85, 98], "5350": 37, "719": [37, 98], "5350_p100": 37, "5351": 37, "721": [37, 56, 98], "5351_p100": 37, "722": [37, 98], "5352": 37, "723": [37, 98], "5352_p100": 37, "5353": 37, "725": [37, 98], "5353_p100": 37, "726": [37, 56, 98], "5354": 37, "727": [37, 98], "5354_p100": 37, "728": [37, 98], "5471": 37, "5471_p100": 37, "2006": [37, 114], "730": [37, 98], "5478": 37, "731": [37, 56, 98], "5478_p100": 37, "732": [37, 98], "8482": 37, "733": [37, 98], "8482_p100": 37, "734": [37, 98], "9005": 37, "735": [37, 98], "9005_x110": 37, "736": [37, 56, 98], "9030": 37, "9066": 37, "738": [37, 98], "9067": 37, "739": [37, 98], "9067_x100": 37, "740": [37, 98], "9400": 37, "741": [37, 56, 98], "9424": 37, "742": [37, 98], "9447": 37, "743": [37, 98], "9447_p100": 37, "744": [37, 98], "9448": 37, "745": [37, 98], "9448_x100": 37, "746": [37, 56, 98], "9449": 37, "747": [37, 98], "9449_p100": 37, "748": [37, 98], "9580": 37, "12712": 37, "750": [37, 98], "12712_p100": 37, "751": [37, 56, 98], "752": [37, 98], "753": [37, 98], "13488": 37, "754": [37, 98], "13489": 37, "755": [37, 98], "13490": 37, "756": [37, 56, 98], "13491": 37, "13496": 37, "758": 37, "13497": 37, "759": 37, "16684": 37, "760": 37, "16684_p110": 37, "761": [37, 56], "16804": 37, "762": 37, "16804_x110": 37, "763": 37, "764": 37, "17584": 37, "766": [37, 56], "17585": 37, "17586": 37, "768": 37, "17587": 37, "769": 37, "17592": 37, "17593": 37, "771": [37, 56], "20780": 37, "772": 37, "21680": 37, "773": 37, "21681": 37, "774": 37, "21682": 37, "21683": 37, "776": [37, 56], "25546": 37, "777": 37, "25776": 37, "778": 37, "25777": 37, "779": 37, "25778": 37, "25779": 37, "29872": 37, "29873": 37, "783": 37, "29874": 37, "784": [37, 108], "29875": 37, "785": 37, "786": [37, 56], "33722_p12a_p12a": 37, "2009_u2": 37, "787": 37, "33722_p120": 37, "788": 37, "33722_vascii_vpua": 37, "33722_vpua": 37, "790": 37, "61955": 37, "791": [37, 56], "61956": 37, "792": 37, "65025": 37, "793": 37, "euccn": 37, "794": 37, "eucjp": 37, "795": 37, "euckr": 37, "796": [37, 56], "euctw": 37, "797": 37, "thai": [37, 98], "798": [37, 111], "ibm037": 37, "799": 37, "ibm273": 37, "800": 37, "ibm277": 37, "801": [37, 56], "ibm278": 37, "802": 37, "ibm280": 37, "ibm284": 37, "804": 37, "ibm285": 37, "805": 37, "ibm290": 37, "ibm297": 37, "807": 37, "ibm367": 37, "808": [37, 111], "809": 37, "ibm437": 37, "811": [37, 56], "ibm500": 37, "812": 37, "ibm737": 37, "ibm775": 37, "ibm819": 37, "815": 37, "ibm838": 37, "816": [37, 56], "ibm850": 37, "817": 37, "ibm851": 37, "818": [37, 109], "ibm852": 37, "ibm855": 37, "820": 37, "ibm856": 37, "821": [37, 56], "ibm857": 37, "ibm00858": 37, "823": 37, "ibm860": 37, "ibm861": 37, "825": 37, "ibm862": 37, "826": [37, 56], "ibm863": 37, "827": 37, "ibm864": 37, "828": 37, "ibm865": 37, "829": 37, "ibm866": 37, "830": 37, "ibm868": 37, "831": [37, 56], "ibm869": 37, "832": 37, "ibm870": 37, "833": 37, "ibm871": 37, "ibm875": 37, "835": 37, "ibm918": 37, "836": [37, 56], "ibm922": 37, "837": 37, "ibm930": 37, "ibm939": 37, "839": 37, "ibm1006": 37, "840": 37, "ibm1026": 37, "841": [37, 56], "ibm1047": 37, "842": 37, "ibm1047_lf": 37, "843": 37, "ibm1098": 37, "844": 37, "ibm01140": 37, "845": 37, "ibm01141": 37, "846": [37, 56], "ibm1141_lf": 37, "847": 37, "ibm01142": 37, "ibm01143": 37, "849": 37, "ibm01144": 37, "ibm01145": 37, "ibm01146": 37, "ibm01147": 37, "853": 37, "ibm01148": 37, "ibm01149": 37, "ibm1153": 37, "imap": 37, "mailbox": 37, "iscii": 37, "bng": 37, "guj": 37, "gur": 37, "knd": 37, "mlm": 37, "ori": 37, "tlg": 37, "tml": 37, "872": 37, "873": 37, "iso_646": 37, "irv": 37, "1983": 37, "876": 37, "1991": [37, 110], "iso_2022": 37, "ja": [37, 56, 98], "879": 37, "880": 37, "881": 37, "882": 37, "ko": [37, 56, 98], "883": 37, "884": 37, "zh": [37, 56, 98, 108], "886": 37, "887": 37, "iso_8859": 37, "1987": 37, "888": 37, "1988": 37, "890": 37, "891": 37, "892": 37, "893": 37, "894": 37, "895": 37, "1989": 37, "896": 37, "1992": [37, 113], "897": 37, "899": 37, "900": 37, "ext": 37, "903": 37, "904": 37, "905": 37, "8859_10": 37, "906": 37, "8859_11": 37, "907": 37, "8859_14": 37, "908": 37, "909": 37, "910": 37, "911": 37, "917": 37, "919": 37, "924": 37, "925": 37, "926": 37, "uc": [37, 103], "927": 37, "928": 37, "celtic": 37, "929": 37, "ir": 37, "934": 37, "936": 37, "940": 37, "941": 37, "iso646": 37, "944": 37, "iso8859_15_fdi": 37, "945": 37, "ji": 37, "946": 37, "jis_encod": 37, "jis7": 37, "948": 37, "jis8": 37, "951": 37, "952": 37, "953": 37, "ks_c_5601": 37, "955": 37, "ksc": 37, "956": 37, "ksc_5601": 37, "l1": 37, "958": 37, "l2": 37, "959": 37, "l3": 37, "960": [37, 109], "l4": 37, "l5": 37, "962": 37, "l6": 37, "963": 37, "l8": 37, "l9": 37, "965": 37, "966": 37, "latin0": 37, "967": 37, "latin2": 37, "969": 37, "latin3": 37, "latin4": 37, "latin5": 37, "972": 37, "latin6": 37, "latin8": 37, "974": 37, "lmbc": 37, "975": 37, "mac": 37, "977": 37, "macc": 37, "979": 37, "maccentraleurop": 37, "980": 37, "macci": 37, "981": 37, "macgr": 37, "982": 37, "macintosh": 37, "0_2": 37, "984": 37, "6_2": 37, "7_3": 37, "986": 37, "988": 37, "macroman": 37, "mactr": 37, "ms_kanji": 37, "991": 37, "ms874": 37, "992": 37, "ms932": 37, "993": 37, "ms936": 37, "994": 37, "ms949": 37, "ms950": 37, "996": 37, "ms950_hksc": 37, "997": 37, "multilingu": 37, "998": 37, "pck": 37, "r8": 37, "1000": [37, 109, 113], "1001": 37, "scsu": 37, "1002": 37, "1003": 37, "shift_jis78": 37, "sji": 37, "1005": 37, "sjis78": 37, "sun_eu_greek": 37, "1007": 37, "thai8": 37, "1008": 37, "ti": [37, 56, 72, 108], "1009": 37, "tis620": 37, "2533": 37, "1010": 37, "1011": 37, "turkish8": 37, "1013": 37, "1014": 37, "uji": 37, "1015": 37, "1016": 37, "1018": 37, "1019": 37, "1020": 37, "unicodebig": 37, "unicodebigunmark": 37, "1022": 37, "unicodelittl": 37, "1023": 37, "unicodelittleunmark": 37, "1027": 37, "1029": 37, "1030": 37, "1031": 37, "1032": 37, "1033": 37, "1034": 37, "1035": 37, "1036": 37, "1038": 37, "utf16_bigendian": 37, "1039": 37, "utf16_littleendian": 37, "utf16_oppositeendian": 37, "1041": 37, "utf16_platformendian": 37, "1042": 37, "utf32_bigendian": 37, "1043": 37, "utf32_littleendian": 37, "utf32_oppositeendian": 37, "1045": 37, "utf32_platformendian": 37, "31j": 37, "1048": 37, "1049": 37, "1050": 37, "1052": 37, "1054": 37, "1055": 37, "1056": 37, "1057": 37, "1059": 37, "1060": 37, "1061": 37, "1062": 37, "1063": 37, "1064": 37, "1066": 37, "1067": 37, "1068": 37, "1070": 37, "1071": 37, "1072": 37, "1073": 37, "1075": 37, "1076": 37, "1078": 37, "1079": 37, "1080": 37, "10000": 37, "10006": 37, "1082": 37, "10007": 37, "1083": 37, "10029": 37, "10081": 37, "1085": 37, "20127": 37, "1086": 37, "20866": 37, "21866": 37, "1088": 37, "28592": 37, "28593": 37, "1090": 37, "28594": 37, "1091": 37, "28595": 37, "1092": 37, "28596": 37, "1093": 37, "28597": 37, "28598": 37, "1095": 37, "28599": 37, "28603": 37, "28605": 37, "51949": 37, "54936": 37, "1100": 37, "57002": 37, "1101": 37, "57003": 37, "1102": 37, "57004": 37, "1103": 37, "57005": 37, "57006": 37, "1105": 37, "57007": 37, "57008": 37, "1107": 37, "57009": 37, "57010": 37, "1109": 37, "57011": 37, "65000": 37, "1111": 37, "65001": 37, "compound": [37, 97], "1114": 37, "1115": 37, "ibm720": 37, "1116": 37, "1117": 37, "ibm867": 37, "1119": [37, 104, 114], "ibm874": 37, "1121": 37, "ibm921": 37, "ibm930a": 37, "ibm933": 37, "ibm935": 37, "1127": 37, "ibm937": 37, "1128": 37, "ibm939a": 37, "ibm942": 37, "ibm942c": 37, "ibm943": 37, "ibm949": 37, "1134": 37, "ibm949c": 37, "ibm950": 37, "1136": 37, "ibm954": 37, "ibm954c": 37, "1138": 37, "ibm964": 37, "1139": 37, "ibm970": 37, "ibm971": 37, "ibm1025": 37, "ibm1097": 37, "ibm1112": 37, "ibm1122": 37, "ibm1123": 37, "ibm1124": 37, "1150": 37, "ibm1363": 37, "ibm1363c": 37, "1152": 37, "ibm1364": 37, "ibm1371": 37, "ibm1388": 37, "ibm1390": 37, "ibm1399": 37, "ibm33722": 37, "ibm33722a": 37, "ibm33722c": 37, "gu": [37, 56], "ka": [37, 56, 98], "ma": [37, 56, 108], "1167": 37, "pa": [37, 56], "ta": [37, 56, 98], "te": [37, 56], "1170": 37, "iscii91": 37, "1172": 37, "1173": 37, "1174": 37, "jisautodetect": 37, "1176": 37, "ksc5601": 37, "ce": [37, 56], "1178": 37, "centraleurroman": 37, "1179": 37, "1180": 37, "1183": 37, "maccyril": 37, "macgreek": 37, "1186": 37, "macturkish": 37, "1187": 37, "macukrain": 37, "1188": 37, "1189": 37, "ms932_0213": 37, "1191": 37, "1192": 37, "1193": 37, "utf_8j": 37, "1194": 37, "1195": 37, "1196": 37, "1197": 37, "1198": 37, "50220": 37, "50221": 37, "iso2022jp": 37, "x11": 37, "undesir": 39, "expert": 39, "situat": [39, 108], "old": 39, "neither": [39, 43, 108, 113], "effect": [39, 57, 85, 93, 108, 113], "charset": [39, 49], "invisibli": [39, 57, 94], "0x1a": 40, "itself": [40, 93, 111, 113], "x1a": [40, 106], "032": 40, "utf8toint": 42, "enc2utf8": [42, 43], "unchang": [43, 76, 89, 90, 107], "ufffd": [43, 44], "bogu": 43, "serv": [44, 84, 107, 113], "own": [44, 109, 112], "iconv": [44, 109, 111], "to_raw": [44, 111], "stri_conv": 44, "encodingnam": 44, "erron": 44, "001a": 44, "fffd": 44, "thereof": [44, 107, 113], "problemat": [44, 110, 112], "stri_locate_all_regex": [44, 58, 90, 109, 113], "converted_str": 44, "u001a": 44, "exce": [44, 73], "printabl": 45, "uxxxx": [45, 101], "uxxxxxxxx": [45, 101], "stri_extract_first_": [46, 47], "stri_extract_last_": [46, 47], "stri_extract_first": [46, 89, 107], "stri_extract_last": [46, 89, 107], "mode": [46, 58, 60, 66, 73, 74, 76, 104, 105, 113], "stri_extract_first_charclass": 46, "stri_extract_last_charclass": 46, "stri_extract_all_col": 46, "stri_extract_first_col": 46, "stri_extract_last_col": 46, "stri_extract_first_regex": [46, 109, 113], "stri_extract_last_regex": 46, "stri_extract_first_fix": [46, 107], "stri_extract_last_fix": 46, "_": [46, 55, 58, 76, 82, 96, 106, 113], "scenario": [46, 58, 60, 90, 107, 109], "skip": [46, 58, 76, 110], "xaaaax": 46, "bartolini": 46, "abcdefghijk": 46, "bcde": 46, "ij": [46, 106], "aabbcc": 46, "55200": 46, "0123456789": [46, 70], "\u2139": 46, "aaaaaaaa": 46, "\u00fd": 46, "abababa": [46, 58], "aba": [46, 58, 109], "agaga": [46, 76], "aga": [46, 58, 60, 76, 107], "stri_extract_last_boundari": 47, "stri_extract_first_boundari": 47, "_word": [47, 59], "whatsoev": [48, 109], "abcdefghijklmnopqrstuvwxyz": 48, "abbcccdeefff": 48, "concis": [49, 113], "fastest": 50, "term": [51, 93, 109], "longest": [51, 54, 106], "confus": 51, "ordinari": [51, 64], "1a": 51, "2b": 51, "3c": 51, "4d": [51, 111], "5e": 51, "6f": 51, "7g": 51, "8h": 51, "9i": 51, "10j": 51, "11k": 51, "12l": 51, "13m": 51, "1n": 51, "2o": 51, "3p": 51, "4q": 51, "5r": 51, "7t": 51, "8u": 51, "9v": 51, "10w": 51, "11x": 51, "12y": 51, "13z": 51, "xyz": 51, "stri_c_list": 52, "stri_paste_list": 52, "sausag": [52, 106, 113], "method": [53, 94, 104], "by_row": [54, 106], "transpos": [54, 109], "simplify2arrai": [54, 106], "transposit": 54, "unsupport": 55, "anyth": [55, 89], "complic": [55, 107], "3l": [55, 64], "insight": 55, "underscor": [55, 109], "af": 56, "af_na": 56, "af_za": 56, "agq": 56, "agq_cm": 56, "ak": 56, "ak_gh": 56, "am_et": 56, "ar_001": 56, "ar_a": 56, "ar_bh": 56, "ar_dj": 56, "ar_dz": 56, "ar_eg": 56, "ar_eh": 56, "ar_er": 56, "ar_il": 56, "ar_iq": 56, "ar_jo": 56, "ar_km": 56, "ar_kw": 56, "ar_lb": 56, "ar_li": 56, "ar_ma": 56, "ar_mr": 56, "ar_om": 56, "ar_p": 56, "ar_qa": 56, "ar_sa": 56, "ar_sd": 56, "ar_so": 56, "ar_ss": 56, "ar_si": 56, "ar_td": 56, "ar_tn": 56, "ar_y": 56, "as_in": 56, "asa": 56, "asa_tz": 56, "ast": [56, 93, 114], "ast_": 56, "az": [56, 98], "az_cyrl": [56, 98], "az_cyrl_az": 56, "az_latn": 56, "az_latn_az": 56, "bas_cm": 56, "be_bi": 56, "bem": 56, "bem_zm": 56, "bez": 56, "bez_tz": 56, "bg": [56, 98], "bg_bg": 56, "bgc": 56, "bgc_in": 56, "bho": 56, "bho_in": 56, "blo": 56, "blo_bj": 56, "bm": 56, "bm_ml": 56, "bn": 56, "bn_bd": 56, "bn_in": 56, "bo": 56, "bo_cn": 56, "bo_in": 56, "br": 56, "br_fr": 56, "brx": 56, "brx_in": 56, "bs_cyrl": 56, "bs_cyrl_ba": 56, "bs_latn": 56, "bs_latn_ba": 56, "ca_ad": 56, "ca_e": 56, "ca_fr": 56, "ca_it": 56, "ccp": 56, "ccp_bd": 56, "ccp_in": 56, "ce_ru": 56, "ceb": 56, "ceb_ph": 56, "cgg": 56, "cgg_ug": 56, "chr": [56, 98, 110], "chr_u": 56, "ckb": 56, "ckb_iq": 56, "ckb_ir": 56, "cs_cz": 56, "csw": 56, "csw_ca": 56, "cv": 56, "cv_ru": 56, "cy": [56, 98], "cy_gb": 56, "da": 56, "da_dk": 56, "da_gl": 56, "dav": 56, "dav_k": 56, "de_at": [56, 108], "de_b": 56, "de_ch": 56, "de_it": 56, "de_li": 56, "de_lu": 56, "dje": 56, "dje_n": 56, "doi_in": 56, "dsb": [56, 98], "dsb_de": 56, "dua": 56, "dua_cm": 56, "dyo": 56, "dyo_sn": 56, "dz": 56, "dz_bt": 56, "ebu": 56, "ebu_k": 56, "ee_gh": 56, "ee_tg": 56, "el_ci": 56, "el_gr": 56, "en_001": 56, "en_150": 56, "en_a": 56, "en_ag": 56, "en_ai": 56, "en_at": 56, "en_bb": 56, "en_b": 56, "en_bi": 56, "en_bm": 56, "en_bw": 56, "en_bz": 56, "en_ca": 56, "en_cc": 56, "en_ch": 56, "en_ck": 56, "en_cm": 56, "en_cx": 56, "en_ci": 56, "en_d": 56, "en_dg": 56, "en_dk": 56, "en_dm": 56, "en_er": 56, "en_fi": 56, "en_fj": 56, "en_fk": 56, "en_fm": 56, "en_gb": 56, "en_gd": 56, "en_gg": 56, "en_gh": 56, "en_gi": 56, "en_gm": 56, "en_gu": 56, "en_hk": [56, 108], "en_id": 56, "en_i": 56, "en_il": 56, "en_im": 56, "en_in": 56, "en_io": 56, "en_j": 56, "en_jm": 56, "en_k": 56, "en_ki": 56, "en_kn": 56, "en_lc": 56, "en_lr": 56, "en_l": 56, "en_mg": 56, "en_mh": 56, "en_mo": 56, "en_mp": 56, "en_m": 56, "en_mt": 56, "en_mu": 56, "en_mv": 56, "en_mw": 56, "en_mi": 56, "en_na": 56, "en_nf": 56, "en_ng": 56, "en_nl": 56, "en_nr": 56, "en_nu": 56, "en_nz": [56, 112], "en_pg": 56, "en_ph": [56, 108], "en_pk": 56, "en_pn": 56, "en_pr": 56, "en_pw": 56, "en_rw": 56, "en_sb": 56, "en_sc": 56, "en_sd": 56, "en_s": 56, "en_sg": 56, "en_sh": 56, "en_si": 56, "en_sl": 56, "en_ss": 56, "en_sx": 56, "en_sz": 56, "en_tc": 56, "en_tk": 56, "en_to": 56, "en_tt": 56, "en_tv": 56, "en_tz": 56, "en_ug": 56, "en_um": 56, "en_vc": 56, "en_vg": 56, "en_vi": 56, "en_vu": 56, "en_w": 56, "en_za": 56, "en_zm": 56, "en_zw": 56, "eo": [56, 98], "eo_001": 56, "es_419": [56, 98], "es_ar": 56, "es_bo": 56, "es_br": 56, "es_bz": 56, "es_cl": 56, "es_co": 56, "es_cr": 56, "es_cu": 56, "es_do": 56, "es_ea": 56, "es_ec": 56, "es_gq": 56, "es_gt": 56, "es_hn": 56, "es_ic": 56, "es_mx": 56, "es_ni": 56, "es_pa": 56, "es_p": 56, "es_ph": 56, "es_pr": 56, "es_pi": 56, "es_sv": 56, "es_u": 56, "es_ui": 56, "es_v": 56, "et": [56, 69, 112], "et_e": 56, "eu": [56, 69], "eu_": 56, "ewo": 56, "ewo_cm": 56, "fa_af": 56, "fa_ir": 56, "ff_adlm": 56, "ff_adlm_bf": 56, "ff_adlm_cm": 56, "ff_adlm_gh": 56, "ff_adlm_gm": 56, "ff_adlm_gn": 56, "ff_adlm_gw": 56, "ff_adlm_lr": 56, "ff_adlm_mr": 56, "ff_adlm_n": 56, "ff_adlm_ng": 56, "ff_adlm_sl": 56, "ff_adlm_sn": 56, "ff_latn": 56, "ff_latn_bf": 56, "ff_latn_cm": 56, "ff_latn_gh": 56, "ff_latn_gm": 56, "ff_latn_gn": 56, "ff_latn_gw": 56, "ff_latn_lr": 56, "ff_latn_mr": 56, "ff_latn_n": 56, "ff_latn_ng": 56, "ff_latn_sl": [56, 108], "ff_latn_sn": 56, "fi_fi": 56, "fil": 56, "fil_ph": 56, "fo": 56, "fo_dk": 56, "fo_fo": 56, "fr_be": 