diff --git a/.gitignore b/.gitignore index 32eea3fe3..39d723d86 100644 --- a/.gitignore +++ b/.gitignore @@ -7,4 +7,5 @@ db* scripts/*.json conda* input.json +scripts/*.json* *.swp diff --git a/Makefile b/Makefile index 58941b192..1fe5955ba 100644 --- a/Makefile +++ b/Makefile @@ -217,7 +217,7 @@ check-env: BEAGLE_AUTH_LDAP_SERVER_URI \ BEAGLE_LIMS_PASSWORD \ BEAGLE_LIMS_USERNAME; do \ - [ -z "$$(printenv BEAGLE_LIMS_USERNAME)" ] && echo ">>> env variable $$i is not set; some features may not work" || : ; done + [ -z "$$(printenv $$i)" ] && echo ">>> env variable $$i is not set; some features may not work" || : ; done # start the RabbitMQ server in the background rabbitmq-start: $(LOG_DIR_ABS) @@ -316,10 +316,14 @@ export DJ_DEBUG_LOG:=$(LOG_DIR_ABS)/dj.debug.log # initialize the Django app in the database # do this after setting up the db above django-init: - python manage.py makemigrations --merge + python manage.py makemigrations # --merge python manage.py migrate + $(MAKE) django-load-fixtures python manage.py createsuperuser + +django-load-fixtures: python manage.py loaddata \ + beagle_etl.operator.json \ file_system.filegroup.json \ file_system.filetype.json \ file_system.storage.json \ @@ -430,6 +434,7 @@ files-request: --data '{"request_ids":["$(REQID)"]}' \ http://$(DJANGO_BEAGLE_IP):$(DJANGO_BEAGLE_PORT)/v0/fs/files/ # python ./beagle_cli.py files list --metadata='requestId:$(REQID)' +# http://localhost:6991/v0/fs/files/?metadata=requestId:DemoRequest1 # get info on a single file REQFILE:=b37.fasta @@ -440,22 +445,28 @@ file-get: http://$(DJANGO_BEAGLE_IP):$(DJANGO_BEAGLE_PORT)/v0/fs/files/?filename=$(REQFILE) # start a Roslin run for a given request in the Beagle db -run-request: +PIPELINE:=roslin +run-request: $(AUTH_FILE) + token=$$( jq -r '.token' "$(AUTH_FILE)" ) && \ + echo ">>> token: $$token" && \ curl -H "Content-Type: application/json" \ -X POST \ - -H "Authorization: Bearer $(TOKEN)" \ - --data '{"request_ids":["$(REQID)"], "pipeline_name": "roslin"}' \ + -H "Authorization: Bearer $$token" \ + --data '{"request_ids":["$(REQID)"], "pipeline_name": "$(PIPELINE)"}' \ http://$(DJANGO_BEAGLE_IP):$(DJANGO_BEAGLE_PORT)/v0/run/request/ # send a pipeline input to the API to start running REQJSON:=fixtures/tests/run_roslin.json run-request-api: $(AUTH_FILE) - @token=$$( jq -r '.token' "$(AUTH_FILE)" ) && \ + token=$$( jq -r '.token' "$(AUTH_FILE)" ) && \ + echo ">>> token: $$token" && \ curl -H "Content-Type: application/json" \ -X POST \ -H "Authorization: Bearer $$token" \ --data @$(REQJSON) \ http://$(DJANGO_BEAGLE_IP):$(DJANGO_BEAGLE_PORT)/v0/run/api/ +# http://localhost:6991/v0/run/api/?metadata=requestId:10277_C +# http://localhost:6991/v0/run/api/?requestId%3D10277_C/ # make a demo Roslin input.json file from the template fixture; # need to update the fixture with the app ID of the demo pipeline that was loaded in the database @@ -471,12 +482,22 @@ $(DEMO_INPUT): $(INPUT_TEMPLATE) $(AUTH_FILE) .PHONY: $(DEMO_INPUT) # submit a demo Roslin run using the dev Roslin pipeline entry in the database -demo-run: register-dev-pipeline $(DEMO_INPUT) +# submit using the API endpoint; bypasses the Operator +demo-run-api: register-dev-pipeline $(DEMO_INPUT) @python manage.py loaddata fixtures/tests/juno_roslin_demo2.file.json @python manage.py loaddata fixtures/tests/juno_roslin_demo2.filemetadata.json @python manage.py loaddata fixtures/tests/roslin_reference_files.json @$(MAKE) run-request-api REQID=DemoRequest1 REQJSON=$(DEMO_INPUT) +# run the update-request endpoint for a request ID in order to update the metadata about a request +update-request: + @token=$$( jq -r '.token' "$(AUTH_FILE)" ) && \ + curl -H "Content-Type: application/json" \ + -X POST \ + -H "Authorization: Bearer $$token" \ + --data '{"request_ids":["$(REQID)"], "pipeline_name": "roslin"}' \ + http://$(DJANGO_BEAGLE_IP):$(DJANGO_BEAGLE_PORT)/v0/etl/update-requests/ + # check if the ports needed for services and servers are already in use on this system ifeq ($(UNAME), Darwin) # On macOS High Sierra, use this command: lsof -nP -i4TCP:$PORT | grep LISTEN @@ -514,5 +535,3 @@ PORT= port-check: ss -lntup | grep ':$(PORT)' endif - - diff --git a/beagle_etl/fixtures/beagle_etl.operator.json b/beagle_etl/fixtures/beagle_etl.operator.json index c188ef458..627cf2420 100644 --- a/beagle_etl/fixtures/beagle_etl.operator.json +++ b/beagle_etl/fixtures/beagle_etl.operator.json @@ -18,5 +18,15 @@ "class_name": "AccessOperator", "slug": "access" } + }, + { + "model": "beagle_etl.operator", + "pk": 3, + "fields": { + "active": true, + "recipes": "[]", + "class_name": "RoslinQcOperator", + "slug": "roslin-qc" + } } ] diff --git a/fixtures/tests/ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json b/fixtures/tests/ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json new file mode 100644 index 000000000..d431bfe9c --- /dev/null +++ b/fixtures/tests/ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json @@ -0,0 +1,6854 @@ +[ + { + "model": "runner.run", + "pk": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "fields": { + "created_date": "2019-12-11T22:53:02.012Z", + "modified_date": "2020-01-14T23:03:35.530Z", + "name": "ROSLIN 09670_D, 22 of 54 (12/11/2019, 22:53:02)", + "app": "cb5d793b-e650-4b7d-bfcd-882858e29cc5", + "status": 4, + "execution_id": "df43cc77-bed4-4233-9817-6d12e25d9e1c", + "job_statuses": {}, + "output_metadata": { + "assay": "IDT_Exome_v1_FP_b37" + }, + "tags": { + "requestId": "09670_D" + } + } + }, + { + "model": "runner.port", + "pk": "6a3f41e3-e6f1-4d6f-a877-35c2247b82cb", + "fields": { + "created_date": "2019-12-11T22:53:17.822Z", + "modified_date": "2020-02-04T15:29:30.720Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "dbsnp", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".idx" + ], + "db_value": { + "class": "File", + "location": "bid://914dce04-bc41-427e-9b6c-3084bfa61250" + }, + "value": { + "path": "/juno/work/ci/resources/request_files/dbsnp/dbsnp_138.b37.excluding_sites_after_129.vcf", + "size": 2432705678, + "class": "File" + }, + "files": [ + "914dce04-bc41-427e-9b6c-3084bfa61250" + ] + } + }, + { + "model": "runner.port", + "pk": "704ee521-9779-4754-b270-ba8216f09c34", + "fields": { + "created_date": "2019-12-11T22:53:17.827Z", + "modified_date": "2020-02-04T15:29:30.724Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "indels_1000g", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".idx" + ], + "db_value": { + "class": "File", + "location": "bid://c868b6e9-92bd-4855-9726-7945e4471973" + }, + "value": { + "path": "/juno/work/ci/resources/request_files/indels_1000g/Mills_and_1000G_gold_standard.indels.b37.vcf", + "size": 86369975, + "class": "File" + }, + "files": [ + "c868b6e9-92bd-4855-9726-7945e4471973" + ] + } + }, + { + "model": "runner.port", + "pk": "52e17010-65a2-4e7d-a699-03bfa8c7f62e", + "fields": { + "created_date": "2019-12-11T22:53:17.831Z", + "modified_date": "2020-02-04T15:29:30.750Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "snps_1000g", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".idx" + ], + "db_value": { + "class": "File", + "location": "bid://6f644f7f-a7b7-4573-a40a-6c5838f58b75" + }, + "value": { + "path": "/juno/work/ci/resources/request_files/snps_1000g/1000G_phase1.snps.high_confidence.b37.vcf", + "size": 7313069069, + "class": "File" + }, + "files": [ + "6f644f7f-a7b7-4573-a40a-6c5838f58b75" + ] + } + }, + { + "model": "runner.port", + "pk": "b51ad3f0-e81f-45d6-a7ea-915939644abd", + "fields": { + "created_date": "2019-12-11T22:53:17.836Z", + "modified_date": "2020-02-04T15:29:30.924Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "cosmic", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".idx" + ], + "db_value": { + "class": "File", + "location": "bid://100204c9-c560-43d9-ab4d-8c03bc207f4e" + }, + "value": { + "path": "/juno/work/ci/resources/request_files/cosmic/CosmicCodingMuts_v67_b37_20131024__NDS.vcf", + "size": 112402812, + "class": "File" + }, + "files": [ + "100204c9-c560-43d9-ab4d-8c03bc207f4e" + ] + } + }, + { + "model": "runner.port", + "pk": "e656d671-1873-4268-8f62-0e786496ff19", + "fields": { + "created_date": "2019-12-11T22:53:17.843Z", + "modified_date": "2020-02-04T15:29:31.049Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "exac_filter", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".tbi" + ], + "db_value": { + "class": "File", + "location": "bid://5c1dfb8e-d831-43f1-892b-f3c0bf043ca2" + }, + "value": { + "path": "/juno/work/ci/resources/vep/cache/ExAC_nonTCGA.r0.3.1.sites.vep.vcf.gz", + "size": 337197976, + "class": "File" + }, + "files": [ + "5c1dfb8e-d831-43f1-892b-f3c0bf043ca2" + ] + } + }, + { + "model": "runner.port", + "pk": "fa222a47-ba06-4e04-8c4f-fb8cbbc29f18", + "fields": { + "created_date": "2019-12-11T22:53:17.802Z", + "modified_date": "2020-02-04T15:29:52.626Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "db_files", + "port_type": 0, + "schema": { + "type": "record", + "fields": { + "refseq": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "vep_data": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "vep_path": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "custom_enst": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "facets_snps": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "hotspot_vcf": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "fp_genotypes": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "fp_intervals": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "hotspot_list": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "delly_exclude": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "bait_intervals": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "conpair_markers": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "hotspot_list_maf": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "target_intervals": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "conpair_markers_bed": { + "type": [ + "null", + "array" + ], + "items": "string" + } + } + }, + "secondary_files": [], + "db_value": { + "refseq": { + "class": "File", + "location": "bid://3814d1da-e507-4e7d-b65b-b4ae7e07ec61" + }, + "vep_data": "/var/cache", + "vep_path": "/usr/bin/vep", + "custom_enst": "/usr/bin/vcf2maf/data/isoform_overrides_at_mskcc", + "facets_snps": { + "class": "File", + "location": "bid://584079c8-13af-4816-9ad3-50ce86e13934" + }, + "hotspot_vcf": "/usr/bin/basicfiltering/data/hotspot-list-union-v1-v2.vcf", + "fp_genotypes": { + "class": "File", + "location": "bid://1edc9e89-8014-406f-92ee-74084eb981cd" + }, + "fp_intervals": { + "class": "File", + "location": "bid://b7c7d59f-73a4-4968-bbf5-cd6aed491b91" + }, + "hotspot_list": "/usr/bin/ngs-filters/data/hotspot-list-union-v1-v2.txt", + "delly_exclude": { + "class": "File", + "location": "bid://e0e6283e-24ba-466f-9ec6-b6d9d85b2acd" + }, + "bait_intervals": { + "class": "File", + "location": "bid://a88b6dca-0601-4383-947f-27dbe8b83213" + }, + "conpair_markers": "/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.txt", + "hotspot_list_maf": { + "class": "File", + "location": "bid://92bff766-15fd-4316-8977-77afcef97dae" + }, + "target_intervals": { + "class": "File", + "location": "bid://c29140df-2bdf-4553-ba5d-b0bf07fb347e" + }, + "conpair_markers_bed": "/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.bed" + }, + "value": { + "refseq": { + "path": "/juno/work/ci/resources/request_files/refseq/refGene_b37.sorted.txt", + "size": 9953757, + "class": "File" + }, + "vep_data": "/var/cache", + "vep_path": "/usr/bin/vep", + "custom_enst": "/usr/bin/vcf2maf/data/isoform_overrides_at_mskcc", + "facets_snps": { + "path": "/juno/work/ci/resources/genomes/GRCh37/facets_snps/dbsnp_137.b37__RmDupsClean__plusPseudo50__DROP_SORT.vcf.gz", + "size": 1015019014, + "class": "File" + }, + "hotspot_vcf": "/usr/bin/basicfiltering/data/hotspot-list-union-v1-v2.vcf", + "fp_genotypes": { + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/FP_tiling_genotypes.txt", + "size": 38179, + "class": "File" + }, + "fp_intervals": { + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/FP_tiling_intervals.intervals", + "size": 50804, + "class": "File" + }, + "hotspot_list": "/usr/bin/ngs-filters/data/hotspot-list-union-v1-v2.txt", + "delly_exclude": { + "path": "/juno/work/ci/resources/genomes/GRCh37/delly/human.hg19.excl.tsv", + "size": 6984, + "class": "File" + }, + "bait_intervals": { + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/IDT_Exome_v1_FP_b37_baits.ilist", + "size": 7083292, + "class": "File" + }, + "conpair_markers": "/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.txt", + "hotspot_list_maf": { + "path": "/juno/work/ci/resources/roslin-qc/hotspot-list-union-v1-v2.maf", + "size": 624846, + "class": "File" + }, + "target_intervals": { + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/IDT_Exome_v1_FP_b37_targets.ilist", + "size": 6997415, + "class": "File" + }, + "conpair_markers_bed": "/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.bed" + }, + "files": [ + "1edc9e89-8014-406f-92ee-74084eb981cd", + "3814d1da-e507-4e7d-b65b-b4ae7e07ec61", + "584079c8-13af-4816-9ad3-50ce86e13934", + "92bff766-15fd-4316-8977-77afcef97dae", + "a88b6dca-0601-4383-947f-27dbe8b83213", + "b7c7d59f-73a4-4968-bbf5-cd6aed491b91", + "c29140df-2bdf-4553-ba5d-b0bf07fb347e", + "e0e6283e-24ba-466f-9ec6-b6d9d85b2acd" + ] + } + }, + { + "model": "runner.port", + "pk": "f4459608-f329-4ab9-bc30-a6c1ab31dcca", + "fields": { + "created_date": "2019-12-11T22:53:17.852Z", + "modified_date": "2020-02-04T15:29:52.795Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "curated_bams", + "port_type": 0, + "schema": { + "type": "array", + "items": [ + "null", + "array" + ] + }, + "secondary_files": [ + "^.bai" + ], + "db_value": [ + { + "class": "File", + "location": "bid://a0fa83e4-8f43-44ba-8dce-719c18bc33b9" + }, + { + "class": "File", + "location": "bid://1560276d-5d60-4bbf-bb16-2893fa5ec1b6" + }, + { + "class": "File", + "location": "bid://00e929a4-6ef8-46ca-ae7c-47fded158cbb" + }, + { + "class": "File", + "location": "bid://16aecbf7-94d8-4057-b6d0-409cf2d30f44" + }, + { + "class": "File", + "location": "bid://404e0dfd-b8c3-4c98-b07a-beadb4887939" + }, + { + "class": "File", + "location": "bid://e8dd7bdf-abfb-45e2-afd5-452ca86deb9d" + }, + { + "class": "File", + "location": "bid://07f85933-01ac-42f4-8c94-f751318e7376" + }, + { + "class": "File", + "location": "bid://0d64fb11-bc41-4963-9559-158411f15ce6" + }, + { + "class": "File", + "location": "bid://777be3e6-1cd5-4aef-a83d-db7061a11045" + }, + { + "class": "File", + "location": "bid://62373f4a-efc1-4ae7-8252-e5d4a91218ba" + }, + { + "class": "File", + "location": "bid://12ac7fba-2cbc-4ab5-b4c3-1fa44fc41e3e" + }, + { + "class": "File", + "location": "bid://b8f0c91b-9741-48dc-a617-7e4713819dc3" + }, + { + "class": "File", + "location": "bid://f05da7bc-d9ca-4a93-929f-4d52a09c19aa" + }, + { + "class": "File", + "location": "bid://d85ba214-e41d-4c0b-a7fd-d0c3cff0b052" + }, + { + "class": "File", + "location": "bid://45316ece-3691-4b9c-b636-3e02594580cf" + }, + { + "class": "File", + "location": "bid://aa352bb2-7209-4f14-9750-12e6c4f296ab" + }, + { + "class": "File", + "location": "bid://cc9c56f9-0432-4058-aec9-f61207718feb" + }, + { + "class": "File", + "location": "bid://b973583f-e8fd-4156-af89-852747dbce51" + }, + { + "class": "File", + "location": "bid://0978e54d-5f7e-4383-abcb-2cb675659c6b" + }, + { + "class": "File", + "location": "bid://cd114cae-5147-40a4-907f-82567b31bcc4" + }, + { + "class": "File", + "location": "bid://8eaf9fc4-c0fd-4d04-940d-754eac5f429e" + }, + { + "class": "File", + "location": "bid://b4583b1b-d570-4f92-a8f1-95a036c239f6" + }, + { + "class": "File", + "location": "bid://b1f6d1fd-163d-4616-8d15-67f888216e93" + }, + { + "class": "File", + "location": "bid://1998b585-d331-449b-b963-a8e42d64ec4b" + }, + { + "class": "File", + "location": "bid://8ad44576-6f3c-443d-84f2-71790469ce60" + }, + { + "class": "File", + "location": "bid://b89ed0be-70c6-4452-b98c-a6577ac07421" + }, + { + "class": "File", + "location": "bid://fdc12b20-3121-4176-afda-a161de7e5834" + }, + { + "class": "File", + "location": "bid://dd0a5f64-011c-4461-963e-ba85d529a2dd" + }, + { + "class": "File", + "location": "bid://507e913b-66fe-43a8-bbef-da9944556898" + }, + { + "class": "File", + "location": "bid://df51e7ab-0582-4e3b-9242-a95f0ba0fde8" + }, + { + "class": "File", + "location": "bid://f363912b-96b1-4898-94fb-025bd9e4d859" + }, + { + "class": "File", + "location": "bid://8808aeca-3a6d-478d-b4b5-a4818d624271" + }, + { + "class": "File", + "location": "bid://754edfb4-83bc-466f-99b3-c8d29f3bacd9" + }, + { + "class": "File", + "location": "bid://0eb765d1-797f-482e-ab3f-a5ec90416ec8" + }, + { + "class": "File", + "location": "bid://7afbce7f-0ae7-4120-8711-15de848a2bde" + }, + { + "class": "File", + "location": "bid://a3ef2b60-a2e3-40ee-b06a-d2c1580aaad2" + }, + { + "class": "File", + "location": "bid://e5f5ce8a-16e3-4310-afed-1e846bb4696b" + }, + { + "class": "File", + "location": "bid://91770ec9-d82c-45b2-9ce7-da18b67cb4c0" + }, + { + "class": "File", + "location": "bid://c5b27f38-4d0f-4fda-bf2d-c3c72fbbc3cf" + }, + { + "class": "File", + "location": "bid://316a84f9-1e44-4294-acd9-44007db6fa9d" + } + ], + "value": [ + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006284_N002_d.Group3.rg.md.abra.printreads.bam", + "size": 18001309333, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006537_N001_d.Group0.rg.md.abra.printreads.bam", + "size": 13424642344, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006550_N002_d.Group1.rg.md.abra.printreads.bam", + "size": 13851651891, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006609_N001_d.Group0.rg.md.abra.printreads.bam", + "size": 16764556278, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006610_N001_d.Group1.rg.md.abra.printreads.bam", + "size": 17797687748, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006626_N001_d.Group19.rg.md.abra.printreads.bam", + "size": 15450048427, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006627_N001_d.Group20.rg.md.abra.printreads.bam", + "size": 21418934197, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006628_N001_d.Group15.rg.md.abra.printreads.bam", + "size": 20242506560, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006630_N001_d.Group14.rg.md.abra.printreads.bam", + "size": 18554952981, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006631_N001_d.Group17.rg.md.abra.printreads.bam", + "size": 17671380235, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006632_N001_d.Group16.rg.md.abra.printreads.bam", + "size": 17956822592, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006633_N001_d.Group13.rg.md.abra.printreads.bam", + "size": 14995930592, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006635_N001_d.Group8.rg.md.abra.printreads.bam", + "size": 19452196435, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006636_N001_d.Group9.rg.md.abra.printreads.bam", + "size": 19189450319, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006637_N002_d.Group0.rg.md.abra.printreads.bam", + "size": 10888838079, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006638_N001_d.Group1.rg.md.abra.printreads.bam", + "size": 10088003650, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006639_N001_d.Group6.rg.md.abra.printreads.bam", + "size": 18437335538, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006640_N001_d.Group7.rg.md.abra.printreads.bam", + "size": 18781758639, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006641_N001_d.Group4.rg.md.abra.printreads.bam", + "size": 15954753147, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006642_N001_d.Group5.rg.md.abra.printreads.bam", + "size": 17579506808, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006643_N001_d.Group2.rg.md.abra.printreads.bam", + "size": 17298827865, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006644_N001_d.Group3.rg.md.abra.printreads.bam", + "size": 19302206744, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006645_N001_d.Group0.rg.md.abra.printreads.bam", + "size": 15523622669, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006646_N001_d.Group1.rg.md.abra.printreads.bam", + "size": 17007314582, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006647_N001_d.Group18.rg.md.abra.printreads.bam", + "size": 20776680414, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006648_N001_d.Group11.rg.md.abra.printreads.bam", + "size": 17232710261, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006649_N001_d.Group10.rg.md.abra.printreads.bam", + "size": 17366153538, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006650_N001_d.Group21.rg.md.abra.printreads.bam", + "size": 16571180154, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006904_N001_d.Group0.rg.md.abra.printreads.bam", + "size": 18185638557, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006905_N001_d.Group1.rg.md.abra.printreads.bam", + "size": 18558003865, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006906_N001_d.Group1.rg.md.abra.printreads.bam", + "size": 16951748171, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006907_N001_d.Group0.rg.md.abra.printreads.bam", + "size": 16389279357, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006996_N001_d.Group0.rg.md.abra.printreads.bam", + "size": 10690676737, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_0AEE89_N001_d.Group0.rg.md.abra.printreads.bam", + "size": 13862649385, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_1NPV4P_N001_d.Group0.rg.md.abra.printreads.bam", + "size": 11105358516, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_4W32NJ_N001_d.Group1.rg.md.abra.printreads.bam", + "size": 17582103301, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_H9KJFX_N001_d.Group2.rg.md.abra.printreads.bam", + "size": 19349236927, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_P5FLLT_N001_d.Group4.rg.md.abra.printreads.bam", + "size": 20668078544, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_VC7LNE_N001_d.Group5.rg.md.abra.printreads.bam", + "size": 18873117772, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_WV53F0_N001_d.Group0.rg.md.abra.printreads.bam", + "size": 19501528278, + "class": "File" + } + ], + "files": [ + "00e929a4-6ef8-46ca-ae7c-47fded158cbb", + "07f85933-01ac-42f4-8c94-f751318e7376", + "0978e54d-5f7e-4383-abcb-2cb675659c6b", + "0d64fb11-bc41-4963-9559-158411f15ce6", + "0eb765d1-797f-482e-ab3f-a5ec90416ec8", + "12ac7fba-2cbc-4ab5-b4c3-1fa44fc41e3e", + "1560276d-5d60-4bbf-bb16-2893fa5ec1b6", + "16aecbf7-94d8-4057-b6d0-409cf2d30f44", + "1998b585-d331-449b-b963-a8e42d64ec4b", + "316a84f9-1e44-4294-acd9-44007db6fa9d", + "404e0dfd-b8c3-4c98-b07a-beadb4887939", + "45316ece-3691-4b9c-b636-3e02594580cf", + "507e913b-66fe-43a8-bbef-da9944556898", + "62373f4a-efc1-4ae7-8252-e5d4a91218ba", + "754edfb4-83bc-466f-99b3-c8d29f3bacd9", + "777be3e6-1cd5-4aef-a83d-db7061a11045", + "7afbce7f-0ae7-4120-8711-15de848a2bde", + "8808aeca-3a6d-478d-b4b5-a4818d624271", + "8ad44576-6f3c-443d-84f2-71790469ce60", + "8eaf9fc4-c0fd-4d04-940d-754eac5f429e", + "91770ec9-d82c-45b2-9ce7-da18b67cb4c0", + "a0fa83e4-8f43-44ba-8dce-719c18bc33b9", + "a3ef2b60-a2e3-40ee-b06a-d2c1580aaad2", + "aa352bb2-7209-4f14-9750-12e6c4f296ab", + "b1f6d1fd-163d-4616-8d15-67f888216e93", + "b4583b1b-d570-4f92-a8f1-95a036c239f6", + "b89ed0be-70c6-4452-b98c-a6577ac07421", + "b8f0c91b-9741-48dc-a617-7e4713819dc3", + "b973583f-e8fd-4156-af89-852747dbce51", + "c5b27f38-4d0f-4fda-bf2d-c3c72fbbc3cf", + "cc9c56f9-0432-4058-aec9-f61207718feb", + "cd114cae-5147-40a4-907f-82567b31bcc4", + "d85ba214-e41d-4c0b-a7fd-d0c3cff0b052", + "dd0a5f64-011c-4461-963e-ba85d529a2dd", + "df51e7ab-0582-4e3b-9242-a95f0ba0fde8", + "e5f5ce8a-16e3-4310-afed-1e846bb4696b", + "e8dd7bdf-abfb-45e2-afd5-452ca86deb9d", + "f05da7bc-d9ca-4a93-929f-4d52a09c19aa", + "f363912b-96b1-4898-94fb-025bd9e4d859", + "fdc12b20-3121-4176-afda-a161de7e5834" + ] + } + }, + { + "model": "runner.port", + "pk": "783ef68e-f360-49d8-aa65-1e8b4fda9740", + "fields": { + "created_date": "2019-12-11T22:53:17.808Z", + "modified_date": "2020-02-04T15:29:52.632Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "ref_fasta", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".amb", + ".ann", + ".bwt", + ".pac", + ".sa", + ".fai", + "^.dict" + ], + "db_value": { + "class": "File", + "location": "bid://96e3a791-2bc7-45f8-acc6-e519a29d5d0b" + }, + "value": { + "path": "/juno/work/ci/resources/genomes/GRCh37/fasta/b37.fasta", + "size": 3189750467, + "class": "File" + }, + "files": [ + "96e3a791-2bc7-45f8-acc6-e519a29d5d0b" + ] + } + }, + { + "model": "runner.port", + "pk": "615b0226-6d3e-435f-888d-fe526984861f", + "fields": { + "created_date": "2019-12-11T22:53:17.814Z", + "modified_date": "2020-02-04T15:29:52.640Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "mouse_fasta", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".amb", + ".ann", + ".bwt", + ".pac", + ".sa", + ".fai", + "^.dict" + ], + "db_value": { + "class": "File", + "location": "bid://b6b418fe-6c83-43a2-8bdc-f3af2b0954a7" + }, + "value": { + "path": "/juno/work/ci/resources/genomes/GRCm38/GRCm38.fasta", + "size": 2769885087, + "class": "File" + }, + "files": [ + "b6b418fe-6c83-43a2-8bdc-f3af2b0954a7" + ] + } + }, + { + "model": "runner.port", + "pk": "b7457771-aa9f-45eb-9d47-b2bac2ca9ce9", + "fields": { + "created_date": "2019-12-11T22:53:17.818Z", + "modified_date": "2020-02-04T15:29:52.648Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "hapmap", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".idx" + ], + "db_value": { + "class": "File", + "location": "bid://87b6a57c-f15b-49eb-9d22-d3893d2e00ef" + }, + "value": { + "path": "/juno/work/ci/resources/request_files/hapmap/hapmap_3.3.b37.vcf", + "size": 225898391, + "class": "File" + }, + "files": [ + "87b6a57c-f15b-49eb-9d22-d3893d2e00ef" + ] + } + }, + { + "model": "runner.port", + "pk": "f0f57a14-4f34-4ab3-9d7e-8e5469462859", + "fields": { + "created_date": "2019-12-11T22:53:17.862Z", + "modified_date": "2020-02-04T15:29:52.797Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "runparams", + "port_type": 0, + "schema": { + "type": "record", + "fields": { + "genome": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "tmp_dir": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "intervals": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "mutect_rf": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "complex_nn": { + "type": [ + "null", + "array" + ], + "items": "float" + }, + "complex_tn": { + "type": [ + "null", + "array" + ], + "items": "float" + }, + "covariates": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "delly_type": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "facets_cval": { + "type": [ + "null", + "array" + ], + "items": "int" + }, + "mutect_dcov": { + "type": [ + "null", + "array" + ], + "items": "int" + }, + "num_threads": { + "type": [ + "null", + "array" + ], + "items": "int" + }, + "scripts_bin": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "abra_ram_min": { + "type": [ + "null", + "array" + ], + "items": "int" + }, + "abra_scratch": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "facets_pcval": { + "type": [ + "null", + "array" + ], + "items": "int" + }, + "gatk_jar_path": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "project_prefix": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "opt_dup_pix_dist": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "emit_original_quals": { + "type": [ + "null", + "array" + ], + "items": "boolean" + }, + "num_cpu_threads_per_data_thread": { + "type": [ + "null", + "array" + ], + "items": "int" + } + } + }, + "secondary_files": [], + "db_value": { + "genome": "GRCh37", + "tmp_dir": "/scratch", + "intervals": [ + "1", + "2", + "3", + "4", + "5", + "6", + "7", + "8", + "9", + "10", + "11", + "12", + "13", + "14", + "15", + "16", + "17", + "18", + "19", + "20", + "21", + "22", + "X", + "Y", + "MT" + ], + "mutect_rf": [ + "BadCigar" + ], + "complex_nn": 0.1, + "complex_tn": 0.2, + "covariates": [ + "CycleCovariate", + "ContextCovariate", + "ReadGroupCovariate", + "QualityScoreCovariate" + ], + "delly_type": [ + "DUP", + "DEL", + "INV", + "INS", + "BND" + ], + "facets_cval": 100, + "mutect_dcov": 50000, + "num_threads": 10, + "scripts_bin": "/usr/bin", + "abra_ram_min": 84000, + "abra_scratch": "/scratch", + "facets_pcval": 500, + "gatk_jar_path": "/usr/bin/gatk.jar", + "project_prefix": [ + "09670_D" + ], + "opt_dup_pix_dist": "2500", + "emit_original_quals": true, + "num_cpu_threads_per_data_thread": 6 + }, + "value": { + "genome": "GRCh37", + "tmp_dir": "/scratch", + "intervals": [ + "1", + "2", + "3", + "4", + "5", + "6", + "7", + "8", + "9", + "10", + "11", + "12", + "13", + "14", + "15", + "16", + "17", + "18", + "19", + "20", + "21", + "22", + "X", + "Y", + "MT" + ], + "mutect_rf": [ + "BadCigar" + ], + "complex_nn": 0.1, + "complex_tn": 0.2, + "covariates": [ + "CycleCovariate", + "ContextCovariate", + "ReadGroupCovariate", + "QualityScoreCovariate" + ], + "delly_type": [ + "DUP", + "DEL", + "INV", + "INS", + "BND" + ], + "facets_cval": 100, + "mutect_dcov": 50000, + "num_threads": 10, + "scripts_bin": "/usr/bin", + "abra_ram_min": 84000, + "abra_scratch": "/scratch", + "facets_pcval": 500, + "gatk_jar_path": "/usr/bin/gatk.jar", + "project_prefix": [ + "09670_D" + ], + "opt_dup_pix_dist": "2500", + "emit_original_quals": true, + "num_cpu_threads_per_data_thread": 6 + }, + "files": [] + } + }, + { + "model": "runner.port", + "pk": "a5388100-69f2-42eb-b2cc-ca02676e5ed9", + "fields": { + "created_date": "2019-12-11T22:53:17.869Z", + "modified_date": "2020-02-04T15:29:52.810Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "pair", + "port_type": 0, + "schema": { + "type": "array", + "items": "record" + }, + "secondary_files": [], + "db_value": [ + { + "CN": "MSKCC", + "ID": "s_C_K2902H_P001_d", + "LB": "09670_D_1_1_1_1_1", + "PL": "Illumina", + "PU": [ + "H7HCTBBXY_ACATACGG" + ], + "R1": [ + { + "class": "File", + "location": "bid://242cebfb-2b22-4e69-9cbf-478c4f026c3d" + } + ], + "R2": [ + { + "class": "File", + "location": "bid://02cfb077-f61c-4659-9877-752c456e8f80" + } + ], + "bam": [], + "zR1": [], + "zR2": [], + "RG_ID": [ + "s_C_K2902H_P001_d_H7HCTBBXY_ACATACGG" + ], + "adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGCCGTCTTCTGCTTG", + "adapter2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT", + "bwa_output": "s_C_K2902H_P001_d.bam" + }, + { + "CN": "MSKCC", + "ID": "s_C_K2902H_N001_d", + "LB": "09670_D_46_1", + "PL": "Illumina", + "PU": [ + "H7FKJBBXY" + ], + "R1": [ + { + "class": "File", + "location": "bid://d320fc3a-07e6-46c6-88f4-ad6480cf446e" + } + ], + "R2": [ + { + "class": "File", + "location": "bid://47be3848-e16b-4126-9e64-1d3f5a67b927" + } + ], + "bam": [], + "zR1": [], + "zR2": [], + "RG_ID": [ + "s_C_K2902H_N001_d_H7FKJBBXY" + ], + "adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGCCGTCTTCTGCTTG", + "adapter2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT", + "bwa_output": "s_C_K2902H_N001_d.bam" + } + ], + "value": [ + { + "CN": "MSKCC", + "ID": "s_C_K2902H_P001_d", + "LB": "09670_D_1_1_1_1_1", + "PL": "Illumina", + "PU": [ + "H7HCTBBXY_ACATACGG" + ], + "R1": [ + { + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0390_BH7HCTBBXY/Project_09670_D/Sample_S16-68609_IGO_09670_D_1/S16-68609_IGO_09670_D_1_S11_R1_001.fastq.gz", + "size": 5966546453, + "class": "File" + } + ], + "R2": [ + { + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0390_BH7HCTBBXY/Project_09670_D/Sample_S16-68609_IGO_09670_D_1/S16-68609_IGO_09670_D_1_S11_R2_001.fastq.gz", + "size": 5832468368, + "class": "File" + } + ], + "bam": [], + "zR1": [], + "zR2": [], + "RG_ID": [ + "s_C_K2902H_P001_d_H7HCTBBXY_ACATACGG" + ], + "adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGCCGTCTTCTGCTTG", + "adapter2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT", + "bwa_output": "s_C_K2902H_P001_d.bam" + }, + { + "CN": "MSKCC", + "ID": "s_C_K2902H_N001_d", + "LB": "09670_D_46_1", + "PL": "Illumina", + "PU": [ + "H7FKJBBXY" + ], + "R1": [ + { + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0391_AH7FKJBBXY/Project_09670_D/Sample_P-0017035-N01-WES_IGO_09670_D_46/P-0017035-N01-WES_IGO_09670_D_46_S12_R1_001.fastq.gz", + "size": 3576965127, + "class": "File" + } + ], + "R2": [ + { + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0391_AH7FKJBBXY/Project_09670_D/Sample_P-0017035-N01-WES_IGO_09670_D_46/P-0017035-N01-WES_IGO_09670_D_46_S12_R2_001.fastq.gz", + "size": 3592299152, + "class": "File" + } + ], + "bam": [], + "zR1": [], + "zR2": [], + "RG_ID": [ + "s_C_K2902H_N001_d_H7FKJBBXY" + ], + "adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGCCGTCTTCTGCTTG", + "adapter2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT", + "bwa_output": "s_C_K2902H_N001_d.bam" + } + ], + "files": [ + "02cfb077-f61c-4659-9877-752c456e8f80", + "242cebfb-2b22-4e69-9cbf-478c4f026c3d", + "47be3848-e16b-4126-9e64-1d3f5a67b927", + "d320fc3a-07e6-46c6-88f4-ad6480cf446e" + ] + } + }, + { + "model": "runner.port", + "pk": "3abd6a10-21d2-49be-bc83-31dd207759ec", + "fields": { + "created_date": "2019-12-11T22:53:17.971Z", + "modified_date": "2020-02-04T15:29:58.827Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "annotate_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 65612975, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.annotate-variants.vcf", + "checksum": "sha1$0201d57f5fd370615df7ce8b78f49ae512692e0e", + "location": "bid://b835c33c-d241-42fc-beb2-e1ce1c41a77d", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.annotate-variants" + }, + "value": { + "size": 65612975, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.annotate-variants.vcf", + "checksum": "sha1$0201d57f5fd370615df7ce8b78f49ae512692e0e", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.annotate-variants.vcf", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.annotate-variants" + }, + "files": [ + "b835c33c-d241-42fc-beb2-e1ce1c41a77d" + ] + } + }, + { + "model": "runner.port", + "pk": "d83323d6-f422-4656-a232-d552e780d170", + "fields": { + "created_date": "2019-12-11T22:53:18.030Z", + "modified_date": "2020-02-04T15:29:59.003Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "maf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 181310718, + "class": "File", + "nameext": ".maf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.muts.maf", + "checksum": "sha1$15db27138a1586bf4f017b572154875c5ff129db", + "location": "bid://f9f55509-fcae-45f7-bdd2-72aebb59178e", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.muts" + }, + "value": { + "size": 181310718, + "class": "File", + "nameext": ".maf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.muts.maf", + "checksum": "sha1$15db27138a1586bf4f017b572154875c5ff129db", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.muts.maf", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.muts" + }, + "files": [ + "f9f55509-fcae-45f7-bdd2-72aebb59178e" + ] + } + }, + { + "model": "runner.port", + "pk": "aad31466-a189-447d-a73e-3f582662b52b", + "fields": { + "created_date": "2019-12-11T22:53:17.873Z", + "modified_date": "2020-02-04T15:29:59.010Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "bams", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + "^.bai" + ], + "db_value": [ + { + "size": 22899967017, + "class": "File", + "nameext": ".bam", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.bam", + "checksum": "sha1$d67cf2c24cacfeaa222893c5d4303aed55556457", + "location": "bid://e528ce76-0c6f-4088-8e22-38ece693bcdd", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads", + "secondaryFiles": [ + { + "size": 6252264, + "class": "File", + "nameext": ".bai", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.bai", + "checksum": "sha1$776fc843bcdbd215452e611f03d7d9b42ad05a09", + "location": "bid://a0184edc-0a1c-40e7-9d41-69dda2e1e23e", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads" + } + ] + }, + { + "size": 14961505727, + "class": "File", + "nameext": ".bam", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.bam", + "checksum": "sha1$45f52cc5db96a9d90784ddcee324cedbe1ac5618", + "location": "bid://f6d0fd8d-cae6-469d-ab57-f22ab55178c9", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads", + "secondaryFiles": [ + { + "size": 6010352, + "class": "File", + "nameext": ".bai", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.bai", + "checksum": "sha1$67a9aff1f1cd7be0240b7fefe740f7852dee4933", + "location": "bid://12ffa7a4-b853-452d-8076-fde5bac09aec", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads" + } + ] + } + ], + "value": [ + { + "size": 22899967017, + "class": "File", + "nameext": ".bam", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.bam", + "checksum": "sha1$d67cf2c24cacfeaa222893c5d4303aed55556457", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.bam", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads", + "secondaryFiles": [ + { + "size": 6252264, + "class": "File", + "nameext": ".bai", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.bai", + "checksum": "sha1$776fc843bcdbd215452e611f03d7d9b42ad05a09", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.bai", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads" + } + ] + }, + { + "size": 