diff --git a/Cargo.toml b/Cargo.toml
index dad80e8..3b2519e 100644
--- a/Cargo.toml
+++ b/Cargo.toml
@@ -36,8 +36,8 @@ simdutf8 = {version = "0.1", optional = true}
 needletail = { version = "0.5", optional = true, default-features = false}
 
 # Dep for development
-minimap2-sys = { path = "./minimap2-sys" }
-# minimap2-sys = "0.1.19"
+# minimap2-sys = { path = "./minimap2-sys" }
+minimap2-sys = "0.1.19"
 rust-htslib = { version = "0.47", default-features = false, optional = true }
 
 [dev-dependencies]
diff --git a/my_index.mmi b/my_index.mmi
deleted file mode 100644
index 2f2a785..0000000
Binary files a/my_index.mmi and /dev/null differ
diff --git a/src/lib.rs b/src/lib.rs
index 3527521..9aaa281 100644
--- a/src/lib.rs
+++ b/src/lib.rs
@@ -198,6 +198,7 @@ pub struct Alignment {
     pub cigar_str: Option<String>,
     pub md: Option<String>,
     pub cs: Option<String>,
+    pub alignment_score: Option<u32>,
 }
 
 /// Mapping result
@@ -328,14 +329,20 @@ impl Default for Aligner {
 impl Aligner {
     /// Create a new aligner with default options
     pub fn builder() -> Self {
-        Aligner {
+        let mut aligner = Aligner {
             mapopt: MapOpt {
-                seed: 42,
+                seed: 11,
                 best_n: 1,
                 ..Default::default()
             },
             ..Default::default()
+        };
+
+        unsafe {
+            minimap2_sys::mm_set_opt(&0, &mut aligner.idxopt, &mut aligner.mapopt);
         }
+
+        aligner
     }
 }
 
@@ -484,7 +491,7 @@ impl Aligner {
         let mut mapopt = MapOpt::default();
 
         unsafe {
-            // Set preset
+            mm_set_opt(&0, &mut idxopt, &mut mapopt);
             mm_set_opt(preset.into(), &mut idxopt, &mut mapopt)
         };
 
@@ -548,6 +555,20 @@ impl Aligner {
         self
     }
 
+    // Check options
+    pub fn check_opts(&self) -> Result<(), &'static str> {
+        let result = unsafe {
+            mm_check_opt(&self.idxopt, &self.mapopt)
+        };
+
+        if result == 0 {
+            Ok(())
+        } else {
+            Err("Invalid options")
+        }
+    }
+
+
     /// Set index parameters for minimap2 using builder pattern
     /// Creates the index as well with the given number of threads (set at struct creation).
     /// You must set the number of threads before calling this function.
@@ -870,6 +891,8 @@ impl Aligner {
 
                     let is_primary = reg.parent == reg.id;
                     let is_supplementary = reg.sam_pri() == 0;
+                    
+                    // todo holy heck this code is ugly
                     let alignment = if !reg.p.is_null() {
                         let p = &*reg.p;
 
@@ -1063,6 +1086,7 @@ impl Aligner {
                             cigar_str,
                             md: md_str,
                             cs: cs_str,
+                            alignment_score: Some(p.dp_score as u32),
                         })
                     } else {
                         None
@@ -1460,6 +1484,27 @@ mod tests {
         println!("{:#?}", mappings);
     }
 
+    #[test]
+    fn test_alignment_score() {
+        let mut aligner = Aligner::builder()
+            .preset(Preset::Splice)
+            .with_index_threads(1);
+
+        aligner.check_opts().expect("Opts are invalid");
+
+        aligner = aligner
+            .with_index("test_data/genome.fa", None)
+            .unwrap();
+
+        let output = aligner.map(
+            b"GAAATACGGGTCTCTGGTTTGACATAAAGGTCCAACTGTAATAACTGATTTTATCTGTGGGTGATGCGTTTCTCGGACAACCACGACCGCGCCCAGACTTAAATCGCACATACTGCGTCGTGCAATGCCGGGCGCTAACGGCTCAATATCACGCTGCGTCACTATGGCTACCCCAAAGCGGGGGGGGCATCGACGGGCTGTTTGATTTGAGCTCCATTACCCTACAATTAGAACACTGGCAACATTTGGGCGTTGAGCGGTCTTCCGTGTCGCTCGATCCGCTGGAACTTGGCAACCACACTCTAAACTACATGTGGTATGGCTCATAAGATCATGCGGATCGTGGCACTGCTTTCGGCCACGTTAGAGCCGCTGTGCTCGAAGATTGGGACCTACCAAC",
+            false, false, None, None).unwrap();
+
+        println!("{:#?}", aligner.mapopt);
+        println!("{:#?}", aligner.idxopt);
+        println!("{:#?}", output);
+    }
+
     #[test]
     fn test_aligner_config_and_mapping() {
         let mut aligner = Aligner::builder()
diff --git a/test_data/cDNA.fasta b/test_data/cDNA.fasta
new file mode 100644
index 0000000..8f4e502
--- /dev/null
+++ b/test_data/cDNA.fasta
@@ -0,0 +1,2 @@
+>fwd
+GAAATACGGGTCTCTGGTTTGACATAAAGGTCCAACTGTAATAACTGATTTTATCTGTGGGTGATGCGTTTCTCGGACAACCACGACCGCGCCCAGACTTAAATCGCACATACTGCGTCGTGCAATGCCGGGCGCTAACGGCTCAATATCACGCTGCGTCACTATGGCTACCCCAAAGCGGGGGGGGCATCGACGGGCTGTTTGATTTGAGCTCCATTACCCTACAATTAGAACACTGGCAACATTTGGGCGTTGAGCGGTCTTCCGTGTCGCTCGATCCGCTGGAACTTGGCAACCACACTCTAAACTACATGTGGTATGGCTCATAAGATCATGCGGATCGTGGCACTGCTTTCGGCCACGTTAGAGCCGCTGTGCTCGAAGATTGGGACCTACCAAC
diff --git a/yeast_ref.mmi b/yeast_ref.mmi
deleted file mode 100644
index 22df8b9..0000000
Binary files a/yeast_ref.mmi and /dev/null differ