56, "fr_bf": 56, "fr_bi": 56, "fr_bj": 56, "fr_bl": 56, "fr_ca": [56, 108], "fr_cd": 56, "fr_cf": 56, "fr_cg": 56, "fr_ch": 56, "fr_ci": 56, "fr_cm": 56, "fr_dj": 56, "fr_dz": 56, "fr_fr": [56, 108], "fr_ga": 56, "fr_gf": 56, "fr_gn": 56, "fr_gp": 56, "fr_gq": 56, "fr_ht": 56, "fr_km": 56, "fr_lu": 56, "fr_ma": 56, "fr_mc": 56, "fr_mf": 56, "fr_mg": 56, "fr_ml": 56, "fr_mq": 56, "fr_mr": 56, "fr_mu": 56, "fr_nc": 56, "fr_ne": 56, "fr_pf": 56, "fr_pm": 56, "fr_re": 56, "fr_rw": 56, "fr_sc": 56, "fr_sn": 56, "fr_sy": 56, "fr_td": 56, "fr_tg": 56, "fr_tn": 56, "fr_vu": 56, "fr_wf": 56, "fr_yt": 56, "fur": 56, "fur_it": 56, "fy": 56, "fy_nl": 56, "ga": [56, 76, 107, 108], "ga_gb": 56, "ga_i": 56, "gd": 56, "gd_gb": 56, "gl": 56, "gl_e": 56, "gsw": 56, "gsw_ch": 56, "gsw_fr": 56, "gsw_li": 56, "gu_in": 56, "guz": 56, "guz_k": 56, "gv": 56, "gv_im": 56, "ha_gh": 56, "ha_n": [56, 98], "ha_ng": 56, "haw": 56, "haw_u": 56, "hi": 56, "hi_in": 56, "hi_latn": 56, "hi_latn_in": 56, "hr": 56, "hr_ba": 56, "hr_hr": 56, "hsb": 56, "hsb_de": 56, "hu": 56, "hu_hu": 56, "hy": [56, 98, 112], "hy_am": 56, "ia": [56, 98], "ia_001": 56, "id_id": 56, "ie": 56, "ie_e": 56, "ig": 56, "ig_ng": 56, "ii_cn": 56, "is_i": 56, "it_ch": 56, "it_it": 56, "it_sm": 56, "it_va": 56, "ja_jp": [56, 112], "jgo": 56, "jgo_cm": 56, "jmc": 56, "jmc_tz": 56, "jv": 56, "jv_id": 56, "ka_g": 56, "kab": 56, "kab_dz": 56, "kam": 56, "kam_k": 56, "kde": 56, "kde_tz": 56, "kea": 56, "kea_cv": 56, "kgp": 56, "kgp_br": 56, "khq": 56, "khq_ml": 56, "ki": 56, "ki_k": 56, "kk_kz": 56, "kkj": 56, "kkj_cm": 56, "kl": [56, 106], "kl_gl": 56, "kln": 56, "kln_ke": 56, "km": 56, "km_kh": 56, "kn": 56, "kn_in": 56, "ko_cn": 56, "ko_kp": 56, "ko_kr": 56, "kok": 56, "kok_in": 56, "ks_arab": 56, "ks_arab_in": 56, "ks_deva": 56, "ks_deva_in": 56, "ksb": 56, "ksb_tz": 56, "ksf": 56, "ksf_cm": 56, "ksh": 56, "ksh_de": 56, "ku": 56, "ku_tr": 56, "kw": 56, "kw_gb": 56, "kxv": 56, "kxv_deva": 56, "kxv_deva_in": 56, "kxv_latn": 56, "kxv_latn_in": 56, "kxv_orya": 56, "kxv_orya_in": 56, "kxv_telu": 56, "kxv_telu_in": 56, "ky": [56, 98], "ky_kg": 56, "lag": 56, "lag_tz": 56, "lb": 56, "lb_lu": 56, "lg": 56, "lg_ug": 56, "lij": 56, "lij_it": 56, "lkt": 56, "lkt_u": 56, "lmo": 56, "lmo_it": 56, "ln": 56, "ln_ao": 56, "ln_cd": 56, "ln_cf": 56, "ln_cg": 56, "lo_la": 56, "lrc": 56, "lrc_iq": 56, "lrc_ir": 56, "lt_lt": 56, "lu_cd": 56, "luo": 56, "luo_k": 56, "lui": 56, "luy_k": 56, "lv": 56, "lv_lv": 56, "mai_in": 56, "mas_k": 56, "mas_tz": 56, "mer": 56, "mer_k": 56, "mfe": 56, "mfe_mu": 56, "mg": 56, "mg_mg": 56, "mgh": 56, "mgh_mz": 56, "mgo": 56, "mgo_cm": 56, "mi": [56, 69, 87, 88, 104, 111, 112], "mi_nz": 56, "mk": [56, 98], "mk_mk": 56, "ml": 56, "ml_in": 56, "mn_mn": 56, "mni": 56, "mni_beng": 56, "mni_beng_in": 56, "mr": [56, 59, 83], "mr_in": 56, "ms_bn": 56, "ms_id": 56, "ms_my": 56, "ms_sg": 56, "mt": 56, "mt_mt": 56, "mua": 56, "mua_cm": 56, "my": [56, 98, 112], "my_mm": 56, "mzn": 56, "mzn_ir": 56, "naq": 56, "naq_na": 56, "nb": [56, 76], "nb_no": 56, "nb_sj": 56, "nd_zw": 56, "nds_de": 56, "nds_nl": 56, "ne": 56, "ne_in": 56, "ne_np": 56, "nl_aw": 56, "nl_be": 56, "nl_bq": 56, "nl_cw": [56, 108], "nl_nl": [56, 112], "nl_sr": 56, "nl_sx": 56, "nmg": 56, "nmg_cm": 56, "nn": 56, "nn_no": 56, "nnh": 56, "nnh_cm": 56, "nqo": 56, "nqo_gn": 56, "nu": 56, "nus_ss": 56, "nyn": 56, "nyn_ug": 56, "oc": 56, "oc_": 56, "oc_fr": 56, "om": 56, "om_et": 56, "om_k": 56, "or_in": 56, "os_g": 56, "os_ru": 56, "pa_arab": 56, "pa_arab_pk": 56, "pa_guru": 56, "pa_guru_in": 56, "pcm": 56, "pcm_ng": 56, "prg": 56, "prg_pl": 56, "ps_af": 56, "ps_pk": 56, "pt_ao": 56, "pt_br": [56, 57], "pt_ch": [56, 108], "pt_cv": 56, "pt_gq": 56, "pt_gw": 56, "pt_lu": 56, "pt_mo": 56, "pt_mz": 56, "pt_pt": 56, "pt_st": 56, "pt_tl": 56, "qu": 56, "qu_bo": 56, "qu_ec": 56, "qu_p": 56, "raj": 56, "raj_in": 56, "rm": [56, 114], "rm_ch": 56, "rn": 56, "rn_bi": 56, "ro": [56, 98, 111], "ro_md": 56, "ro_ro": 56, "rof": 56, "rof_tz": 56, "ru": [56, 98], "ru_bi": 56, "ru_kg": 56, "ru_kz": 56, "ru_md": 56, "ru_ru": 56, "ru_ua": 56, "rw": 56, "rw_rw": 56, "rwk": 56, "rwk_tz": 56, "sa": [56, 93], "sa_in": 56, "sah": 56, "sah_ru": 56, "saq": 56, "saq_k": 56, "sat_olck": [56, 98], "sat_olck_in": 56, "sbp": 56, "sbp_tz": 56, "sc_it": 56, "sd": 56, "sd_arab": 56, "sd_arab_pk": 56, "sd_deva": 56, "sd_deva_in": 56, "se_fi": 56, "se_no": 56, "se_s": 56, "seh": 56, "seh_mz": 56, "ses_ml": 56, "sg": 56, "sg_cf": 56, "shi": 56, "shi_latn": 56, "shi_latn_ma": 56, "shi_tfng": 56, "shi_tfng_ma": 56, "si": [56, 98, 111], "si_lk": 56, "sl": 56, "sl_si": 56, "smn": 56, "smn_fi": 56, "sn": 56, "sn_zw": 56, "so_dj": 56, "so_et": 56, "so_k": 56, "so_so": 56, "sq": 56, "sq_al": 56, "sq_mk": 56, "sq_xk": 56, "sr": [56, 98], "sr_cyrl": [56, 108], "sr_cyrl_ba": 56, "sr_cyrl_m": 56, "sr_cyrl_r": 56, "sr_cyrl_xk": 56, "sr_latn": [56, 98, 108], "sr_latn_ba": 56, "sr_latn_m": 56, "sr_latn_r": 56, "sr_latn_xk": 56, "su": [56, 93, 111], "su_latn": 56, "su_latn_id": 56, "sv_ax": 56, "sv_fi": 56, "sv_se": 56, "sw": 56, "sw_cd": 56, "sw_ke": 56, "sw_tz": 56, "sw_ug": 56, "syr": 56, "syr_iq": 56, "syr_si": 56, "szl": 56, "szl_pl": 56, "ta_in": 56, "ta_lk": 56, "ta_mi": 56, "ta_sg": 56, "te_in": 56, "teo": 56, "teo_k": 56, "teo_ug": 56, "tg": 56, "tg_tj": 56, "th_th": 56, "ti_er": 56, "ti_et": 56, "tk": [56, 98], "tk_tm": 56, "to_to": 56, "tok": 56, "tok_001": 56, "tr": [56, 66, 98, 99, 111], "tr_cy": 56, "tr_tr": [56, 95, 112], "tt": 56, "tt_ru": 56, "twq": 56, "twq_ne": 56, "tzm": 56, "tzm_ma": 56, "ug": [56, 98], "ug_cn": 56, "uk": [56, 98, 103], "uk_ua": 56, "ur": [56, 98], "ur_in": 56, "ur_pk": 56, "uz": [56, 98], "uz_arab": 56, "uz_arab_af": 56, "uz_cyrl": [56, 98], "uz_cyrl_uz": 56, "uz_latn": [56, 98], "uz_latn_uz": 56, "vai": 56, "vai_latn": 56, "vai_latn_lr": 56, "vai_vaii": 56, "vai_vaii_lr": 56, "vec_it": 56, "vi": 56, "vi_vn": 56, "vmw": 56, "vmw_mz": 56, "vun": 56, "vun_tz": 56, "wae": 56, "wae_ch": 56, "wo": 56, "wo_sn": 56, "xh": [56, 98], "xh_za": 56, "xnr": 56, "xnr_in": 56, "xog": 56, "xog_ug": 56, "yav": 56, "yav_cm": 56, "yi": 56, "yi_ua": 56, "yo": [56, 98, 112], "yo_bj": [56, 98, 112], "yo_ng": 56, "yrl": 56, "yrl_br": 56, "yrl_co": 56, "yrl_ve": 56, "yue": 56, "yue_han": 56, "yue_hans_cn": 56, "yue_hant": 56, "yue_hant_hk": 56, "za_cn": 56, "zgh": 56, "zgh_ma": 56, "zh_han": [56, 108], "zh_hans_cn": 56, "zh_hans_hk": 56, "zh_hans_mo": 56, "zh_hans_sg": 56, "zh_hant": [56, 108], "zh_hant_hk": 56, "zh_hant_mo": 56, "zh_hant_tw": 56, "zu": [56, 98], "zu_za": 56, "stri_locale_get": [57, 108], "oldloc": 57, "stringi_1": 57, "stri_locate_first_": [58, 59], "stri_locate_last_": [58, 59], "stri_locate_first": [58, 89, 90, 107], "stri_locate_last": [58, 89, 90, 107], "stri_locate_first_charclass": 58, "stri_locate_last_charclass": 58, "stri_locate_all_col": [58, 109], "stri_locate_first_col": 58, "stri_locate_last_col": 58, "stri_locate_first_regex": [58, 89, 109], "stri_locate_last_regex": [58, 89], "stri_locate_first_fix": [58, 107], "stri_locate_last_fix": [58, 107], "latter": [58, 106, 107, 108, 109, 113], "similarli": [58, 106], "stri_match_regex": 58, "breakfast": [58, 60], "lunch": [58, 60], "pizza": [58, 60], "food": [58, 60], "ababa": [58, 86], "ye": 58, "lookahead": 58, "acagagactttagatagagaaga": [58, 60], "jone": [59, 83, 106, 109], "brown": [59, 76, 83, 107], "happi": [59, 83], "smith": [59, 83], "stri_match_first": [60, 107], "stri_match_last": [60, 107], "stri_match_all_regex": [60, 113], "stri_match_first_regex": 60, "stri_match_last_regex": 60, "dessert": 60, "icecream": 60, "spaghetti": 60, "xyx": 60, "acgt": [60, 96, 112], "gag": 60, "ttt": 60, "ata": 60, "trail": 62, "u001f600": 62, "skip_word_numb": [63, 83], "skip_word_lett": [63, 83], "skip_word_kana": 63, "skip_word_ideo": 63, "skip_line_soft": 63, "skip_line_hard": 63, "skip_sentence_term": 63, "skip_sentence_sep": [63, 83], "action": 63, "exclud": [63, 91], "hiragana": [63, 98, 108], "hard": [63, 108], "mandatori": 63, "skip_": 63, "rbbi": 63, "ubrk": 63, "ubrk_8h": 63, "alternate_shift": [64, 108], "uppercase_first": [64, 108], "stri_col": 64, "permiss": [64, 108], "strictest": [64, 108], "primari": [64, 108], "weight": [64, 108], "top": [64, 108, 110], "quaternari": [64, 108], "canadian": [64, 108], "secondari": 64, "tertiari": [64, 108], "opposit": [64, 108], "increment": [64, 108], "fcd": [64, 98, 108, 112], "nfd": [64, 97, 98, 99, 108, 111], "turn": 64, "alik": 64, "reliabl": 64, "relationship": 64, "definit": [64, 66, 113], "architectur": 64, "classicu_1_1col": 64, "number100": 64, "number2": 64, "u_toupp": 65, "ala": [65, 66], "dotal": 66, "dot_al": [66, 113], "multilin": 66, "multi_lin": [66, 113], "unix_lin": [66, 113], "uword": [66, 113], "error_on_unknown_escap": [66, 113], "entir": [66, 113], "metacharact": 66, "000a": [66, 113], "tr29": 66, "word_boundari": 66, "unrecogn": 66, "themselv": [66, 82, 113], "cpu": [66, 113], "poorli": [66, 113], "heap": [66, 113], "backtrack": [66, 113], "uregexpflag": 66, "uregex_8h": 66, "rearrang": 67, "ascend": 67, "descend": 67, "nondecreas": [67, 80], "nonincreas": [67, 80], "put": [67, 80, 99, 104], "stabl": [67, 80, 108, 109], "stl": [67, 80], "stable_sort": [67, 80], "ok": [67, 72, 80], "floor": [68, 104], "getopt": [68, 104], "use_length": [68, 85, 104], "dispatch": 68, "stri_trim_left": [68, 100], "screen": 68, "ud6c8": 68, "ubbfc": 68, "uc815": 68, "uc74c": 68, "\ud6c8\ubbfc\uc815\uc74c": 68, "\u1112\u116e\u11ab\u1106\u1175\u11ab\u110c\u1165\u11bc\u110b\u1173\u11b7": 68, "start_lipsum": 69, "lai": 69, "exercis": [69, 112], "zipf": 69, "discret": 69, "markov": 69, "model": [69, 99], "sappli": [69, 92, 106, 110], "tincidunt": [69, 112], "fermentum": [69, 112], "erat": 69, "penatibu": 69, "parturi": 69, "porta": 69, "qui": [69, 112], "mauri": [69, 112], "volutpat": 69, "nunc": 69, "urna": 69, "aliquet": [69, 87, 104], "nec": 69, "ero": [69, 112], "diam": 69, "molesti": 69, "sociosqu": 69, "etiam": [69, 87, 104, 112], "phasellu": 69, "di": 69, "arcu": [69, 112], "variu": 69, "donec": [69, 112], "ligula": 69, "sed": [69, 87, 88, 104, 112, 113], "tempor": [69, 112], "semper": 69, "ut": [69, 112], "pulvinar": 69, "sodal": 69, "ridiculu": [69, 112], "quam": 69, "tristiqu": 69, "facilisi": [69, 112], "lacinia": [69, 87, 88, 104, 112], "vestibulum": [69, 112], "dignissim": 69, "quisqu": 69, "cursu": 69, "ultrici": 69, "pretium": [69, 112], "molli": 69, "elementum": 69, "lacu": [69, 112], "augu": [69, 87, 88, 104], "velit": 69, "iaculi": 69, "egesta": [69, 112], "curabitur": [69, 112], "proin": [69, 88, 104], "vita": [69, 112], "vivamu": 69, "morbi": 69, "imperdiet": 69, "platea": 69, "himenaeo": 69, "luctu": 69, "feugiat": 69, "efficitur": 69, "maecena": 69, "malesuada": 69, "adipisc": 69, "leo": 69, "tortor": [69, 112], "sem": [69, 112], "sapien": [69, 112], "cubilia": 69, "nisl": 69, "porttitor": 69, "cura": 69, "magna": 69, "aliquam": [69, 112], "fame": 69, "pellentesqu": [69, 87, 104], "nibh": [69, 87, 88, 104, 112], "vel": [69, 87, 104, 112], "justo": 69, "turpi": [69, 112], "libero": 69, "natoqu": 69, "condimentum": 69, "massa": [69, 112], "finibu": 69, "pharetra": 69, "nulla": 69, "socii": [69, 112], "dictumst": [69, 112], "aptent": 69, "est": [69, 93], "dapibu": [69, 112], "conval": 69, "nequ": 69, "risu": 69, "faucibu": 69, "blandit": 69, "auctor": [69, 112], "bibendum": 69, "magni": [69, 112], "feli": [69, 112], "hac": [69, 112], "nisi": 69, "scelerisqu": [69, 87, 88, 104], "aenean": 69, "sollicitudin": 69, "matti": 69, "vulput": 69, "commodo": 69, "euismod": 69, "enim": 69, "nullam": 69, "puru": 69, "At": [69, 110], "viverra": 69, "torquent": [69, 112], "accumsan": 69, "habitass": [69, 112], "eget": [69, 112], "eleifend": 69, "primi": 69, "praesent": 69, "metu": [69, 112], "netu": [69, 112], "venenati": 69, "odio": [69, 112], "tellu": [69, 87, 104], "consequat": [69, 112], "dui": 69, "taciti": 69, "ullamcorp": [69, 112], "tempu": 69, "hendrerit": 69, "lectu": 69, "fringilla": 69, "rutrum": 69, "ant": [69, 112], "sagitti": [69, 112], "dictum": 69, "incepto": 69, "gravida": [69, 112], "habit": 69, "ex": [69, 112], "nam": [69, 112], "laoreet": 69, "maximu": 69, "cra": [69, 87, 104], "posuer": 69, "suscipit": [69, 87, 88, 104], "suspendiss": 69, "orci": 69, "loborti": 69, "rhoncu": [69, 112], "ultric": [69, 112], "nascetur": 69, "litora": 69, "nostra": 69, "mu": 69, "mont": 69, "cum": 69, "congu": 69, "fusc": [69, 112], "placerat": 69, "conubia": 69, "senectu": 69, "ornar": [69, 112], "vehicula": [69, 112], "interdum": 69, "peculiar": [70, 71, 79], "abcdefghi": 70, "cheidfbag": 70, "5096873241": 70, "rep": [70, 109], "bjyxtszeufhpogcwdrvmaliqkn": 70, "kafgjolxiqwmtpnhyucdbrzev": 70, "vumbrtgqlpfhniwkxeazjdocsi": 70, "irjhvgpqsobzayneumlfdkcxtw": 70, "yplrcekozfjnvmawxgqhtisbud": 70, "afwijgkuxrqonshelmcvdpbyzt": 70, "flircxuthpsygadwkjvmnzqebo": 70, "zqynmsjreatfhcloipvubdwgkx": 70, "kvyjzutiprsbclgfqonhmaedwx": 70, "eqjtmzfuaidpkxbchygsrlownv": 70, "draw": 71, "redund": [71, 110], "sampl": [71, 80, 108, 112], "probabl": 71, "hmpsw2wty": 71, "xsgz6tf2kx": 71, "tgdzehxah9": 71, "xtgn1tldje": 71, "8ppm98esgr": 71, "tnf5n": 71, "horoonr": 71, "kdi0t": 71, "dnbl6f": 71, "fpm6qztsa": 71, "\u014f\u1eb7\u0279\u1ebd\u0267": 71, "\u01b0\ua775\u0119\u1d6c\u1d8f": 71, "\u1e6f\u0270\u1d7d\ud837\udf01\u1d79": 71, "\uab54\ufb04\u1e7b\u02ac\u0169": 71, "\uff4e\u0259\u00f2\uff57\u2c79": 71, "\u0161\u1e21\ud837\udf01\u1e59\u02a8": 71, "\u1eaf\u0267\u025d\u01e7\u028c": 71, "\ud837\udf19\u0173\u0115\u0161\u1eef": 71, "\u1e8b\uab55\u1ed5\ua733\u1d96": 71, "\u1ec1\ua7b9\ua778\ud837\udf15\u1d12": 71, "password": 71, "3hgsajnqztagw": 71, "wjgmtzjcups4": 71, "k0msqhex9bozev": 71, "ftaj1dgf2a": 71, "8lxjpujohhc": 71, "unkx3ygc2qtho": 71, "o9otfpcn3x2g": 71, "aidxj0jyffdfoa": 71, "tkgrmalp2w": 71, "sffglwz7vkw": 71, "xtfrm": 72, "receiv": 72, "runif": [72, 85, 108], "0455565": 72, "5281055": 72, "2875775": 72, "4089769": 72, "8830174": 72, "8924190": 72, "7883051": 72, "9404673": 72, "ins": 73, "entireti": [73, 113], "abil": [73, 81, 105], "robust": [73, 111], "stri_split_lines1": [73, 74, 84, 111], "stri_replace_first": [76, 89, 107], "stri_replace_last": [76, 89, 107], "vectorise_al": [76, 107, 110], "stri_replace_first_charclass": 76, "stri_replace_last_charclass": 76, "stri_replace_all_col": 76, "stri_replace_first_col": 76, "stri_replace_last_col": 76, "stri_replace_first_fix": 76, "stri_replace_last_fix": 76, "stri_replace_all_regex": [76, 110, 113], "stri_replace_first_regex": 76, "stri_replace_last_regex": 76, "npattern": 76, "tc": 76, "l0rem": 76, "d0l0r": 76, "c0nsectetur": 76, "abaca": 76, "rexamin": 76, "xamin": 76, "quick": [76, 107], "fox": [76, 107], "jump": [76, 107], "lazi": [76, 107, 113], "dog": [76, 107], "slow": [76, 107], "black": 76, "bear": 76, "quicker": 76, "ag": 76, "str2": 77, "wherev": [77, 89, 90, 109, 113], "plain": [77, 113], "test1": 77, "cba": [79, 107, 109], "zxy": 79, "u0104123": 79, "321\u0105\u0105": 79, "yxz": 79, "stri_trans_nfd": [79, 97, 99, 111], "agonek": 79, "weakli": 80, "increas": [80, 