14961505727, + "class": "File", + "nameext": ".bam", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.bam", + "checksum": "sha1$45f52cc5db96a9d90784ddcee324cedbe1ac5618", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads.bam", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads", + "secondaryFiles": [ + { + "size": 6010352, + "class": "File", + "nameext": ".bai", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.bai", + "checksum": "sha1$67a9aff1f1cd7be0240b7fefe740f7852dee4933", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads.bai", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads" + } + ] + } + ], + "files": [ + "e528ce76-0c6f-4088-8e22-38ece693bcdd", + "f6d0fd8d-cae6-469d-ab57-f22ab55178c9" + ] + } + }, + { + "model": "runner.port", + "pk": "0be0ceba-0959-4173-a65c-0e6f13604211", + "fields": { + "created_date": "2019-12-11T22:53:17.876Z", + "modified_date": "2020-02-04T15:29:59.025Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "clstats1", + "port_type": 1, + "schema": { + "type": "array", + "items": "array" + }, + "secondary_files": [], + "db_value": [ + [ + { + "size": 2641, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk000_cl.stats", + "checksum": "sha1$c3c14c67c47c1a9502a528685d8f24f1eda9dccd", + "location": "bid://0f1e06cb-c77b-4988-994f-797eab18cbea", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk000_cl" + }, + { + "size": 2611, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk001_cl.stats", + "checksum": "sha1$15260c3f7d8a521e7d2021f2581f8ffd96ff9519", + "location": "bid://48dd6384-7034-4cc7-9027-7df71496eb27", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk001_cl" + }, + { + "size": 2576, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk002_cl.stats", + "checksum": "sha1$ef853b586f31afefcabe8be9ba28bcddd5e47919", + "location": "bid://2c2b195f-514c-4107-af3a-8488cf6547ea", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk002_cl" + } + ], + [ + { + "size": 2764, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk000_cl.stats", + "checksum": "sha1$581103c999b49f012af12d4dd579a48ab7573991", + "location": "bid://2af79d18-4ba7-4aef-8505-bd775d47b00d", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk000_cl" + }, + { + "size": 2714, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk001_cl.stats", + "checksum": "sha1$fe2dd352e11bc48feefc6f7e1035ea0b5c8265dc", + "location": "bid://2a1736ce-50fd-4721-92da-474f67318c8d", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk001_cl" + } + ] + ], + "value": [ + [ + { + "size": 2641, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk000_cl.stats", + "checksum": "sha1$c3c14c67c47c1a9502a528685d8f24f1eda9dccd", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk000_cl.stats", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk000_cl" + }, + { + "size": 2611, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk001_cl.stats", + "checksum": "sha1$15260c3f7d8a521e7d2021f2581f8ffd96ff9519", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk001_cl.stats", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk001_cl" + }, + { + "size": 2576, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk002_cl.stats", + "checksum": "sha1$ef853b586f31afefcabe8be9ba28bcddd5e47919", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk002_cl.stats", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk002_cl" + } + ], + [ + { + "size": 2764, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk000_cl.stats", + "checksum": "sha1$581103c999b49f012af12d4dd579a48ab7573991", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk000_cl.stats", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk000_cl" + }, + { + "size": 2714, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk001_cl.stats", + "checksum": "sha1$fe2dd352e11bc48feefc6f7e1035ea0b5c8265dc", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk001_cl.stats", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk001_cl" + } + ] + ], + "files": [ + "0f1e06cb-c77b-4988-994f-797eab18cbea", + "2a1736ce-50fd-4721-92da-474f67318c8d", + "2af79d18-4ba7-4aef-8505-bd775d47b00d", + "2c2b195f-514c-4107-af3a-8488cf6547ea", + "48dd6384-7034-4cc7-9027-7df71496eb27" + ] + } + }, + { + "model": "runner.port", + "pk": "ba34a02a-0a12-4e50-a233-f962b644ac5e", + "fields": { + "created_date": "2019-12-11T22:53:17.879Z", + "modified_date": "2020-02-04T15:29:59.042Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "clstats2", + "port_type": 1, + "schema": { + "type": "array", + "items": "array" + }, + "secondary_files": [], + "db_value": [ + [ + { + "size": 2818, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk000_cl.stats", + "checksum": "sha1$883cf9ba173211144550938349dfdbeefb6f38ee", + "location": "bid://e6d2247d-c056-467b-8ddb-6cf6e0387f26", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk000_cl" + }, + { + "size": 2815, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk001_cl.stats", + "checksum": "sha1$78e3a8aab3b20c83dee40acea967e25893ec2065", + "location": "bid://aecc788a-ebd8-4e3d-bb25-6bc6a373f5fa", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk001_cl" + }, + { + "size": 2775, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk002_cl.stats", + "checksum": "sha1$83cee0ca80ff374fd6049f9cbf475fb81a380d91", + "location": "bid://e0ad9888-930b-4c87-9797-a5a88894cb2a", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk002_cl" + } + ], + [ + { + "size": 2873, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk000_cl.stats", + "checksum": "sha1$2f9093a15e3a538e80653637690e0410779df620", + "location": "bid://75f8f49a-ffe7-4cf4-8956-0adacfe9f6f6", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk000_cl" + }, + { + "size": 2826, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk001_cl.stats", + "checksum": "sha1$e583971745676ccfbbb0b09474f74ecef10ea922", + "location": "bid://2a41fde8-172a-439c-8a9e-9681069c87fa", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk001_cl" + } + ] + ], + "value": [ + [ + { + "size": 2818, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk000_cl.stats", + "checksum": "sha1$883cf9ba173211144550938349dfdbeefb6f38ee", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk000_cl.stats", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk000_cl" + }, + { + "size": 2815, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk001_cl.stats", + "checksum": "sha1$78e3a8aab3b20c83dee40acea967e25893ec2065", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk001_cl.stats", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk001_cl" + }, + { + "size": 2775, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk002_cl.stats", + "checksum": "sha1$83cee0ca80ff374fd6049f9cbf475fb81a380d91", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk002_cl.stats", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk002_cl" + } + ], + [ + { + "size": 2873, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk000_cl.stats", + "checksum": "sha1$2f9093a15e3a538e80653637690e0410779df620", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk000_cl.stats", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk000_cl" + }, + { + "size": 2826, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk001_cl.stats", + "checksum": "sha1$e583971745676ccfbbb0b09474f74ecef10ea922", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk001_cl.stats", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk001_cl" + } + ] + ], + "files": [ + "2a41fde8-172a-439c-8a9e-9681069c87fa", + "75f8f49a-ffe7-4cf4-8956-0adacfe9f6f6", + "aecc788a-ebd8-4e3d-bb25-6bc6a373f5fa", + "e0ad9888-930b-4c87-9797-a5a88894cb2a", + "e6d2247d-c056-467b-8ddb-6cf6e0387f26" + ] + } + }, + { + "model": "runner.port", + "pk": "47ed87d7-ac01-4a86-96b5-3b3c795b375a", + "fields": { + "created_date": "2019-12-11T22:53:18.020Z", + "modified_date": "2020-02-04T15:29:59.046Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "maf_file", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 59073, + "class": "File", + "nameext": ".maf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.maf", + "checksum": "sha1$bc1d7f73cc72eecf3b13f88402d6952c92d933de", + "location": "bid://463c0311-e32f-40ae-a1a2-d831431997b7", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep" + }, + "value": { + "size": 59073, + "class": "File", + "nameext": ".maf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.maf", + "checksum": "sha1$bc1d7f73cc72eecf3b13f88402d6952c92d933de", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.maf", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep" + }, + "files": [ + "463c0311-e32f-40ae-a1a2-d831431997b7" + ] + } + }, + { + "model": "runner.port", + "pk": "13610edb-6b99-41dd-8117-6b9df9f895dc", + "fields": { + "created_date": "2019-12-11T22:53:17.932Z", + "modified_date": "2020-02-04T15:29:59.053Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "qual_pdf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 8189, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "checksum": "sha1$9ff5ad812b693a79512b12506f59d5d67df87c05", + "location": "bid://0fdc6110-b18f-4ef0-9c50-9905bf4a22a9", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle" + }, + { + "size": 8219, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "checksum": "sha1$716fb1c1bcd8040ecc6e4452cbbae25a20435c52", + "location": "bid://9290ce2b-2dbd-4253-a4dd-9edf7fe79114", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle" + } + ], + "value": [ + { + "size": 8189, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "checksum": "sha1$9ff5ad812b693a79512b12506f59d5d67df87c05", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle" + }, + { + "size": 8219, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "checksum": "sha1$716fb1c1bcd8040ecc6e4452cbbae25a20435c52", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle" + } + ], + "files": [ + "0fdc6110-b18f-4ef0-9c50-9905bf4a22a9", + "9290ce2b-2dbd-4253-a4dd-9edf7fe79114" + ] + } + }, + { + "model": "runner.port", + "pk": "4f9ab52a-7061-4bde-bdf7-26a1f2d88bf1", + "fields": { + "created_date": "2019-12-11T22:53:17.892Z", + "modified_date": "2020-02-04T15:29:59.059Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "as_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 2171, + "class": "File", + "nameext": ".asmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.asmetrics", + "checksum": "sha1$7e891f9f68deedb83626c728109097d9c562f7a1", + "location": "bid://b9cd207a-f8d5-4c41-8506-f8bb6b0f61af", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 2134, + "class": "File", + "nameext": ".asmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.asmetrics", + "checksum": "sha1$65ab3f206ead19b7ae3aa0eb4a9d1c5e7dff9843", + "location": "bid://22a814db-f3ad-4fb2-ae81-c56b41f01f13", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "value": [ + { + "size": 2171, + "class": "File", + "nameext": ".asmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.asmetrics", + "checksum": "sha1$7e891f9f68deedb83626c728109097d9c562f7a1", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.asmetrics", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 2134, + "class": "File", + "nameext": ".asmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.asmetrics", + "checksum": "sha1$65ab3f206ead19b7ae3aa0eb4a9d1c5e7dff9843", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.asmetrics", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "files": [ + "22a814db-f3ad-4fb2-ae81-c56b41f01f13", + "b9cd207a-f8d5-4c41-8506-f8bb6b0f61af" + ] + } + }, + { + "model": "runner.port", + "pk": "a5dd52ef-36be-42d0-a338-030be7e21fa3", + "fields": { + "created_date": "2019-12-11T22:53:17.997Z", + "modified_date": "2020-02-04T15:29:59.066Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "facets_out", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 603, + "class": "File", + "nameext": ".out", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.out", + "checksum": "sha1$adf1df0bad06a20de898606152b4562d13de5fba", + "location": "bid://48a16d33-0fd4-41df-9bca-fe87c15c119e", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens" + }, + { + "size": 602, + "class": "File", + "nameext": ".out", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.out", + "checksum": "sha1$f376bc7c0c427199a8319cbe95fc368abc914535", + "location": "bid://734731f7-a505-4aaa-957e-ce706342f555", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity" + } + ], + "value": [ + { + "size": 603, + "class": "File", + "nameext": ".out", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.out", + "checksum": "sha1$adf1df0bad06a20de898606152b4562d13de5fba", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.out", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens" + }, + { + "size": 602, + "class": "File", + "nameext": ".out", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.out", + "checksum": "sha1$f376bc7c0c427199a8319cbe95fc368abc914535", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.out", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity" + } + ], + "files": [ + "48a16d33-0fd4-41df-9bca-fe87c15c119e", + "734731f7-a505-4aaa-957e-ce706342f555" + ] + } + }, + { + "model": "runner.port", + "pk": "e110e9fc-3bef-42b7-a0ba-a4b8856ca8b9", + "fields": { + "created_date": "2019-12-11T22:53:17.986Z", + "modified_date": "2020-02-04T15:29:59.077Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "facets_png", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 124853, + "class": "File", + "nameext": ".png", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.CNCF.png", + "checksum": "sha1$aa3cfccae19203ef9fa352574ecdbf8db6b42d5a", + "location": "bid://a813b899-7525-480b-9a8d-fe844abf06cf", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.CNCF" + }, + { + "size": 111084, + "class": "File", + "nameext": ".png", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.CNCF.png", + "checksum": "sha1$dd13091946cb9b1ae3c002c0b86f8c1ca8f7bdea", + "location": "bid://9cbfedb0-dac4-4151-ac25-2553fc46fad6", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.CNCF" + } + ], + "value": [ + { + "size": 124853, + "class": "File", + "nameext": ".png", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.CNCF.png", + "checksum": "sha1$aa3cfccae19203ef9fa352574ecdbf8db6b42d5a", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.CNCF.png", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.CNCF" + }, + { + "size": 111084, + "class": "File", + "nameext": ".png", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.CNCF.png", + "checksum": "sha1$dd13091946cb9b1ae3c002c0b86f8c1ca8f7bdea", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.CNCF.png", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.CNCF" + } + ], + "files": [ + "9cbfedb0-dac4-4151-ac25-2553fc46fad6", + "a813b899-7525-480b-9a8d-fe844abf06cf" + ] + } + }, + { + "model": "runner.port", + "pk": "917e9d14-e93c-41ce-b46c-5e03774b2f59", + "fields": { + "created_date": "2019-12-11T22:53:18.005Z", + "modified_date": "2020-02-04T15:29:59.084Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "facets_seg", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 