108, 109], "0dz": 81, "001": 81, "002": [81, 114], "delimit": [82, 106, 107, 112], "token": [82, 83, 106, 107, 113], "remaind": [82, 83], "hand": [82, 83, 90, 95, 106, 109, 111, 113], "never": [82, 84, 113], "a_b_c_d": 82, "a_b_c__d": 82, "b_c__d": 82, "ab_c": 82, "d_ef_g": 82, "ab": [82, 96, 106], "ef": [82, 106], "0x0d": 84, "0x0a": 84, "crlf": 84, "next": [84, 106], "nel": 84, "0x85": 84, "unambigu": 84, "0x2029": 84, "0x2028": 84, "vertic": 84, "vt": 84, "0x0b": 84, "0x0c": 84, "utr": 84, "tr13": 84, "na_str": 85, "inf_str": 85, "inf": 85, "nan_str": 85, "nan": 85, "unsign": 85, "infin": 85, "123456": 85, "thousand": [85, 110], "later": 85, "unus": [85, 91], "dioxx": 85, "feeggaa": 85, "blank": 85, "invis": 85, "printf": 85, "archlinux": 85, "wikipedia": [85, 97, 99, 110], "wiki": [85, 97, 99, 110], "printf_format_str": 85, "3f": 85, "u00b2": 85, "exp": [85, 113], "e\u00b2": 85, "\u03c0": 85, "\u03c0\u00b2": 85, "xxabcd": 85, "u0106": 85, "u0107": [85, 97], "u0108": 85, "u200b": [85, 106, 112], "u0001f3f4": 85, "u000e0067": 85, "u000e0062": 85, "u000e0073": 85, "u000e0063": 85, "u000e0074": 85, "u000e007f": 85, "minimum": 85, "xx\u0105\u0107\u0107\u0109": 85, "xxa": 85, "xx\u0105": 85, "wrt": 85, "ifels": [85, 105], "2f": 85, "preformat": 85, "seq_along": 85, "u2718": 85, "u2713": 85, "na_real_": 85, "u0001f4a9": 85, "u221": 85, "000": [85, 111, 113], "1714999701": 85, "996432": 85, "23456": 85, "asterisk": 85, "14159265358979": 85, "141593": 85, "998135": 85, "stri_startswith_fix": [86, 107], "stri_endswith_fix": [86, 107], "stri_startswith_charclass": 86, "stri_endswith_charclass": 86, "stri_startswith_col": 86, "stri_endswith_col": 86, "meta": 86, "wspace": [86, 100], "a1": [86, 108], "a2": [86, 108], "b3": 86, "a4": 86, "c5": 86, "pat": 86, "u0635": 86, "u0644": 86, "u0649": 86, "u0627": 86, "u0647": 86, "u0639": 86, "u064a": 86, "u0648": 86, "u0633": 86, "u0645xyz": 86, "ufdfa": [86, 99], "ufdfaxyz": 86, "aggreg": [87, 88, 106], "linesnempti": 87, "char": 87, "charsnwhit": 87, "stuff": [87, 88], "stat": [87, 88], "orient": 88, "kile": 88, "sourceforg": 88, "team": 88, "php": 88, "charsword": 88, "charscmdenvir": 88, "charswhit": 88, "envir": 88, "textbf": 88, "textit": 88, "forward": [89, 90, 97, 107, 109], "mutual": [89, 90], "exclus": [89, 90, 106], "leav": [89, 90], "inject": 89, "front": 89, "prioriti": 89, "3456": [89, 90], "new_substr": 89, "stri_sub_all_replac": 90, "simplest": 90, "disjoint": 90, "stri_subset_fix": [91, 107], "stri_subset_charclass": 91, "stri_subset_col": 91, "stri_subset_regex": 91, "partial": [91, 109], "former": [91, 107, 109], "item": [91, 107, 113], "id456": 91, "display_typ": 92, "generic_short": 92, "generic_long": 92, "gmt_short": 92, "gmt_long": 92, "generic_loc": 92, "readabl": [92, 109, 113], "dst": [92, 93], "rawoffset": [92, 93], "offset": [92, 93], "usesdaylighttim": [92, 93], "europ": [92, 93, 94, 112], "summer": [92, 93], "stredoeur\u00f3pski": 92, "\u0161tandardn\u00fd": 92, "\u010da": 92, "letn\u00fd": 92, "london": [92, 93], "greenwich": [92, 93], "kingdom": 92, "na_integer_": 93, "area": 93, "coordin": 93, "interchang": [93, 99, 109], "concern": 93, "histor": [93, 108, 113], "vari": [93, 106, 107, 109], "throughout": 93, "closer": 93, "equat": 93, "half": 93, "northern": 93, "hemispher": 93, "southern": 93, "classicu_1_1timezon": [93, 94], "aet": 93, "africa": 93, "abidjan": 93, "accra": 93, "addis_ababa": 93, "algier": 93, "asmara": 93, "asmera": 93, "bamako": 93, "bangui": 93, "banjul": 93, "bissau": 93, "blantyr": 93, "brazzavil": 93, "bujumbura": 93, "cairo": 93, "casablanca": 93, "ceuta": 93, "conakri": 93, "dakar": 93, "dar_es_salaam": 93, "djibouti": 93, "douala": 93, "el_aaiun": 93, "freetown": 93, "gaboron": 93, "harar": 93, "johannesburg": 93, "juba": 93, "kampala": 93, "khartoum": 93, "kigali": 93, "kinshasa": 93, "lago": 93, "librevil": 93, "lome": 93, "luanda": 93, "lubumbashi": 93, "lusaka": 93, "malabo": 93, "maputo": 93, "maseru": 93, "mbaban": 93, "mogadishu": 93, "monrovia": 93, "nairobi": 93, "ndjamena": 93, "niamei": 93, "nouakchott": 93, "ouagadoug": 93, "porto": 93, "novo": 93, "sao_tom": 93, "timbuktu": 93, "tripoli": 93, "tuni": 93, "windhoek": 93, "agt": 93, "adak": 93, "anchorag": 93, "anguilla": 93, "antigua": 93, "araguaina": 93, "argentina": 93, "buenos_air": 93, "catamarca": 93, "comodrivadavia": 93, "cordoba": 93, "jujui": 93, "la_rioja": 93, "mendoza": 93, "rio_gallego": 93, "salta": 93, "san_juan": 93, "san_lui": 93, "tucuman": 93, "ushuaia": 93, "aruba": 93, "asuncion": 93, "atikokan": 93, "atka": 93, "bahia": 93, "bahia_bandera": 93, "barbado": 93, "belem": 93, "beliz": 93, "blanc": 93, "sablon": 93, "boa_vista": 93, "bogota": 93, "bois": 93, "cambridge_bai": 93, "campo_grand": 93, "cancun": 93, "caraca": 93, "cayenn": 93, "cayman": 93, "chicago": 93, "chihuahua": 93, "ciudad_juarez": 93, "coral_harbour": 93, "costa_rica": 93, "creston": 93, "cuiaba": 93, "curacao": 93, "danmarkshavn": 93, "dawson": 93, "dawson_creek": 93, "denver": 93, "detroit": 93, "dominica": 93, "edmonton": 93, "eirunep": 93, "el_salvador": 93, "ensenada": 93, "fort_nelson": 93, "fort_wayn": 93, "fortaleza": 93, "glace_bai": 93, "godthab": 93, "goose_bai": 93, "grand_turk": 93, "grenada": 93, "guadeloup": 93, "guatemala": 93, "guayaquil": 93, "guyana": 93, "halifax": 93, "havana": 93, "hermosillo": 93, "indiana": 93, "indianapoli": 93, "knox": 93, "marengo": 93, "petersburg": 93, "tell_citi": 93, "vevai": 93, "vincenn": 93, "winamac": 93, "inuvik": 93, "iqaluit": 93, "jamaica": 93, "juneau": 93, "kentucki": 93, "louisvil": 93, "monticello": 93, "knox_in": 93, "kralendijk": 93, "la_paz": 93, "lima": 93, "lower_princ": 93, "maceio": 93, "managua": 93, "manau": 93, "marigot": 93, "martiniqu": 93, "matamoro": 93, "mazatlan": 93, "menomine": 93, "merida": 93, "metlakatla": 93, "mexico_c": 93, "miquelon": 93, "moncton": 93, "monterrei": 93, "montevideo": 93, "montreal": 93, "montserrat": 93, "nassau": 93, "new_york": 93, "nipigon": 93, "nome": 93, "noronha": 93, "north_dakota": 93, "beulah": 93, "new_salem": 93, "nuuk": 93, "ojinaga": 93, "panama": 93, "pangnirtung": 93, "paramaribo": 93, "phoenix": 93, "port_of_spain": 93, "port": 93, "au": 93, "princ": 93, "porto_acr": 93, "porto_velho": 93, "puerto_rico": 93, "punta_arena": 93, "rainy_riv": 93, "rankin_inlet": 93, "recif": 93, "regina": 93, "resolut": 93, "rio_branco": 93, "rosario": 93, "santa_isabel": 93, "santarem": 93, "santiago": 93, "santo_domingo": 93, "sao_paulo": 93, "scoresbysund": 93, "shiprock": 93, "sitka": 93, "st_barthelemi": 93, "st_john": 93, "st_kitt": 93, "st_lucia": 93, "st_thoma": 93, "st_vincent": 93, "swift_curr": 93, "tegucigalpa": 93, "thule": 93, "thunder_bai": 93, "tijuana": 93, "toronto": 93, "tortola": 93, "vancouv": 93, "virgin": 93, "whitehors": 93, "winnipeg": 93, "yakutat": 93, "yellowknif": 93, "antarctica": 93, "casei": 93, "davi": 93, "dumontdurvil": 93, "macquari": 93, "mawson": 93, "mcmurdo": 93, "palmer": 93, "rothera": 93, "south_pol": 93, "syowa": 93, "troll": 93, "vostok": 93, "arctic": 93, "longyearbyen": 93, "art": 93, "asia": 93, "aden": 93, "almati": 93, "amman": 93, "anadyr": 93, "aqtau": 93, "aqtob": 93, "ashgabat": 93, "ashkhabad": 93, "atyrau": 93, "baghdad": 93, "bahrain": 93, "baku": 93, "bangkok": 93, "barnaul": 93, "beirut": 93, "bishkek": 93, "brunei": 93, "calcutta": 93, "chita": 93, "choibalsan": 93, "chongq": 93, "chungk": 93, "colombo": 93, "dacca": 93, "damascu": 93, "dhaka": 93, "dili": 93, "dubai": 93, "dushanb": 93, "famagusta": 93, "gaza": 93, "harbin": 93, "hebron": 93, "ho_chi_minh": 93, "hong_kong": 93, "hovd": 93, "irkutsk": 93, "istanbul": 93, "jakarta": 93, "jayapura": 93, "jerusalem": 93, "kabul": 93, "kamchatka": 93, "karachi": 93, "kashgar": 93, "kathmandu": 93, "katmandu": 93, "khandyga": 93, "kolkata": 93, "krasnoyarsk": 93, "kuala_lumpur": 93, "kuch": 93, "kuwait": 93, "macao": 93, "macau": 93, "magadan": 93, "makassar": 93, "manila": 93, "muscat": 93, "nicosia": 93, "novokuznetsk": 93, "novosibirsk": 93, "omsk": 93, "oral": 93, "phnom_penh": 93, "pontianak": 93, "pyongyang": 93, "qatar": 93, "qostanai": 93, "qyzylorda": 93, "rangoon": 93, "riyadh": 93, "saigon": 93, "sakhalin": 93, "samarkand": 93, "seoul": 93, "shanghai": 93, "singapor": 93, "srednekolymsk": 93, "taipei": 93, "tashkent": 93, "tbilisi": 93, "tehran": 93, "tel_aviv": 93, "thimbu": 93, "thimphu": 93, "tokyo": 93, "tomsk": 93, "ujung_pandang": 93, "ulaanbaatar": 93, "ulan_b": 93, "urumqi": 93, "ust": 93, "nera": 93, "vientian": 93, "vladivostok": 93, "yakutsk": 93, "yangon": 93, "yekaterinburg": 93, "yerevan": 93, "atlant": 93, "azor": 93, "bermuda": 93, "canari": 93, "cape_verd": 93, "faero": 93, "faro": 93, "jan_mayen": 93, "madeira": 93, "reykjavik": 93, "south_georgia": 93, "st_helena": 93, "stanlei": 93, "australia": [93, 110], "adelaid": 93, "brisban": 93, "broken_hil": 93, "canberra": 93, "curri": 93, "darwin": 93, "eucla": 93, "hobart": 93, "lhi": 93, "lindeman": 93, "lord_how": 93, "melbourn": [93, 110, 114], "north": 93, "nsw": 93, "perth": 93, "queensland": 93, "south": 93, "sydnei": 93, "tasmania": 93, "victoria": 93, "west": 93, "yancowinna": 93, "bet": 93, "brazil": 93, "acr": 93, "denoronha": 93, "east": [93, 103], "bst": 93, "canada": 93, "saskatchewan": 93, "eastern": 93, "mountain": 93, "newfoundland": 93, "yukon": 93, "chile": 93, "continent": 93, "easterisland": 93, "cnt": 93, "cst": 93, "cst6cdt": 93, "ctt": [93, 112], "cuba": 93, "eat": 93, "ect": [93, 113], "eet": 93, "egypt": 93, "eir": 93, "est5edt": 93, "gmt0": 93, "uct": 93, "zulu": 93, "amsterdam": 93, "andorra": 93, "astrakhan": 93, "athen": 93, "belfast": 93, "belgrad": 93, "berlin": 93, "bratislava": 93, "brussel": 93, "bucharest": 93, "budapest": 93, "busingen": 93, "chisinau": 93, "copenhagen": 93, "dublin": 93, "gibraltar": 93, "guernsei": 93, "helsinki": 93, "isle_of_man": 93, "jersei": 93, "kaliningrad": 93, "kiev": 93, "kirov": 93, "kyiv": 93, "lisbon": 93, "ljubljana": 93, "luxembourg": 93, "madrid": 93, "malta": 93, "mariehamn": 93, "minsk": 93, "monaco": 93, "moscow": 93, "oslo": 93, "pari": 93, "podgorica": 93, "pragu": 93, "riga": 93, "rome": 93, "samara": 93, "san_marino": 93, "sarajevo": 93, "saratov": 93, "simferopol": 93, "skopj": 93, "sofia": 93, "stockholm": 93, "tallinn": 93, "tiran": 93, "tiraspol": 93, "ulyanovsk": 93, "uzhgorod": 93, "vaduz": 93, "vatican": 93, "vienna": 93, "vilniu": 93, "volgograd": 93, "zagreb": 93, "zaporozhy": 93, "zurich": 93, "factori": 93, "hongkong": 93, "hst": 93, "iceland": 93, "iet": 93, "antananarivo": 93, "chago": 93, "christma": 93, "coco": 93, "comoro": 93, "kerguelen": 93, "mahe": 93, "maldiv": 93, "mauritiu": 93, "mayott": 93, "reunion": 93, "iran": 93, "israel": 93, "ist": [93, 108], "japan": 93, "jst": 93, "kwajalein": 93, "libya": 93, "mexico": 93, "bajanort": 93, "bajasur": 93, "mit": 93, "mst": 93, "mst7mdt": 93, "navajo": 93, "net": [93, 114], "nst": 93, "nz": [93, 112, 114], "chat": 93, "apia": 93, "auckland": 93, "bougainvil": 93, "chatham": 93, "chuuk": 93, "easter": 93, "efat": 93, "enderburi": 93, "fakaofo": 93, "fiji": 93, "funafuti": 93, "galapago": 93, "gambier": 93, "guadalcan": 93, "guam": 93, "honolulu": 93, "johnston": 93, "kanton": 93, "kiritimati": 93, "kosra": 93, "majuro": 93, "marquesa": 93, "midwai": 93, "nauru": 93, "niue": 93, "norfolk": 93, "noumea": 93, "pago_pago": 93, "palau": 93, "pitcairn": 93, "pohnpei": 93, "ponap": 93, "port_moresbi": 93, "rarotonga": 93, "saipan": 93, "samoa": 93, "tahiti": 93, "tarawa": 93, "tongatapu": 93, "truk": 93, "wake": 93, "walli": 93, "yap": 93, "plt": 93, "pnt": 93, "poland": 93, "portug": 93, "prc": 93, "prt": 93, "pst": 93, "pst8pdt": 93, "roc": 93, "rok": 93, "sst": 93, "systemv": 93, "ast4": 93, "ast4adt": 93, "cst6": 93, "est5": 93, "hst10": 93, "mst7": 93, "pst8": 93, "yst9": 93, "yst9ydt": 93, "turkei": 93, "alaska": 93, "aleutian": 93, "arizona": 93, "hawaii": 93, "stark": 93, "michigan": 93, "vst": 93, "wet": 93, "rbind": 93, "lappli": 93, "brasilia": 93, "paraguai": 93, "amazon": 93, "colombia": 93, "venezuela": 93, "guiana": 93, "greenland": 93, "ecuador": 93, "mexican": 93, "bolivia": 93, "peru": 93, "st": 93, "pierr": 93, "uruguai": 93, "fernando": 93, "surinam": 93, "dumont": 93, "urvil": 93, "zealand": 93, "arabia": 93, "kazakhstan": 93, "turkmenistan": 93, "azerbaijan": 93, "indochina": 93, "kyrgyzstan": 93, "darussalam": 93, "india": 93, "china": 93, "bangladesh": 93, "timor": 93, "gulf": 93, "tajikistan": 93, "hong": 93, "kong": 93, "indonesia": 93, "afghanistan": 93, "petropavlovsk": 93, "kamchatski": 93, "pakistan": 93, "nepal": 93, "malaysia": 93, "philippin": 93, "myanmar": [93, 98], "uzbekistan": 93, "georgia": 93, "bhutan": 93, "armenia": 93, "cape": 93, "verd": 93, "falkland": 93, "island": 93, "lord": 93, "ocean": 93, "antarct": 93, "seychel": 93, "r\u00e9union": 93, "marshal": 93, "vanuatu": 93, "tokelau": 93, "tuvalu": 93, "solomon": 93, "chamorro": 93, "caledonia": 93, "papua": 93, "guinea": 93, "cook": 93, "gilbert": 93, "tonga": 93, "futuna": 93, "morocco": 93, "romanc": 93, "sudan": 93, "sao": 93, "tome": 93, "namibia": 93, "alaskan": 93, "tocantin": 93, "brazilian": 93, "turk": 93, "And": [93, 108, 109], "caico": 93, "saint": 93, "haiti": 93, "magallan": 93, "jordan": 93, "russia": 93, "altai": 93, "transbaik": 93, "sri": 93, "lanka": 93, "syria": 93, "arabian": 93, "gtb": 93, "bank": 93, "mongolia": 93, "korea": 93, "georgian": [93, 98], "ekaterinburg": 93, "caucasu": 93, "cen": 93, "irish": 93, "hawaiian": 93, "datelin": 93, "fle": 93, "belaru": 93, "oldtz": 94, "stri_trans_toupp": [95, 97, 112], "worth": [95, 113], "surround": [95, 110], "rest": 95, "casemap": 95, "scharf": 95, "\u0105\u0105": 95, "WItH": 95, "attach": 95, "id_123": 96, "babaab": 96, "101001": 96, "gcuacggagcuucggagcuag": 96, "tgca": [96, 112], "cgutgcctcguugcctcgutc": 96, "varieti": 97, "halfwidth": [97, 98], "semicolon": [97, 108], "mainli": 97, "broader": 97, "prebuilt": 97, "step": 97, "restrict": 97, "achiev": [97, 113], "analog": 97, "composit": [97, 99, 111], "nfkd": [97, 98, 99, 108, 111], "\u03c3\u03c4\u03c1\u03b9\u03b3\u03b3\u03b9": 97, "\u0441\u0442\u0440\u0438\u043d\u0433\u0438": 97, "u0105golewski": 97, "pl_fonipa": [97, 98], "mar\u025bk": 97, "\u0261\u0254\u014b\u0261\u0254l\u025bfski": 97, "u2620": 97, "skull": 97, "AND": 97, "crossbon": 97, "u201c": 97, "u2026": 97, "u201d": 97, "u015b": 97, "u017c": [97, 109], "nfc": [97, 98, 99, 103, 111], "\u0105\u015b\u0107\u017c": 97, "uc885": 97, "ub85c": 97, "uad6c": 97, "uc0ac": 97, "uc9c1": 97, "ub3d9": 97, "hangul": [97, 98, 103], "jonglogu": 97, "sajigdong": 97, "deviat": 97, "romanis": [97, 112], "romanization_of_korean": 97, "u11a8": 97, "u11a": 97, "u11b8": 97, "u1105": 97, "jongrogu": 97, "sajikdong": 97, "am_brai": 98, "am_ethi": 98, "gemin": 98, "d0_mors": 98, "am_fonipa": 98, "am_latn": 98, "bgn": 98, "amhar": 98, "ar_latn": 98, "armenian": 98, "armn": 98, "be_latn": 98, "beng": 98, "bengali": 98, "bg_latn": 98, "blt_fonipa": 98, "bopo": 98, "bopomofo": 98, "braill": 98, "byn_ethi": 98, "tekie_alibekit": 98, "xaleget": 98, "byn_latn": 98, "canadianaborigin": 98, "ch_fonipa": 98, "chr_fonipa": 98, "cs_fonipa": 98, "cy_fonipa": 98, "cyrl": 98, "gutgart": 98, "deva": [98, 112], "devanagari": 98, "dsb_fonipa": 98, "dv_latn": 98, "el_latn": 98, "eo_fonipa": 98, "es_419_fonipa": 98, "es_fonipa": 98, "ethi": 98, "ethiop": 98, "aethiopica": 98, "alaloc": 98, "beta_metsehaf": 98, "ies_jes_1964": 98, "lambdin": 98, "sera": 98, "williamson": 98, "xalaget": 98, "fa_fonipa": 98, "fa_latn": 98, "fcc": 98, "geor": 98, "ungegn": 98, "grek": 98, "gujarati": 98, "gujr": 98, "gurmukhi": 98, "guru": [98, 112], "gz_ethi": 98, "hang": 98, "han": 98, "hant": 98, "he_latn": 98, "hebr": 98, "xml10": 98, "hira": 98, "hy_arevmda_fonipa": 98, "hy_fonipa": 98, "hy_latn": 98, "ia_fonipa": 98, "jamo": [98, 103], "ka_latn": 98, "bgn_1981": 98, "kannada": 98, "kk_fonipa": 98, "kk_latn": 98, "knda": 98, "ky_fonipa": 98, "ky_latn": 98, "la_fonipa": 98, "latn": 98, "malayalam": 98, "mk_latn": 98, "mlym": 98, "mn_latn": 98, "my_fonipa": 98, "my_latn": 98, "nfkc": [98, 99, 108, 111], "nv_fonipa": 98, "oriya": 98, "orya": [98, 112], "ps_latn": 98, "rm_fonipa_sursilv": 98, "ro_fonipa": 98, "ru_latn": 98, "sarb": 98, "sat_fonipa": 98, "sgw_ethi": 98, "gurage_2013": 98, "si_fonipa": 98, "si_latn": 98, "sk_fonipa": 98, "syrc": 98, "syriac": 98, "ta_fonipa": 98, "tamil": [98, 112], "taml": [98, 112], "telu": 98, "telugu": 98, "thaa": 98, "thaana": 98, "ug_fonipa": 98, "uk_latn": 98, "und_fonipa": [98, 112], "und_fonxsamp": 98, "vec_fonipa": 98, "xh_fonipa": 98, "zu_fonipa": 98, "azerbaijani": 98, "belarusian": 98, "blt": 98, "bulgarian": 98, "burmes": 98, "tone": 98, "dv": 98, "aethiopi": 98, "aethiopi_gemin": 98, "alaloc_gemin": 98, "beta_metsehaf_gemin": 98, "es3842": 98, "ies_jes_1964_gemin": 98, "gurag": 98, "aethiopica_gemin": 98, "betametsehaf_gemin": 98, "fullwidth": 98, "geez": 98, "musnad": 98, "hani": 98, "hy_arevmda": 98, "xsampa": 98, "ja_hrkt": 98, "ja_latn": 98, "kazakh": 98, "kirghiz": 98, "ko_latn": 98, "la": [98, 112], "numericpinyin": 98, "macedonian": 98, "maldivian": 98, "mongolian": 98, "zawgyi": 98, "pinyin": 98, "nv": 98, "pashto": 98, "rm_sursilv": 98, "serbian": [98, 108], "tk_cyrl": 98, "tlh": 98, "tlh_fonipa": 98, "turkmen": 98, "ukrainian": 98, "uzbek": 98, "zh_latn_pinyin": 98, "nfkc_casefold": 99, "stri_trans_nfkc": 99, "stri_trans_nfkc_casefold": 99, "stri_trans_isnfc": 99, "stri_trans_isnfd": 99, "stri_trans_isnfkd": 99, "stri_trans_isnfkc": 99, "stri_trans_isnfkc_casefold": 99, "formal": [99, 103], "essenti": 99, "decomposit": [99, 108, 111], "nf": 99, "w3c": 99, "aris": 99, "web": [99, 110], "rfc5198": 99, "tr15": 99, "network": 99, "w3": 99, "charmod": 99, "norm": 99, "unicode_equival": 99, "codepoint": [99, 108], "\u0635\u0644\u0649": 99, "\u0627\u0644\u0644\u0647": 99, "\u0639\u0644\u064a\u0647": 99, "\u0648\u0633\u0644\u0645": 99, "unnecessari": 100, "stri_trim_right": 100, "contrari": [100, 104, 111, 113], "retain": 100, "adjust": 100, "bitcoin": 100, "mask": 101, "0x1f": 101, "bewar": 101, "u0032": 101, "a\u0105": 101, "\u0105": [102, 108, 109, 111, 113], "gro\u00df": [102, 107, 108, 112, 113], "mono": 103, "font": [103, 106, 111], "cl": 103, "cam": 103, "mgk25": 103, "wcwidth": 103, "nodej": 103, "node": [103, 110], "blob": 103, "node_i18n": 103, "uax": 103, "proce": 103, "medial": 103, "vowel": 103, "conson": 103, "enumer": [103, 109, 113], "uchar_hangul_syllable_typ": 103, "u_hst_vowel_jamo": 103, "u_hst_trailing_jamo": 103, "200b": [103, 106], "u_ea_fullwidth": 103, "u_ea_wid": 103, "00ad": 103, "asian": 103, "tr11": 103, "u0001f606": 103, "0x3000": 103, "0xff01": 103, "0xff5e": 103, "ubc1f": 103, "cost_expon": [104, 112], "reformat": 104, "expon": 104, "aesthet": 104, "subsequ": [104, 106], "arrang": 104, "evenli": 104, "plass": [104, 114], "practic": [104, 114], "1981": [104, 114], "pp": 104, "writelin": 105, "noteworthi": [105, 109, 113], "review": 106, "entiti": [106, 108], "\u4f60\u597d": 106, "carri": [106, 113], "4f60": 106, "597d": 106, "greet": 106, "compris": [106, 108, 113], "5th": [106, 109], "undefin": 106, "sweav": [106, 112], "knitr": [106, 112, 114], "estim": 106, "occupi": 106, "monospac": 106, "cell": [106, 110], "said": 106, "tasti": 106, "delici": 106, "yummi": 106, "y2a": 106, "z3a": 106, "x4a": 106, "y5a": 106, "z6a": 106, "paste0": 106, "x_1_a": 106, "y_2_a": 106, "z_3_a": 106, "x_4_a": 106, "y_5_a": 106, "z_6_a": 106, "implicitli": 106, "graham": [106, 109], "chapman": [106, 109, 114], "clees": [106, 109], "terri": [106, 109], "gilliam": [106, 109], "eric": [106, 109], "idl": [106, 109], "michael": [106, 109], "palin": [106, 109], "outer": [106, 109, 113], "product": [106, 109], "bb": 106, "dddd": 106, "negg": 106, "buckwheat": 106, "fulfil": 106, "essenc": 106, "18th": 106, "12th": 106, "15th": 106, "deeper": 106, "sorghum": 106, "orgh": 106, "ghu": 106, "flexibl": 106, "stri_sub_list": 106, "fed": 106, "from_to": 106, "label": [106, 110], "ncol": [106, 109, 110], "abcdefgh": 106, "ijklmnop": 106, "op": 106, "gh": 106, "mapa": 106, "anobc": 106, "uvw": 106, "axcd": 106, "abcuvw": 106, "uu": 106, "wwww": 106, "azcz": 106, "uuabvewwww": 106, "7th": [106, 109], "syntact": 106, "sugar": 106, "face": 107, "nucleotid": 107, "dna": 107, "profil": 107, "uuid": 107, "simplic": [107, 109], "quickli": 107, "manner": [107, 109, 111, 113], "actg": [107, 109, 112], "actga": 107, "five": 107, "operand": [107, 109], "kmp": 107, "notabl": 107, "descript": 107, "soon": [107, 113], "abcabcdefabcabcabdc": 107, "grep": [107, 113], "needl": [107, 109], "haystack": [107, 109], "redirect": 107, "simplist": 107, "actgacgacgggacg": 107, "acg": 107, "acatgacaca": 107, "xyzabc": 107, "uabdc": 107, "dab": [107, 109], "why": 107, "specialis": [107, 112], "respons": 107, "twice": [107, 109], "particularli": 107, "programmat": 107, "fly": 107, "pinpoint": [107, 110, 113], "agagagagaga": 107, "yearn": 107, "answer": 107, "constitut": [107, 108, 111], "fine": 107, "ggagagagagaca": 107, "agagagaga": 107, "gaca": 107, "yellow": 107, "hen": 107, "spamiti": [107, 112, 113], "llama": 107, "supersed": 107, "repeat": [107, 113], "forth": [107, 109, 110, 113], "nlp": 107, "extent": [107, 109], "anchor": 107, "pointwis": [108, 113], "involv": 108, "nowadai": [108, 113], "approach": 108, "basi": [108, 113], "meet": 108, "proceed": 108, "parameteris": 108, "speaker": 108, "eng": 108, "spa": [108, 113], "spanish": [108, 113], "zho": 108, "masai": 108, "lack": 108, "vocabulari": 108, "measur": 108, "toward": 108, "de_de_preeuro": 108, "deutsch": 108, "dem": 108, "high": [108, 109, 110, 111], "chosen": 108, "gnu": [108, 109], "sporad": 108, "2021": [108, 111, 112], "metric": 108, "WITH": 108, "0061": [108, 113], "0328": 108, "render": 108, "glyph": 108, "u0328": [108, 111], "g\u0105golewski": [108, 113], "u0328golewski": 108, "chaotic": 108, "ch\u0142odni": 108, "hardi": 108, "goe": 108, "beyond": 108, "contract": 108, "cichi": 108, "cenni": 108, "expans": 108, "german_k_word": 108, "k\u00f6nnen": 108, "kondensieren": 108, "kochen": 108, "korrelieren": 108, "phone": 108, "book": 108, "\u00f6": 108, "oe": 108, "go": 108, "neglig": 108, "attent": 108, "fb00": 108, "nest": 108, "inter": 108, "strongest": 108, "mismatch": 108, "deem": 108, "u1e9": 108, "\u00df": [108, 113], "csa": 108, "z243": 108, "cote": 108, "c\u00f4te": 108, "cot\u00e9": 108, "c\u00f4t\u00e9": 108, "immedi": 108, "a11": 108, "a99": 108, "a10": 108, "a100": 108, "a9": 108, "nonneg": 108, "dealt": 108, "528105": 108, "940467": 108, "408977": 108, "045556": 108, "551435": 108, "456615": 108, "788305": 108, "892419": 108, "287578": 108, "883017": 108, "decreasingli": 108, "looser": 108, "\u00bc": 108, "00bc": 108, "\u211d": 108, "favourit": 108, "fuzzi": 108, "stringdist": 108, "utilis": 108, "albeit": 108, "er": [108, 113], "je": 108, "help": [108, 112, 113], "polish_poland": [108, 109], "rhl": 108, "fairli": 109, "2012": 109, "thin": 109, "ground": 109, "abund": 109, "workhors": 109, "safe": 109, "namespac": 109, "clash": 109, "self": 109, "explanatori": 109, "enter": 109, "apostroph": 109, "classic": 109, "scalar": 109, "typeof": 109, "strategi": 109, "loop": 109, "maintain": [109, 113], "ariti": 109, "oftentim": [109, 113], "crucial": 109, "prototyp": 109, "strrep": 109, "mappli": 109, "multipli": 109, "obviou": [109, 111], "unawar": 109, "unintuit": 109, "illustr": 109, "abcabc": 109, "abdc": 109, "abcdeabc": 109, "grid": 109, "nrow": [109, 110], "aab": 109, "abb": 109, "acb": 109, "aac": 109, "acc": 109, "baa": [109, 113], "bba": 109, "bca": 109, "bbb": 109, "bcb": 109, "bac": 109, "bbc": 109, "bcc": 109, "caa": 109, "cca": 109, "cab": 109, "cbb": 109, "ccb": 109, "cac": 109, "cbc": 109, "dimnam": [109, 110, 113], "flat": 109, "fortran": 109, "sought": [109, 113], "8th": 109, "6th": 109, "9th": 109, "structur": [109, 110, 111, 113], "cartesian": 109, "bx2": 109, "cx1": 109, "prone": 109, "jam": [109, 113], "grepl": 109, "furthermor": [109, 113], "despit": 109, "reduc": 109, "coher": 109, "coverag": 109, "tradition": 109, "scope": 109, "plenti": 109, "pcre": [109, 113], "setlocal": 109, "gregexpr": [109, 113], "tre": [109, 113], "aezaez\u0105\u0119\u017c\u0105\u0119\u017c": 109, "aezaez": 109, "u0118": 109, "u017b": 109, "\u0119": 109, "\u017c": 109, "author": [109, 113], "scratch": 109, "microbenchmark": 109, "join2": 109, "join3": 109, "r_paste2": 109, "r_paste3": 109, "expr": 109, "lq": 109, "median": 109, "uq": 109, "neval": 109, "064": 109, "088": 109, "acca": 109, "r_tre": 109, "r_pcre": 109, "r_fix": 109, "9861": 109, "0658": 109, "1497": 109, "1666": 109, "4805": 109, "5586": 109, "5049": 109, "6874": 109, "1632": 109, "6454": 109, "9504": 109, "4606": 109, "9660": 109, "3722": 109, "0878": 109, "4128": 109, "8794": 109, "7429": 109, "0573": 109, "8115": 109, "2062": 109, "8814": 109, "5560": 109, "8478": 109, "7709": 109, "9305": 109, "0572": 109, "061": 109, "1899": 109, "3638": 109, "themself": 109, "scienc": [109, 114], "expos": 109, "pick": 109, "studi": 110, "scrape": 110, "analys": [110, 111, 113], "climat": 110, "settlement": 110, "lists_of_c": 110, "harvest": 110, "relev": 110, "temperatur": 110, "precipit": 110, "harm": 110, "focu": 110, "vic": 110, "xml2": 110, "rvest": 110, "2020": [110, 112, 113], "tree": [110, 111], "read_html": 110, "20200917_wikipedia_melbourn": 110, "all_tabl": 110, "text_tabl": 110, "html_node": 110, "html_text": 110, "len": 110, "strict": 110, "preview": 110, "melbournevictoriafrom": 110, "flind": 110, "__truncated__": 110, "temp": 110, "annual": 110, "rainfal": 110, "offic": 110, "birth": 110, "birthplac": 110, "npop": 110, "idx": 110, "html_tabl": 110, "record": 110, "averag": 110, "daili": 110, "low": [110, 113], "inch": 110, "raini": 110, "1mm": 110, "afternoon": 110, "humid": 110, "monthli": 110, "sunshin": 110, "bureau": 110, "meteorologi": 110, "evid": [110, 113], "subject": 110, "sake": 110, "2212": 110, "difficult": [110, 112], "simpler": 110, "comma": 110, "jun": 110, "2191": 110, "dispos": [110, 113], "jul": 110, "sum": 110, "6463": 110, "chart": 111, "popular": 111, "setdiff": 111, "0x10ffff": 111, "0xd800": 111, "0xf8ff": 111, "131241": 111, "2155": 111, "1791": 111, "7564": 111, "134564": 111, "unalloc": 111, "occasion": 111, "recent": 111, "supplement": 111, "007f": [111, 113], "007a": [111, 113], "u007a": 111, "u0000007a": 111, "z\u00df\u4f60\u597d": 111, "u4f60": 111, "u597d": 111, "devic": 111, "unabl": 111, "ram": 111, "disk": 111, "abz0\u0105\u00df\u4f60\u597d": 111, "7a": 111, "c3": 111, "9f": 111, "e4": 111, "bd": 111, "a0": 111, "e5": 111, "a5": 111, "df": 111, "4f": [111, 112], "7d": 111, "scan": 111, "associ": 111, "importantli": 111, "proven": 111, "pipelin": 111, "w3tech": 111, "nevertheless": [111, 112, 113], "es_latin1": 111, "head": 111, "canto": 111, "cal\u00edop": 111, "miguel": 111, "cervant": 111, "al": [111, 113], "dulc": 111, "son": 111, "templada": 111, "lira": 111, "prestad": 111, "pastor": 111, "o\u00eddo": 111, "atento": 111, "aid": 111, "4e": 111, "4c": 111, "2d": 111, "Then": 111, "chanc": 111, "destin": 111, "tail": 111, "spoiler": 111, "alert": 111, "homero": 111, "iguala": 111, "escrebir": 111, "intenta": 111, "tanto": 111, "llega": 111, "pluma": 111, "vuelo": 111, "cuanto": 111, "verdad": 111, "que": 111, "todo": 111, "notorio": 111, "alto": 111, "ingenio": 111, "don": 111, "diego": 111, "osorio": 111, "ve": 111, "idea": 111, "url": [111, 113, 114], "distinct": [111, 113], "subscript": 111, "superscript": 111, "r\u00b2": 111, "r2": 111, "runtim": 111, "okai": 111, "sequel": 112, "segment": 112, "stri_extract__boundari": 112, "stri_locate__boundari": 112, "stri_extract__word": 112, "hovercraft": 112, "eel": 112, "pretti": 112, "reach": 112, "centr": 112, "love": 112, "minimis": 112, "rewrit": 112, "u200b\u0105\u00df\u00b2": 112, "\u0105\u00df\u00b2": 112, "1416": 112, "placehold": 112, "uniformli": 112, "ct": 112, "agtg": 112, "ctcgg": 112, "ataact": 112, "\uff90\uff6e\u31ff\ud82c\udd67\uff67\uff71\u30fe\u31f7": 112, "broad": 112, "ii\u0307": 112, "\u0131i": 112, "ijsvrij": 112, "yoghurt": 112, "gataaatctggtcttatttcc": 112, "ctatttagaccagaataaagg": 112, "catalogu": 112, "brows": 112, "\u017c\u00f3\u0142\u0107": 112, "ni\u00f1a": 112, "k\u00f6sz\u00f6n\u00f6m": 112, "zolc": 112, "nina": 112, "koszonom": 112, "godz": 112, "easi": 112, "datetime_relative_long": 112, "tomorrow": 112, "nzdt": 112, "5780": 112, "5781": 112, "date_ful": 112, "\u4ee4\u548c2\u5e742\u67084\u65e5\u706b\u66dc\u65e5": 112, "\u4ee4\u548c2\u5e748\u67087\u65e5\u91d1\u66dc\u65e5": 112, "grammar": 113, "systemat": 113, "scientif": 113, "telephon": [113, 114], "email": 113, "finit": [113, 114], "automata": [113, 114], "present": 113, "qed": [113, 114], "predecessor": 113, "pcre2": 113, "ore": 113, "re2r": 113, "re2": 113, "although": 113, "facet": 113, "recurs": 113, "kate": 113, "eclips": 113, "vscode": 113, "rstudio": 113, "instrument": 113, "scientist": 113, "summaris": 113, "perspect": 113, "suffix": 113, "unrecognis": 113, "trigger": 113, "straightforward": 113, "doesn": 113, "behav": 113, "backlash": 113, "unescap": 113, "ham": 113, "njam": 113, "motiv": 113, "member": 113, "mathtt": 113, "hj": 113, "nobodi": 113, "inquisit": 113, "nob": 113, "odi": 113, "ni": 113, "inq": 113, "ui": 113, "iti": 113, "assign": 113, "fun": 113, "nicod": 113, "a\u0105b\u00df\u00e6a\u0105b\u4f60123": 113, "\u00b2\u00b3\u00be": 113, "\u00e6": 113, "\u4f60": 113, "\u00b2": 113, "\u00b3": 113, "\u00be": 113, "regmatch": 113, "belonging": 113, "reader": 113, "branch": 113, "alga": 113, "amalgam": 113, "dent": 113, "sp": 113, "question": 113, "parser": 113, "sophist": 113, "subfrag": 113, "presenc": 113, "baaa": 113, "bababa": 113, "altogeth": 113, "spamamamnomnomnomammmmmmmmm": 113, "nom": 113, "spamamamnomnomnomam": 113, "stress": 113, "901234": 113, "nondeterminist": 113, "automaton": 113, "exponenti": 113, "aaaaac": 113, "trycatch": 113, "1e5": 113, "elaps": 113, "reformul": 113, "consum": 113, "characterist": 113, "sir": 113, "launcelot": 113, "quest": 113, "grail": 113, "favecolour": 113, "blue": 113, "stri_locate__regex": 113, "caught": 113, "dollar": 113, "strong": 113, "em": 113, "tag": 113, "tagnam": 113, "lastli": 113, "anywher": 113, "didact": 113, "j23": 113, "629cm": 113, "research": 114, "2023": 114, "zenodo": 114, "isbn": 114, "6455719": 114, "deepr": 114, "5281": 114, "7490464": 114, "hock": 114, "2019": 114, "namedcaptur": 114, "hopcroft": 114, "ullman": 114, "1979": 114, "theori": 114, "addison": 114, "weslei": 114, "kleen": 114, "1951": 114, "event": 114, "nerv": 114, "rand": 114, "corpor": 114, "santa": 114, "monica": 114, "dam": 114, "pub": 114, "research_memoranda": 114, "rm704": 114, "1977": 114, "siam": 114, "rabin": 114, "scott": 114, "1959": 114, "decis": 114, "ritchi": 114, "thompson": 114, "70107": 114, "laboratori": 114, "wayback": 114, "20150203071645": 114, "cm": 114, "lab": 114, "dmr": 114, "qedman": 114, "2010": 114, "odern": 114, "\u00e7etinkaya": 114, "rundel": 114, "grolemund": 114, "r4d": 114, "xie": 114, "hall": 114, "crc": 114}, "objects": {}, "objtypes": {}, "objnames": {}, "titleterms": {"stringi": [0, 1, 3, 6, 12], "fast": [0, 13], "portabl": [0, 13], "charact": [0, 5, 9, 12, 13, 14, 30, 31, 33, 37, 51, 54, 75, 77, 87, 88, 89, 96, 100, 111, 112, 113], "string": [0, 7, 10, 13, 15, 17, 24, 28, 38, 41, 42, 43, 44, 48, 50, 52, 61, 68, 70, 71, 75, 78, 79, 80, 82, 83, 84, 85, 86, 95, 100, 106, 107, 108, 111, 112, 113], "process": [0, 1, 13], "r": [0, 3, 5, 13, 109], "instal": 1, "icu4c": 1, "customis": 1, "build": 1, "get": [1, 22, 25, 38], "help": 1, "changelog": 2, "1": 2, "8": [2, 5, 36, 43], "4": 2, "2024": 2, "05": 2, "06": 2, "3": 2, "2023": 2, "12": 2, "10": 2, "2": 2, "11": 2, "22": 2, "09": 2, "7": 2, "01": 2, "2022": 2, "07": 2, "6": 2, "2021": 2, "29": 2, "5": 2, "04": 2, "08": 2, "15": 2, "14": 2, "2020": 2, "02": 2, "17": 2, "2019": 2, "03": 2, "2018": 2, "20": 2, "16": [2, 5, 35], "2017": 2, "21": 2, "2016": 2, "30": 2, "25": 2, "0": 2, "2015": 2, "28": 2, "2014": 2, "24": 2, "23": 2, "19": 2, "2013": 2, "13": 2, "packag": 3, "refer": [3, 5, 6, 8, 9, 10, 12, 13, 17, 20, 23, 26, 29, 30, 44, 63, 64, 65, 66, 67, 72, 80, 81, 84, 85, 93, 94, 95, 97, 98, 99, 102, 103, 104, 113, 114], "about_argu": 4, "descript": [4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105], "coercion": 4, "argument": [4, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 99, 100, 101, 102, 103, 104, 105], "vector": [4, 14, 51, 75, 77, 87, 88, 89, 106], "handl": 4, "miss": [4, 77, 109], "valu": [4, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 109], "na": [4, 61], "preserv": 4, "object": [4, 21], "attribut": 4, "author": [4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105], "": [4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106], "see": [4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 114], "also": [4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 114], "about_encod": 5, "detail": [5, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 76, 77, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 99, 100, 101, 102, 103, 104, 105], "utf": [5, 32, 35, 36, 42, 43], "encod": [5, 31, 33, 37, 38, 41, 44, 111], "span": [5, 6, 12], "class": [5, 6, 9, 12, 113], "rlang": 5, "convers": 5, "detect": [5, 27, 30, 31, 107, 111], "about_local": 6, "local": [6, 10, 31, 55, 56, 108], "identifi": [6, 93], "A": [6, 69, 108], "note": [6, 108, 113], "default": [6, 108], "sensit": [6, 31], "function": [6, 12, 106], "pkg": [6, 12], "about_search": 7, "search": [7, 10, 65, 107, 108], "about_search_boundari": 8, "about_search_charclass": 9, "unicodeset": 9, "pattern": [9, 18, 27, 46, 58, 60, 65, 76, 82, 86, 91, 107], "unicod": [9, 45, 99, 111], "properti": 9, "gener": [9, 63, 64, 65, 66, 69, 71, 87, 97, 109, 112], "categori": 9, "binari": [9, 16], "posix": [9, 113], "about_search_col": 10, "awar": 10, "engin": [10, 65, 107], "about_search_fix": 11, "byte": [11, 62], "compar": [11, 15, 17, 107], "about_search_regex": 12, "icu": 12, "regex": [12, 60, 66], "oper": [12, 16, 106, 112, 113], "glanc": 12, "meta": 12, "about_stringi": 13, "facil": 13, "avail": [13, 56, 93, 98], "operator_add": 14, "concaten": [14, 51, 52], "two": 14, "usag": [14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105], "exampl": [14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 26, 27, 28, 29, 30, 34, 36, 37, 45, 46, 47, 48, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 64, 65, 66, 67, 68, 69, 70, 71, 72, 75, 76, 77, 79, 80, 81, 82, 83, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 110], "operator_compar": 15, "without": [15, 17], "collat": [15, 17, 64, 108], "operator_dollar": 16, "stri_compar": 17, "stri_count": 18, "count": [18, 19, 53, 62, 107], "number": [18, 19, 53, 62], "occurr": [18, 27, 46, 58, 76, 107], "stri_count_boundari": 19, "text": [19, 47, 59, 73, 74, 83, 84, 97, 98, 104, 105, 111, 112], "boundari": [19, 47, 59, 83, 112, 113], "stri_datetime_add": 20, "date": [20, 21, 22, 23, 25, 26, 112], "time": [20, 21, 22, 23, 25, 26, 92, 93, 112], "arithmet": 20, "stri_datetime_cr": 21, "creat": 21, "stri_datetime_field": 22, "field": 22, "stri_datetime_format": 23, "format": [23, 24, 26, 85, 104, 112], "pars": [23, 112], "stri_datetime_fstr": 24, "style": [24, 78], "stri_datetime_now": 25, "current": 25, "stri_datetime_symbol": 26, "list": [26, 37, 52, 54, 56, 63, 64, 65, 66, 93, 98, 106, 108], "localiz": 26, "data": [26, 34, 35, 36, 47, 109, 110], "stri_detect": 27, "stri_dup": 28, "duplic": [28, 29, 106], "stri_dupl": 29, "determin": [29, 50, 86, 103], "element": [29, 91, 102], "stri_enc_detect": 30, "set": [30, 63, 64, 65, 66, 113], "languag": 30, "stri_enc_detect2": 31, "deprec": 31, "stri_enc_fromutf32": 32, "convert": [32, 40, 41, 42, 43, 44, 54, 78, 111], "from": [32, 73, 75, 89, 100, 106, 109], "32": [32, 35, 42], "stri_enc_info": 33, "queri": [33, 55, 92, 108], "stri_enc_isascii": 34, "check": [34, 35, 36, 99], "If": [34, 35, 36], "stream": [34, 35, 36], "i": [34, 35, 36, 50], "possibli": [34, 35, 36], "ascii": [34, 40], "stri_enc_isutf16": 35, "stri_enc_isutf8": 36, "stri_enc_list": 37, "known": 37, "stri_enc_mark": 38, "declar": 38, "each": [38, 70, 79], "stri_enc_set": 39, "stri_enc_toascii": 40, "To": [40, 41, 42, 43, 106], "stri_enc_ton": 41, "nativ": 41, "stri_enc_toutf32": 42, "stri_enc_toutf8": 43, "stri_encod": 44, "between": [44, 47, 111, 112], "given": [44, 55, 91, 92], "stri_escape_unicod": 45, "escap": [45, 101], "code": [45, 53, 70, 103, 106, 107, 111, 113], "point": [45, 53, 70, 103, 106, 111, 113], "stri_extract": 46, "extract": [46, 47, 60, 89, 90, 102, 106, 107, 113], "stri_extract_boundari": 47, "stri_flatten": 48, "flatten": [48, 106], "stri_info": 49, "stri_isempti": 50, "length": [50, 106], "zero": 50, "stri_join": 51, "stri_join_list": 52, "stri_length": 53, "stri_list2matrix": 54, "matrix": 54, "stri_locale_info": 55, "stri_locale_list": 56, "stri_locale_set": 57, "stri_loc": 58, "locat": [58, 59, 107, 113], "stri_locate_boundari": 59, "stri_match": 60, "match": [60, 82, 86, 91, 107, 113], "togeth": 60, "captur": [60, 113], "group": [60, 113], "stri_na2empti": 61, "replac": [61, 76, 77, 78, 89, 90, 106, 107, 113], "empti": [61, 75], "stri_numbyt": 62, "stri_opts_brkit": 63, "breakiter": 63, "stri_opts_col": 64, "stri_opts_fix": 65, "fix": [65, 107, 108], "stri_opts_regex": 66, "matcher": 66, "stri_ord": 67, "order": [67, 108], "permut": [67, 106], "stri_pad": 68, "pad": [68, 112], "center": 68, "left": [68, 100], "right": [68, 100], "align": 68, "stri_rand_lipsum": 69, "lorem": 69, "ipsum": 69, "stri_rand_shuffl": 70, "randomli": 70, "shuffl": 70, "stri_rand_str": 71, "random": [71, 112], "stri_rank": 72, "rank": 72, "stri_read_lin": 73, "read": [73, 74, 111], "line": [73, 84, 105], "file": [73, 74, 105, 111], "stri_read_raw": 74, "raw": 74, "stri_remove_empti": 75, "remov": 75, "all": [75, 101], "stri_replac": 76, "stri_replace_na": 77, "stri_replace_rstr": 78, "gsub": 78, "stri_revers": 79, "revers": 79, "stri_sort": 80, "sort": [80, 81, 108], "stri_sort_kei": 81, "kei": 81, "stri_split": 82, "split": [82, 83, 84, 107], "By": 82, "stri_split_boundari": 83, "stri_split_lin": 84, "Into": 84, "stri_sprintf": 85, "stri_startsendswith": 86, "start": 86, "end": [86, 113], "stri_stats_gener": 87, "statist": [87, 88], "stri_stats_latex": 88, "contain": 88, "latex": 88, "command": 88, "stri_sub": 89, "substr": [89, 90, 106], "In": [89, 106], "stri_sub_al": [90, 106], "multipl": 90, "stri_subset": 91, "select": 91, "stri_timezone_info": 92, "zone": [92, 93], "stri_timezone_list": 93, "stri_timezone_set": 94, "stri_trans_casemap": 95, "transform": [95, 97, 98, 112], "case": [95, 108, 110, 112], "map": [95, 112], "fold": 95, "stri_trans_char": 96, "translat": 96, "stri_trans_gener": 97, "includ": 97, "transliter": [97, 98, 112], "stri_trans_list": 98, "stri_trans_nf": 99, "perform": [99, 113], "For": 99, "normal": 99, "stri_trim": 100, "trim": [100, 112], "side": 100, "stri_unescape_unicod": 101, "un": 101, "sequenc": 101, "stri_uniqu": 102, "uniqu": 102, "stri_width": 103, "width": [103, 106], "stri_wrap": 104, "word": [104, 112, 113], "wrap": [104, 112], "paragraph": 104, "stri_write_lin": 105, "write": [105, 111], "basic": 106, "comput": 106, "join": 106, "generalis": 106, "within": 106, "index": 106, "matric": 106, "place": 106, "pointwis": 107, "test": [107, 108], "equal": 107, "option": [107, 108], "subset": 107, "specifi": 108, "specif": [108, 112], "servic": 108, "equival": 108, "linear": 108, "strength": 108, "ignor": 108, "some": 108, "punctuat": 108, "backward": 108, "secondari": 108, "numer": 108, "compat": 108, "revisit": 108, "design": 109, "principl": 109, "name": 109, "vectoris": 109, "act": 109, "elementwis": 109, "recycl": 109, "flow": 109, "further": 109, "deviat": 109, "base": 109, "us": [110, 113], "prepar": 110, "input": 111, "output": 111, "deal": 111, "normalis": 111, "other": 112, "analys": 112, "appli": 112, "templat": 112, "regular": 113, "express": 113, "individu": 113, "ani": 113, "defin": 113, "complement": 113, "rang": 113, "predefin": 113, "avoid": 113, "altern": 113, "subexpress": 113, "non": 113, "parenthes": 113, "quantifi": 113, "thereto": 113, "back": 113, "referenc": 113, "anchor": 113, "begin": 113, "look": 113, "behind": 113, "ahead": 113, "how": 114, "cite": 114, "bibliographi": 114}, "envversion": {"sphinx.domains.c": 3, "sphinx.domains.changeset": 1, "sphinx.domains.citation": 1, "sphinx.domains.cpp": 9, "sphinx.domains.index": 1, "sphinx.domains.javascript": 3, "sphinx.domains.math": 2, "sphinx.domains.python": 4, "sphinx.domains.rst": 2, "sphinx.domains.std": 2, "sphinxcontrib.bibtex": 9, "sphinx": 60}, "alltitles": {"stringi: Fast and Portable Character String Processing in R": [[0, "stringi-fast-and-portable-character-string-processing-in-r"]], "Installing stringi": [[1, "installing-stringi"]], "ICU4C": [[1, "icu4c"]], "Customising the Build Process": [[1, "customising-the-build-process"]], "Getting Help": [[1, "getting-help"]], "Changelog": [[2, "changelog"]], "1.8.4 (2024-05-06)": [[2, "id1"]], "1.8.3 (2023-12-10)": [[2, "id2"]], "1.8.2 (2023-11-22)": [[2, "id3"]], "1.8.1 (2023-11-09)": [[2, "id4"]], "1.7.12 (2023-01-09)": [[2, "id5"]], "1.7.8 (2022-07-11)": [[2, "id6"]], "1.7.6 (2021-11-29)": [[2, "id7"]], "1.7.5 (2021-10-04)": [[2, "id8"]], "1.7.4 (2021-08-12)": [[2, "id9"]], "1.7.3 (2021-07-15)": [[2, "id10"]], "1.7.2 (2021-07-14)": [[2, "id11"]], "1.7.1 (2021-07-14)": [[2, "id12"]], "1.6.2 (2021-05-14)": [[2, "id13"]], "1.6.1 (2021-05-05)": [[2, "id14"]], "1.5.3 (2020-09-04)": [[2, "id15"]], "1.4.6 (2020-02-17)": [[2, "id16"]], "1.4.5 (2020-01-11)": [[2, "id17"]], "1.4.4 (2020-01-06)": [[2, "id18"]], "1.4.3 (2019-03-12)": [[2, "id19"]], "1.3.1 (2019-02-10)": [[2, "id20"]], "1.2.4 (2018-07-20)": [[2, "id21"]], "1.2.3 (2018-05-16)": [[2, "id22"]], "1.2.2 (2018-05-01)": [[2, "id23"]], "1.1.7 (2018-03-06)": [[2, "id24"]], "1.1.6 (2017-11-10)": [[2, "id25"]], "1.1.5 (2017-04-07)": [[2, "id26"]], "1.1.3 (2017-03-21)": [[2, "id27"]], "1.1.2 (2016-09-30)": [[2, "id28"]], "1.1.1 (2016-05-25)": [[2, "id29"]], "1.0-1 (2015-10-22)": [[2, "id30"]], "0.5-5 (2015-06-28)": [[2, "id31"]], "0.5-2 (2015-06-21)": [[2, "id32"]], "0.4-1 (2014-12-11)": [[2, "id33"]], "0.3-1 (2014-11-06)": [[2, "id34"]], "0.2-5 (2014-05-16)": [[2, "id35"]], "0.2-4 (2014-05-15)": [[2, "id36"]], "0.2-3 (2014-05-14)": [[2, "id37"]], "0.1-25 (2014-03-12)": [[2, "id38"]], "0.1-24 (2014-03-11)": [[2, "id39"]], "0.1-23 (2014-03-11)": [[2, "id40"]], "0.1-22 (2014-02-20)": [[2, "id41"]], "0.1-21 (2014-02-19)": [[2, "id42"]], "0.1-20 (2014-02-17)": [[2, "id43"]], "0.1-11 (2013-11-16)": [[2, "id44"]], "0.1-10 (2013-11-13)": [[2, "id45"]], "0.1-6 (2013-07-05)": [[2, "id46"]], "0.1-1 (2013-01-05)": [[2, "id47"]], "R Package stringi Reference": [[3, "r-package-stringi-reference"]], "about_arguments:": [[4, "about-arguments"]], "Description": [[4, "description"], [5, "description"], [6, "description"], [7, "description"], [8, "description"], [9, "description"], [10, "description"], [11, "description"], [12, "description"], [13, "description"], [14, "description"], [15, "description"], [16, "description"], [17, "description"], [18, "description"], [19, "description"], [20, "description"], [21, "description"], [22, "description"], [23, "description"], [24, "description"], [25, "description"], [26, "description"], [27, "description"], [28, "description"], [29, "description"], [30, "description"], [31, "description"], [32, "description"], [33, "description"], [34, "description"], [35, "description"], [36, "description"], [37, "description"], [38, "description"], [39, "description"], [40, "description"], [41, "description"], [42, "description"], [43, "description"], [44, "description"], [45, "description"], [46, "description"], [47, "description"], [48, "description"], [49, "description"], [50, "description"], [51, "description"], [52, "description"], [53, "description"], [54, "description"], [55, "description"], [56, "description"], [57, "description"], [58, "description"], [59, "description"], [60, "description"], [61, "description"], [62, "description"], [63, "description"], [64, "description"], [65, "description"], [66, "description"], [67, "description"], [68, "description"], [69, "description"], [70, "description"], [71, "description"], [72, "description"], [73, "description"], [74, "description"], [75, "description"], [76, "description"], [77, "description"], [78, "description"], [79, "description"], [80, "description"], [81, "description"], [82, "description"], [83, "description"], [84, "description"], [85, "description"], [86, "description"], [87, "description"], [88, "description"], [89, "description"], [90, "description"], [91, "description"], [92, "description"], [93, "description"], [94, "description"], [95, "description"], [96, "description"], [97, "description"], [98, "description"], [99, "description"], [100, "description"], [101, "description"], [102, "description"], [103, "description"], [104, "description"], [105, "description"]], "Coercion of Arguments": [[4, "coercion-of-arguments"]], "Vectorization": [[4, "vectorization"]], "Handling Missing Values (NAs)": [[4, "handling-missing-values-nas"]], "Preserving Object Attributes": [[4, "preserving-object-attributes"]], "Author(s)": [[4, "author-s"], [5, "author-s"], [6, "author-s"], [7, "author-s"], [8, "author-s"], [9, "author-s"], [10, "author-s"], [11, "author-s"], [12, "author-s"], [13, "author-s"], [14, "author-s"], [15, "author-s"], [16, "author-s"], [17, "author-s"], [18, "author-s"], [19, "author-s"], [20, "author-s"], [21, "author-s"], [22, "author-s"], [23, "author-s"], [24, "author-s"], [25, "author-s"], [26, "author-s"], [27, "author-s"], [28, "author-s"], [29, "author-s"], [30, "author-s"], [31, "author-s"], [32, "author-s"], [33, "author-s"], [34, "author-s"], [35, "author-s"], [36, "author-s"], [37, "author-s"], [38, "author-s"], [39, "author-s"], [40, "author-s"], [41, "author-s"], [42, "author-s"], [43, "author-s"], [44, "author-s"], [45, "author-s"], [46, "author-s"], [47, "author-s"], [48, "author-s"], [49, "author-s"], [50, "author-s"], [51, "author-s"], [52, "author-s"], [53, "author-s"], [54, "author-s"], [55, "author-s"], [56, "author-s"], [57, "author-s"], [58, "author-s"], [59, "author-s"], [60, "author-s"], [61, "author-s"], [62, "author-s"], [63, "author-s"], [64, "author-s"], [65, "author-s"], [66, "author-s"], [67, "author-s"], [68, "author-s"], [69, "author-s"], [70, "author-s"], [71, "author-s"], [72, "author-s"], [73, "author-s"], [74, "author-s"], [75, "author-s"], [76, "author-s"], [77, "author-s"], [78, "author-s"], [79, "author-s"], [80, "author-s"], [81, "author-s"], [82, "author-s"], [83, "author-s"], [84, "author-s"], [85, "author-s"], [86, "author-s"], [87, "author-s"], [88, "author-s"], [89, "author-s"], [90, "author-s"], [91, "author-s"], [92, "author-s"], [93, "author-s"], [94, "author-s"], [95, "author-s"], [96, "author-s"], [97, "author-s"], [98, "author-s"], [99, "author-s"], [100, "author-s"], [101, "author-s"], [102, "author-s"], [103, "author-s"], [104, "author-s"], [105, "author-s"]], "See Also": [[4, "see-also"], [5, "see-also"], [6, "see-also"], [7, "see-also"], [8, "see-also"], [9, "see-also"], [10, "see-also"], [11, "see-also"], [12, "see-also"], [13, "see-also"], [14, "see-also"], [15, "see-also"], [16, "see-also"], [17, "see-also"], [18, "see-also"], [19, "see-also"], [20, "see-also"], [21, "see-also"], [22, "see-also"], [23, "see-also"], [24, "see-also"], [25, "see-also"], [26, "see-also"], [27, "see-also"], [28, "see-also"], [29, "see-also"], [30, "see-also"], [31, "see-also"], [32, "see-also"], [33, "see-also"], [34, "see-also"], [35, "see-also"], [36, "see-also"], [37, "see-also"], [38, "see-also"], [39, "see-also"], [40, "see-also"], [41, "see-also"], [42, "see-also"], [43, "see-also"], [44, "see-also"], [45, "see-also"], [46, "see-also"], [47, "see-also"], [48, "see-also"], [49, "see-also"], [50, "see-also"], [51, "see-also"], [52, "see-also"], [53, "see-also"], [54, "see-also"], [55, "see-also"], [56, "see-also"], [57, "see-also"], [58, "see-also"], [59, "see-also"], [60, "see-also"], [61, "see-also"], [62, "see-also"], [63, "see-also"], [64, "see-also"], [65, "see-also"], [66, "see-also"], [67, "see-also"], [68, "see-also"], [69, "see-also"], [70, "see-also"], [71, "see-also"], [72, "see-also"], [73, "see-also"], [74, "see-also"], [75, "see-also"], [76, "see-also"], [77, "see-also"], [78, "see-also"], [79, "see-also"], [80, "see-also"], [81, "see-also"], [82, "see-also"], [83, "see-also"], [84, "see-also"], [85, "see-also"], [86, "see-also"], [87, "see-also"], [88, "see-also"], [89, "see-also"], [90, "see-also"], [91, "see-also"], [92, "see-also"], [93, "see-also"], [94, "see-also"], [95, "see-also"], [96, "see-also"], [97, "see-also"], [98, "see-also"], [99, "see-also"], [100, "see-also"], [101, "see-also"], [102, "see-also"], [103, "see-also"], [104, "see-also"], [105, "see-also"], [114, "see-also"]], "about_encoding:": [[5, "about-encoding"]], "Details": [[5, "details"], [6, "details"], [7, "details"], [8, "details"], [9, "details"], [12, "details"], [13, "details"], [14, "details"], [15, "details"], [16, "details"], [17, "details"], [18, "details"], [19, "details"], [20, "details"], [21, "details"], [22, "details"], [23, "details"], [24, "details"], [25, "details"], [26, "details"], [27, "details"], [28, "details"], [29, "details"], [30, "details"], [31, "details"], [32, "details"], [33, "details"], [34, "details"], [35, "details"], [36, "details"], [37, "details"], [38, "details"], [39, "details"], [40, "details"], [41, "details"], [42, "details"], [43, "details"], [44, "details"], [45, "details"], [46, "details"], [47, "details"], [48, "details"], [50, "details"], [51, "details"], [52, "details"], [53, "details"], [54, "details"], [55, "details"], [56, "details"], [57, "details"], [58, "details"], [59, "details"], [60, "details"], [62, "details"], [63, "details"], [64, "details"], [65, "details"], [66, "details"], [67, "details"], [68, "details"], [69, "details"], [70, "details"], [71, "details"], [72, "details"], [73, "details"], [74, "details"], [76, "details"], [77, "details"], [79, "details"], [80, "details"], [81, "details"], [82, "details"], [83, "details"], [84, "details"], [85, "details"], [86, "details"], [87, "details"], [88, "details"], [89, "details"], [90, "details"], [91, "details"], [92, "details"], [93, "details"], [94, "details"], [95, "details"], [96, "details"], [97, "details"], [99, "details"], [100, "details"], [101, "details"], [102, "details"], [103, "details"], [104, "details"], [105, "details"]], "UTF-8 and UTF-16": [[5, "utf-8-and-utf-16"]], "Character Encodings in R": [[5, "character-encodings-in-r"]], "Encoding Conversion": [[5, "encoding-conversion"]], "Encoding Detection": [[5, "encoding-detection"]], "References": [[5, "references"], [6, "references"], [8, "references"], [9, "references"], [10, "references"], [12, "references"], [13, "references"], [17, "references"], [20, "references"], [23, "references"], [26, "references"], [29, "references"], [30, "references"], [44, "references"], [63, "references"], [64, "references"], [65, "references"], [66, "references"], [67, "references"], [72, "references"], [80, "references"], [81, "references"], [84, "references"], [85, "references"], [93, "references"], [94, "references"], [95, "references"], [97, "references"], [98, "references"], [99, "references"], [102, "references"], [103, "references"], [104, "references"], [114, "references"]], "about_locale:": [[6, "about-locale"]], "Locale Identifiers": [[6, "locale-identifiers"]], "A Note on Default Locales": [[6, "a-note-on-default-locales"]], "Locale-Sensitive Functions in stringi": [[6, "locale-sensitive-functions-in-stringi"]], "about_search: String Searching": [[7, "about-search-string-searching"]], "about_search_boundaries:": [[8, "about-search-boundaries"]], "about_search_charclass:": [[9, "about-search-charclass"]], "UnicodeSet patterns": [[9, "unicodeset-patterns"]], "Unicode properties": [[9, "unicode-properties"]], "Unicode General Categories": [[9, "unicode-general-categories"]], "Unicode Binary Properties": [[9, "unicode-binary-properties"]], "POSIX Character Classes": [[9, "posix-character-classes"]], "about_search_coll:": [[10, "about-search-coll"]], "Locale-Aware String Search Engine": [[10, "locale-aware-string-search-engine"]], "about_search_fixed:": [[11, "about-search-fixed"]], "Byte Compare": [[11, "byte-compare"]], "about_search_regex:": [[12, "about-search-regex"]], "ICU Regex Operators at a Glance": [[12, "icu-regex-operators-at-a-glance"]], "ICU Regex Meta-characters at a Glance": [[12, "icu-regex-meta-characters-at-a-glance"]], "Character Classes": [[12, "character-classes"]], "Regex Functions in stringi": [[12, "regex-functions-in-stringi"]], "about_stringi: Fast and Portable Character String Processing in R": [[13, "about-stringi-fast-and-portable-character-string-processing-in-r"]], "Facilities available": [[13, "facilities-available"]], "operator_add: Concatenate Two Character Vectors": [[14, "operator-add-concatenate-two-character-vectors"]], "Usage": [[14, "usage"], [15, "usage"], [16, "usage"], [17, "usage"], [18, "usage"], [19, "usage"], [20, "usage"], [21, "usage"], [22, "usage"], [23, "usage"], [24, "usage"], [25, "usage"], [26, "usage"], [27, "usage"], [28, "usage"], [29, "usage"], [30, "usage"], [31, "usage"], [32, "usage"], [33, "usage"], [34, "usage"], [35, "usage"], [36, "usage"], [37, "usage"], [38, "usage"], [39, "usage"], [40, "usage"], [41, "usage"], [42, "usage"], [43, "usage"], [44, "usage"], [45, "usage"], [46, "usage"], [47, "usage"], [48, "usage"], [49, "usage"], [50, "usage"], [51, "usage"], [52, "usage"], [53, "usage"], [54, "usage"], [55, "usage"], [56, "usage"], [57, "usage"], [58, "usage"], [59, "usage"], [60, "usage"], [61, "usage"], [62, "usage"], [63, "usage"], [64, "usage"], [65, "usage"], [66, "usage"], [67, "usage"], [68, "usage"], [69, "usage"], [70, "usage"], [71, "usage"], [72, "usage"], [73, "usage"], [74, "usage"], [75, "usage"], [76, "usage"], [77, "usage"], [78, "usage"], [79, "usage"], [80, "usage"], [81, "usage"], [82, "usage"], [83, "usage"], [84, "usage"], [85, "usage"], [86, "usage"], [87, "usage"], [88, "usage"], [89, "usage"], [90, "usage"], [91, "usage"], [92, "usage"], [93, "usage"], [94, "usage"], [95, "usage"], [96, "usage"], [97, "usage"], [98, "usage"], [99, "usage"], [100, "usage"], [101, "usage"], [102, "usage"], [103, "usage"], [104, "usage"], [105, "usage"]], "Arguments": [[14, "arguments"], [15, "arguments"], [16, "arguments"], [17, "arguments"], [18, "arguments"], [19, "arguments"], [20, "arguments"], [21, "arguments"], [22, "arguments"], [23, "arguments"], [24, "arguments"], [26, "arguments"], [27, "arguments"], [28, "arguments"], [29, "arguments"], [30, "arguments"], [31, "arguments"], [32, "arguments"], [33, "arguments"], [34, "arguments"], [35, "arguments"], [36, "arguments"], [37, "arguments"], [38, "arguments"], [39, "arguments"], [40, "arguments"], [41, "arguments"], [42, "arguments"], [43, "arguments"], [44, "arguments"], [45, "arguments"], [46, "arguments"], [47, "arguments"], [48, "arguments"], [49, "arguments"], [50, "arguments"], [51, "arguments"], [52, "arguments"], [53, "arguments"], [54, "arguments"], [55, "arguments"], [57, "arguments"], [58, "arguments"], [59, "arguments"], [60, "arguments"], [61, "arguments"], [62, "arguments"], [63, "arguments"], [64, "arguments"], [65, "arguments"], [66, "arguments"], [67, "arguments"], [68, "arguments"], [69, "arguments"], [70, "arguments"], [71, "arguments"], [72, "arguments"], [73, "arguments"], [74, "arguments"], [75, "arguments"], [76, "arguments"], [77, "arguments"], [78, "arguments"], [79, "arguments"], [80, "arguments"], [81, "arguments"], [82, "arguments"], [83, "arguments"], [84, "arguments"], [85, "arguments"], [86, "arguments"], [87, "arguments"], [88, "arguments"], [89, "arguments"], [90, "arguments"], [91, "arguments"], [92, "arguments"], [93, "arguments"], [94, "arguments"], [95, "arguments"], [96, "arguments"], [97, "arguments"], [99, "arguments"], [100, "arguments"], [101, "arguments"], [102, "arguments"], [103, "arguments"], [104, "arguments"], [105, "arguments"]], "Value": [[14, "value"], [15, "value"], [16, "value"], [17, "value"], [18, "value"], [19, "value"], [20, "value"], [21, "value"], [22, "value"], [23, "value"], [24, "value"], [25, "value"], [26, "value"], [27, "value"], [28, "value"], [29, "value"], [30, "value"], [31, "value"], [32, "value"], [33, "value"], [34, "value"], [35, "value"], [36, "value"], [37, "value"], [38, "value"], [39, "value"], [40, "value"], [41, "value"], [42, "value"], [43, "value"], [44, "value"], [45, "value"], [46, "value"], [47, "value"], [48, "value"], [49, "value"], [50, "value"], [51, "value"], [52, "value"], [53, "value"], [54, "value"], [55, "value"], [56, "value"], [57, "value"], [58, "value"], [59, "value"], [60, "value"], [61, "value"], [62, "value"], [63, "value"], [64, "value"], [65, "value"], [66, "value"], [67, "value"], [68, "value"], [69, "value"], [70, "value"], [71, "value"], [72, "value"], [73, "value"], [74, "value"], [75, "value"], [76, "value"], [77, "value"], [78, "value"], [79, "value"], [80, "value"], [81, "value"], [82, "value"], [83, "value"], [84, "value"], [85, "value"], [86, "value"], [87, "value"], [88, "value"], [89, "value"], [90, "value"], [91, "value"], [92, "value"], [93, "value"], [94, "value"], [95, "value"], [96, "value"], [97, "value"], [98, "value"], [99, "value"], [100, "value"], [101, "value"], [102, "value"], [103, "value"], [104, "value"], [105, "value"]], "Examples": [[14, "examples"], [15, "examples"], [16, "examples"], [17, "examples"], [18, "examples"], [19, "examples"], [20, "examples"], [21, "examples"], [22, "examples"], [23, "examples"], [24, "examples"], [26, "examples"], [27, "examples"], [28, "examples"], [29, "examples"], [30, "examples"], [34, "examples"], [36, "examples"], [37, "examples"], [45, "examples"], [46, "examples"], [47, "examples"], [48, "examples"], [50, "examples"], [51, "examples"], [52, "examples"], [53, "examples"], [54, "examples"], [55, "examples"], [56, "examples"], [57, "examples"], [58, "examples"], [59, "examples"], [60, "examples"], [61, "examples"], [62, "examples"], [64, "examples"], [65, "examples"], [66, "examples"], [67, "examples"], [68, "examples"], [69, "examples"], [70, "examples"], [71, "examples"], [72, "examples"], [75, "examples"], [76, "examples"], [77, "examples"], [79, "examples"], [80, "examples"], [81, "examples"], [82, "examples"], [83, "examples"], [85, "examples"], [86, "examples"], [87, "examples"], [88, "examples"], [89, "examples"], [90, "examples"], [91, "examples"], [92, "examples"], [93, "examples"], [94, "examples"], [95, "examples"], [96, "examples"], [97, "examples"], [98, "examples"], [99, "examples"], [100, "examples"], [101, "examples"], [102, "examples"], [103, "examples"], [104, "examples"]], "operator_compare: Compare Strings with or without Collation": [[15, "operator-compare-compare-strings-with-or-without-collation"]], "operator_dollar: as a Binary Operator": [[16, "operator-dollar-as-a-binary-operator"]], "stri_compare: Compare Strings with or without Collation": [[17, "stri-compare-compare-strings-with-or-without-collation"]], "stri_count: Count the Number of Pattern Occurrences": [[18, "stri-count-count-the-number-of-pattern-occurrences"]], "stri_count_boundaries: Count the Number of Text Boundaries": [[19, "stri-count-boundaries-count-the-number-of-text-boundaries"]], "stri_datetime_add: Date and Time Arithmetic": [[20, "stri-datetime-add-date-and-time-arithmetic"]], "stri_datetime_create: Create a Date-Time Object": [[21, "stri-datetime-create-create-a-date-time-object"]], "stri_datetime_fields: Get Values for Date and Time Fields": [[22, "stri-datetime-fields-get-values-for-date-and-time-fields"]], "stri_datetime_format: Date and Time Formatting and Parsing": [[23, "stri-datetime-format-date-and-time-formatting-and-parsing"]], "stri_datetime_fstr: -Style Format Strings": [[24, "stri-datetime-fstr-style-format-strings"]], "stri_datetime_now: Get Current Date and Time": [[25, "stri-datetime-now-get-current-date-and-time"]], "stri_datetime_symbols: List Localizable Date-Time Formatting Data": [[26, "stri-datetime-symbols-list-localizable-date-time-formatting-data"]], "stri_detect: Detect Pattern Occurrences": [[27, "stri-detect-detect-pattern-occurrences"]], "stri_dup: Duplicate Strings": [[28, "stri-dup-duplicate-strings"]], "stri_duplicated: Determine Duplicated Elements": [[29, "stri-duplicated-determine-duplicated-elements"]], "stri_enc_detect: Detect Character Set and Language": [[30, "stri-enc-detect-detect-character-set-and-language"]], "stri_enc_detect2: [DEPRECATED] Detect Locale-Sensitive Character Encoding": [[31, "stri-enc-detect2-deprecated-detect-locale-sensitive-character-encoding"]], "stri_enc_fromutf32: Convert From UTF-32": [[32, "stri-enc-fromutf32-convert-from-utf-32"]], "stri_enc_info: Query a Character Encoding": [[33, "stri-enc-info-query-a-character-encoding"]], "stri_enc_isascii: Check If a Data Stream Is Possibly in ASCII": [[34, "stri-enc-isascii-check-if-a-data-stream-is-possibly-in-ascii"]], "stri_enc_isutf16: Check If a Data Stream Is Possibly in UTF-16 or UTF-32": [[35, "stri-enc-isutf16-check-if-a-data-stream-is-possibly-in-utf-16-or-utf-32"]], "stri_enc_isutf8: Check If a Data Stream Is Possibly in UTF-8": [[36, "stri-enc-isutf8-check-if-a-data-stream-is-possibly-in-utf-8"]], "stri_enc_list: List Known Character Encodings": [[37, "stri-enc-list-list-known-character-encodings"]], "stri_enc_mark: Get Declared Encodings of Each String": [[38, "stri-enc-mark-get-declared-encodings-of-each-string"]], "stri_enc_set:": [[39, "stri-enc-set"]], "stri_enc_toascii: Convert To ASCII": [[40, "stri-enc-toascii-convert-to-ascii"]], "stri_enc_tonative: Convert Strings To Native Encoding": [[41, "stri-enc-tonative-convert-strings-to-native-encoding"]], "stri_enc_toutf32: Convert Strings To UTF-32": [[42, "stri-enc-toutf32-convert-strings-to-utf-32"]], "stri_enc_toutf8: Convert Strings To UTF-8": [[43, "stri-enc-toutf8-convert-strings-to-utf-8"]], "stri_encode: Convert Strings Between Given Encodings": [[44, "stri-encode-convert-strings-between-given-encodings"]], "stri_escape_unicode: Escape Unicode Code Points": [[45, "stri-escape-unicode-escape-unicode-code-points"]], "stri_extract: Extract Pattern Occurrences": [[46, "stri-extract-extract-pattern-occurrences"]], "stri_extract_boundaries: Extract Data Between Text Boundaries": [[47, "stri-extract-boundaries-extract-data-between-text-boundaries"]], "stri_flatten: Flatten a String": [[48, "stri-flatten-flatten-a-string"]], "stri_info:": [[49, "stri-info"]], "stri_isempty: Determine if a String is of Length Zero": [[50, "stri-isempty-determine-if-a-string-is-of-length-zero"]], "stri_join: Concatenate Character Vectors": [[51, "stri-join-concatenate-character-vectors"]], "stri_join_list: Concatenate Strings in a List": [[52, "stri-join-list-concatenate-strings-in-a-list"]], "stri_length: Count the Number of Code Points": [[53, "stri-length-count-the-number-of-code-points"]], "stri_list2matrix: Convert a List to a Character Matrix": [[54, "stri-list2matrix-convert-a-list-to-a-character-matrix"]], "stri_locale_info: Query Given Locale": [[55, "stri-locale-info-query-given-locale"]], "stri_locale_list: List Available Locales": [[56, "stri-locale-list-list-available-locales"]], "stri_locale_set:": [[57, "stri-locale-set"]], "stri_locate: Locate Pattern Occurrences": [[58, "stri-locate-locate-pattern-occurrences"]], "stri_locate_boundaries: Locate Text Boundaries": [[59, "stri-locate-boundaries-locate-text-boundaries"]], "stri_match: Extract Regex Pattern Matches, Together with Capture Groups": [[60, "stri-match-extract-regex-pattern-matches-together-with-capture-groups"]], "stri_na2empty: Replace NAs with Empty Strings": [[61, "stri-na2empty-replace-nas-with-empty-strings"]], "stri_numbytes: Count the Number of Bytes": [[62, "stri-numbytes-count-the-number-of-bytes"]], "stri_opts_brkiter: Generate a List with BreakIterator Settings": [[63, "stri-opts-brkiter-generate-a-list-with-breakiterator-settings"]], "stri_opts_collator: Generate a List with Collator Settings": [[64, "stri-opts-collator-generate-a-list-with-collator-settings"]], "stri_opts_fixed: Generate a List with Fixed Pattern Search Engine\u2019s Settings": [[65, "stri-opts-fixed-generate-a-list-with-fixed-pattern-search-engine-s-settings"]], "stri_opts_regex: Generate a List with Regex Matcher Settings": [[66, "stri-opts-regex-generate-a-list-with-regex-matcher-settings"]], "stri_order: Ordering Permutation": [[67, "stri-order-ordering-permutation"]], "stri_pad: Pad (Center/Left/Right Align) a String": [[68, "stri-pad-pad-center-left-right-align-a-string"]], "stri_rand_lipsum: A Lorem Ipsum Generator": [[69, "stri-rand-lipsum-a-lorem-ipsum-generator"]], "stri_rand_shuffle: Randomly Shuffle Code Points in Each String": [[70, "stri-rand-shuffle-randomly-shuffle-code-points-in-each-string"]], "stri_rand_strings: Generate Random Strings": [[71, "stri-rand-strings-generate-random-strings"]], "stri_rank: Ranking": [[72, "stri-rank-ranking"]], "stri_read_lines: Read Text Lines from a Text File": [[73, "stri-read-lines-read-text-lines-from-a-text-file"]], "stri_read_raw: Read Text File as Raw": [[74, "stri-read-raw-read-text-file-as-raw"]], "stri_remove_empty: Remove All Empty Strings from a Character Vector": [[75, "stri-remove-empty-remove-all-empty-strings-from-a-character-vector"]], "stri_replace: Replace Pattern Occurrences": [[76, "stri-replace-replace-pattern-occurrences"]], "stri_replace_na: Replace Missing Values in a Character Vector": [[77, "stri-replace-na-replace-missing-values-in-a-character-vector"]], "stri_replace_rstr: Convert gsub-Style Replacement Strings": [[78, "stri-replace-rstr-convert-gsub-style-replacement-strings"]], "stri_reverse: Reverse Each String": [[79, "stri-reverse-reverse-each-string"]], "stri_sort: String Sorting": [[80, "stri-sort-string-sorting"]], "stri_sort_key: Sort Keys": [[81, "stri-sort-key-sort-keys"]], "stri_split: Split a String By Pattern Matches": [[82, "stri-split-split-a-string-by-pattern-matches"]], "stri_split_boundaries: Split a String at Text Boundaries": [[83, "stri-split-boundaries-split-a-string-at-text-boundaries"]], "stri_split_lines: Split a String Into Text Lines": [[84, "stri-split-lines-split-a-string-into-text-lines"]], "stri_sprintf: Format Strings": [[85, "stri-sprintf-format-strings"]], "stri_startsendswith: Determine if the Start or End of a String Matches a Pattern": [[86, "stri-startsendswith-determine-if-the-start-or-end-of-a-string-matches-a-pattern"]], "stri_stats_general: General Statistics for a Character Vector": [[87, "stri-stats-general-general-statistics-for-a-character-vector"]], "stri_stats_latex: Statistics for a Character Vector Containing LaTeX Commands": [[88, "stri-stats-latex-statistics-for-a-character-vector-containing-latex-commands"]], "stri_sub: Extract a Substring From or Replace a Substring In a Character Vector": [[89, "stri-sub-extract-a-substring-from-or-replace-a-substring-in-a-character-vector"]], "stri_sub_all: Extract or Replace Multiple Substrings": [[90, "stri-sub-all-extract-or-replace-multiple-substrings"]], "stri_subset: Select Elements that Match a Given Pattern": [[91, "stri-subset-select-elements-that-match-a-given-pattern"]], "stri_timezone_info: Query a Given Time Zone": [[92, "stri-timezone-info-query-a-given-time-zone"]], "stri_timezone_list: List Available Time Zone Identifiers": [[93, "stri-timezone-list-list-available-time-zone-identifiers"]], "stri_timezone_set:": [[94, "stri-timezone-set"]], "stri_trans_casemap: Transform Strings with Case Mapping or Folding": [[95, "stri-trans-casemap-transform-strings-with-case-mapping-or-folding"]], "stri_trans_char: Translate Characters": [[96, "stri-trans-char-translate-characters"]], "stri_trans_general: General Text Transforms, Including Transliteration": [[97, "stri-trans-general-general-text-transforms-including-transliteration"]], "stri_trans_list: List Available Text Transforms and Transliterators": [[98, "stri-trans-list-list-available-text-transforms-and-transliterators"]], "stri_trans_nf: Perform or Check For Unicode Normalization": [[99, "stri-trans-nf-perform-or-check-for-unicode-normalization"]], "stri_trim: Trim Characters from the Left and/or Right Side of a String": [[100, "stri-trim-trim-characters-from-the-left-and-or-right-side-of-a-string"]], "stri_unescape_unicode: Un-escape All Escape Sequences": [[101, "stri-unescape-unicode-un-escape-all-escape-sequences"]], "stri_unique: Extract Unique Elements": [[102, "stri-unique-extract-unique-elements"]], "stri_width: Determine the Width of Code Points": [[103, "stri-width-determine-the-width-of-code-points"]], "stri_wrap: Word Wrap Text to Format Paragraphs": [[104, "stri-wrap-word-wrap-text-to-format-paragraphs"]], "stri_write_lines: Write Text Lines to a Text File": [[105, "stri-write-lines-write-text-lines-to-a-text-file"]], "Basic String Operations": [[106, "basic-string-operations"]], "Computing Length and Width": [[106, "computing-length-and-width"]], "Joining": [[106, "joining"]], "Operator %s+%": [[106, "operator-s"]], "Flattening": [[106, "flattening"]], "Generalisation": [[106, "generalisation"]], "Duplicating": [[106, "duplicating"]], "Within-List Joining": [[106, "within-list-joining"]], "Extracting and Replacing Substrings": [[106, "extracting-and-replacing-substrings"]], "Indexing Vectors": [[106, "indexing-vectors"]], "Extracting Substrings": [[106, "extracting-substrings"]], "stri_sub_all() Function": [[106, "stri-sub-all-function"]], "\u201cFrom\u2013To\u201d and \u201cFrom\u2013Length\u201d Matrices": [[106, "from-to-and-from-length-matrices"]], "Permuting Code Points": [[106, "permuting-code-points"]], "Replacing Substrings": [[106, "replacing-substrings"]], "Replacing Substrings In-Place": [[106, "replacing-substrings-in-place"]], "Code-Pointwise Comparing": [[107, "code-pointwise-comparing"]], "Testing for Equality of Strings": [[107, "testing-for-equality-of-strings"]], "Searching for Fixed Strings": [[107, "searching-for-fixed-strings"]], "Counting Matches": [[107, "counting-matches"]], "Search Engine Options": [[107, "search-engine-options"]], "Detecting and Subsetting Patterns": [[107, "detecting-and-subsetting-patterns"]], "Locating and Extracting Patterns": [[107, "locating-and-extracting-patterns"]], "Replacing Pattern Occurrences": [[107, "replacing-pattern-occurrences"]], "Splitting": [[107, "splitting"]], "Collation": [[108, "collation"]], "Locales": [[108, "locales"]], "Specifying Locales": [[108, "specifying-locales"]], "Listing Locales": [[108, "listing-locales"]], "Querying for Locale-Specific Services": [[108, "querying-for-locale-specific-services"]], "Default Locale": [[108, "default-locale"]], "Testing String Equivalence": [[108, "testing-string-equivalence"]], "Linear Ordering of Strings": [[108, "linear-ordering-of-strings"]], "Collator Options": [[108, "collator-options"]], "Collation Strength": [[108, "collation-strength"]], "Ignoring Case": [[108, "ignoring-case"]], "Ignoring Some Punctuation": [[108, "ignoring-some-punctuation"]], "Backward Secondary Sorting": [[108, "backward-secondary-sorting"]], "Sorting Numerals": [[108, "sorting-numerals"]], "A Note on Compatibility Equivalence": [[108, "a-note-on-compatibility-equivalence"]], "Searching for Fixed Strings Revisited": [[108, "searching-for-fixed-strings-revisited"]], "General Design Principles": [[109, "general-design-principles"]], "Naming": [[109, "naming"]], "Vectorisation": [[109, "vectorisation"]], "Acting Elementwise with Recycling": [[109, "acting-elementwise-with-recycling"]], "Missing Values": [[109, "missing-values"]], "Data Flow": [[109, "data-flow"]], "Further Deviations from Base R": [[109, "further-deviations-from-base-r"]], "Example Use Case: Data Preparation": [[110, "example-use-case-data-preparation"]], "Input and Output": [[111, "input-and-output"]], "Dealing with Unicode Code Points": [[111, "dealing-with-unicode-code-points"]], "Character Encodings": [[111, "character-encodings"]], "Reading and Writing Text Files": [[111, "reading-and-writing-text-files"]], "Detecting Encodings": [[111, "detecting-encodings"]], "Converting Between Encodings": [[111, "converting-between-encodings"]], "Normalising Strings": [[111, "normalising-strings"]], "Other Operations": [[112, "other-operations"]], "Analysing Text Boundaries": [[112, "analysing-text-boundaries"]], "Trimming, Padding, and Other Formatting": [[112, "trimming-padding-and-other-formatting"]], "Padding": [[112, "padding"]], "Trimming": [[112, "trimming"]], "Word Wrapping": [[112, "word-wrapping"]], "Applying String Templates": [[112, "applying-string-templates"]], "Generating Random Strings": [[112, "generating-random-strings"]], "Transliterating": [[112, "transliterating"]], "Case Mapping": [[112, "case-mapping"]], "Mapping Between Specific Characters": [[112, "mapping-between-specific-characters"]], "General Transforms": [[112, "general-transforms"]], "Parsing and Formatting Date and Time": [[112, "parsing-and-formatting-date-and-time"]], "Regular Expressions": [[113, "regular-expressions"]], "Matching Individual Characters": [[113, "matching-individual-characters"]], "Matching Any Character": [[113, "matching-any-character"]], "Defining Character Sets": [[113, "defining-character-sets"]], "Complementing Sets": [[113, "complementing-sets"]], "Defining Code Point Ranges": [[113, "defining-code-point-ranges"]], "Using Predefined Character Sets": [[113, "using-predefined-character-sets"]], "Avoiding POSIX Classes": [[113, "avoiding-posix-classes"]], "Alternating and Grouping Subexpressions": [[113, "alternating-and-grouping-subexpressions"]], "Alternation Operator": [[113, "alternation-operator"]], "Grouping Subexpressions": [[113, "grouping-subexpressions"]], "Non-grouping Parentheses": [[113, "non-grouping-parentheses"]], "Quantifiers": [[113, "quantifiers"]], "Performance Notes": [[113, "performance-notes"]], "Capture Groups and References Thereto": [[113, "capture-groups-and-references-thereto"]], "Extracting Capture Group Matches": [[113, "extracting-capture-group-matches"]], "Locating Capture Group Matches": [[113, "locating-capture-group-matches"]], "Replacing with Capture Group Matches": [[113, "replacing-with-capture-group-matches"]], "Back-Referencing": [[113, "back-referencing"]], "Anchoring": [[113, "anchoring"]], "Matching at the Beginning or End of a String": [[113, "matching-at-the-beginning-or-end-of-a-string"]], "Matching at Word Boundaries": [[113, "matching-at-word-boundaries"]], "Looking Behind and Ahead": [[113, "looking-behind-and-ahead"]], "How to Cite": [[114, "how-to-cite"]], "Bibliography": [[114, "bibliography"]]}, "indexentries": {}}) \ No newline at end of file diff --git a/docs/weave/basic_operations.html b/docs/weave/basic_operations.html index 9fcbebd3..4da09bf5 100644 --- a/docs/weave/basic_operations.html +++ b/docs/weave/basic_operations.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -730,7 +730,7 @@

                                      Replacing Substrings In-PlaceSphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -782,7 +782,7 @@

                                      Replacing Substrings In-Place + diff --git a/docs/weave/codepoint_comparing.html b/docs/weave/codepoint_comparing.html index 980cd4ce..d31a72c8 100644 --- a/docs/weave/codepoint_comparing.html +++ b/docs/weave/codepoint_comparing.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -736,7 +736,7 @@

                                      SplittingSphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -777,7 +777,7 @@

                                      Splitting + diff --git a/docs/weave/collation.html b/docs/weave/collation.html index 7e0f1cdf..118861d3 100644 --- a/docs/weave/collation.html +++ b/docs/weave/collation.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -790,7 +790,7 @@

                                      Searching for Fixed Strings RevisitedSphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -842,7 +842,7 @@

                                      Searching for Fixed Strings Revisited + diff --git a/docs/weave/design_principles.html b/docs/weave/design_principles.html index 0d0dd1d6..ef8af224 100644 --- a/docs/weave/design_principles.html +++ b/docs/weave/design_principles.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -790,7 +790,7 @@

                                      Further Deviations from Base RSphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -829,7 +829,7 @@

                                      Further Deviations from Base R + diff --git a/docs/weave/example.html b/docs/weave/example.html index eb645098..6f7b79c1 100644 --- a/docs/weave/example.html +++ b/docs/weave/example.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -552,7 +552,7 @@

                                      Example Use Case: Data PreparationSphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -567,7 +567,7 @@

                                      Example Use Case: Data Preparation + diff --git a/docs/weave/input_output.html b/docs/weave/input_output.html index 96e14d13..def7bec9 100644 --- a/docs/weave/input_output.html +++ b/docs/weave/input_output.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -595,7 +595,7 @@

                                      Converting Between EncodingsSphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -634,7 +634,7 @@

                                      Converting Between Encodings + diff --git a/docs/weave/other_operations.html b/docs/weave/other_operations.html index 6965f1d8..2b1d1672 100644 --- a/docs/weave/other_operations.html +++ b/docs/weave/other_operations.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -628,7 +628,7 @@

                                      General TransformsSphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -677,7 +677,7 @@

                                      General Transforms + diff --git a/docs/weave/regular_expressions.html b/docs/weave/regular_expressions.html index 6856d824..7f9c5b2a 100644 --- a/docs/weave/regular_expressions.html +++ b/docs/weave/regular_expressions.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -1028,7 +1028,7 @@

                                      Looking Behind and AheadSphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -1093,7 +1093,7 @@

                                      Looking Behind and Ahead + diff --git a/docs/z_bibliography.html b/docs/z_bibliography.html index cf839f84..c98024da 100644 --- a/docs/z_bibliography.html +++ b/docs/z_bibliography.html @@ -160,7 +160,7 @@ stringi
                                      -1.8.3.9001 +1.8.4
                                      @@ -449,7 +449,7 @@

                                      BibliographySphinx and a customised Furo theme. - Last updated on 2024-05-06T11:02:01+0200. + Last updated on 2024-05-06T14:48:28+0200. This site will never display any ads: it is a non-profit project. It does not collect any data. @@ -485,7 +485,7 @@

                                      Bibliography +