4777, + "class": "File", + "nameext": ".seg", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.seg", + "checksum": "sha1$31d0a6687ac647922e9d67a0d2d6a28a7e16ec7a", + "location": "bid://1e25988d-2f5d-45bf-ab60-a3e8bf3b0811", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens" + }, + { + "size": 3222, + "class": "File", + "nameext": ".seg", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.seg", + "checksum": "sha1$d15b1f7136fb9d107297f35abffd2ee9c9a229ac", + "location": "bid://97923d95-86f5-4f95-ab20-3cb7882b79cc", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity" + } + ], + "value": [ + { + "size": 4777, + "class": "File", + "nameext": ".seg", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.seg", + "checksum": "sha1$31d0a6687ac647922e9d67a0d2d6a28a7e16ec7a", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.seg", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens" + }, + { + "size": 3222, + "class": "File", + "nameext": ".seg", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.seg", + "checksum": "sha1$d15b1f7136fb9d107297f35abffd2ee9c9a229ac", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.seg", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity" + } + ], + "files": [ + "1e25988d-2f5d-45bf-ab60-a3e8bf3b0811", + "97923d95-86f5-4f95-ab20-3cb7882b79cc" + ] + } + }, + { + "model": "runner.port", + "pk": "d3022dfb-3571-44b2-85ba-a3f6366a99ff", + "fields": { + "created_date": "2019-12-11T22:53:17.939Z", + "modified_date": "2020-02-04T15:29:59.091Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "gcbias_pdf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 6784, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_P001_d.rg.md.gcbias.pdf", + "checksum": "sha1$4d1ed6c4bda99d26a031b9e9651f2f4abe8cfdd2", + "location": "bid://ad08e7ac-2877-41da-a16a-f468f3130158", + "nameroot": "s_C_K2902H_P001_d.rg.md.gcbias" + }, + { + "size": 6794, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_N001_d.rg.md.gcbias.pdf", + "checksum": "sha1$010c3e9323875594fa4d4469c13b91db5a46e8cc", + "location": "bid://7694cc12-25c1-4585-93ce-fa5c540b5f17", + "nameroot": "s_C_K2902H_N001_d.rg.md.gcbias" + } + ], + "value": [ + { + "size": 6784, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_P001_d.rg.md.gcbias.pdf", + "checksum": "sha1$4d1ed6c4bda99d26a031b9e9651f2f4abe8cfdd2", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.gcbias.pdf", + "nameroot": "s_C_K2902H_P001_d.rg.md.gcbias" + }, + { + "size": 6794, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_N001_d.rg.md.gcbias.pdf", + "checksum": "sha1$010c3e9323875594fa4d4469c13b91db5a46e8cc", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.gcbias.pdf", + "nameroot": "s_C_K2902H_N001_d.rg.md.gcbias" + } + ], + "files": [ + "7694cc12-25c1-4585-93ce-fa5c540b5f17", + "ad08e7ac-2877-41da-a16a-f468f3130158" + ] + } + }, + { + "model": "runner.port", + "pk": "acdf5eba-b287-4ecf-9db4-b9602d2854db", + "fields": { + "created_date": "2019-12-11T22:53:17.897Z", + "modified_date": "2020-02-04T15:29:59.098Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "hs_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 5016, + "class": "File", + "nameext": ".hsmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.hsmetrics", + "checksum": "sha1$d6ba79849a45f9fa69092453ada9f5992e7c0abb", + "location": "bid://4d8d1cf0-fc62-4ed6-a0bd-0dfbef86b277", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 5029, + "class": "File", + "nameext": ".hsmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.hsmetrics", + "checksum": "sha1$2b08239d16dc6787ab37a7403313d46264877c7e", + "location": "bid://e4475a18-ce54-40c1-82cf-dd9323157658", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "value": [ + { + "size": 5016, + "class": "File", + "nameext": ".hsmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.hsmetrics", + "checksum": "sha1$d6ba79849a45f9fa69092453ada9f5992e7c0abb", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.hsmetrics", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 5029, + "class": "File", + "nameext": ".hsmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.hsmetrics", + "checksum": "sha1$2b08239d16dc6787ab37a7403313d46264877c7e", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.hsmetrics", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "files": [ + "4d8d1cf0-fc62-4ed6-a0bd-0dfbef86b277", + "e4475a18-ce54-40c1-82cf-dd9323157658" + ] + } + }, + { + "model": "runner.port", + "pk": "032f1e1c-25d0-447b-bbf1-d1df336c8c1a", + "fields": { + "created_date": "2019-12-11T22:53:17.920Z", + "modified_date": "2020-02-04T15:29:59.105Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "insert_pdf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 13994, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_P001_d.rg.md.ismetrics.pdf", + "checksum": "sha1$aa4d306c3b2327fe6e84ebf6b371ca79644ec649", + "location": "bid://ff35af28-dbe9-47e6-b55b-2d7d01c4cc63", + "nameroot": "s_C_K2902H_P001_d.rg.md.ismetrics" + }, + { + "size": 12712, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_N001_d.rg.md.ismetrics.pdf", + "checksum": "sha1$5a57d43594e74ac8615409802377346f212e1cf7", + "location": "bid://8954096e-64c4-4393-9721-95c5b880b18b", + "nameroot": "s_C_K2902H_N001_d.rg.md.ismetrics" + } + ], + "value": [ + { + "size": 13994, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_P001_d.rg.md.ismetrics.pdf", + "checksum": "sha1$aa4d306c3b2327fe6e84ebf6b371ca79644ec649", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.ismetrics.pdf", + "nameroot": "s_C_K2902H_P001_d.rg.md.ismetrics" + }, + { + "size": 12712, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_N001_d.rg.md.ismetrics.pdf", + "checksum": "sha1$5a57d43594e74ac8615409802377346f212e1cf7", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.ismetrics.pdf", + "nameroot": "s_C_K2902H_N001_d.rg.md.ismetrics" + } + ], + "files": [ + "8954096e-64c4-4393-9721-95c5b880b18b", + "ff35af28-dbe9-47e6-b55b-2d7d01c4cc63" + ] + } + }, + { + "model": "runner.port", + "pk": "6b0f48b8-432f-41cd-a148-04889e63b5c0", + "fields": { + "created_date": "2019-12-11T22:53:17.884Z", + "modified_date": "2020-02-04T15:29:59.117Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "md_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 2900, + "class": "File", + "nameext": ".md_metrics", + "basename": "s_C_K2902H_P001_d.rg.md_metrics", + "checksum": "sha1$379ec0abb55e3b1ff9adb8ff82ed31689aa8062b", + "location": "bid://bdc504e0-bf83-4093-b14f-a6ce0ef94acc", + "nameroot": "s_C_K2902H_P001_d.rg" + }, + { + "size": 2866, + "class": "File", + "nameext": ".md_metrics", + "basename": "s_C_K2902H_N001_d.rg.md_metrics", + "checksum": "sha1$d2005e5e85d9e581671522c74548c8623d2c1979", + "location": "bid://11a1da3d-5dad-493f-83a5-c5d5fe14d39e", + "nameroot": "s_C_K2902H_N001_d.rg" + } + ], + "value": [ + { + "size": 2900, + "class": "File", + "nameext": ".md_metrics", + "basename": "s_C_K2902H_P001_d.rg.md_metrics", + "checksum": "sha1$379ec0abb55e3b1ff9adb8ff82ed31689aa8062b", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md_metrics", + "nameroot": "s_C_K2902H_P001_d.rg" + }, + { + "size": 2866, + "class": "File", + "nameext": ".md_metrics", + "basename": "s_C_K2902H_N001_d.rg.md_metrics", + "checksum": "sha1$d2005e5e85d9e581671522c74548c8623d2c1979", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md_metrics", + "nameroot": "s_C_K2902H_N001_d.rg" + } + ], + "files": [ + "11a1da3d-5dad-493f-83a5-c5d5fe14d39e", + "bdc504e0-bf83-4093-b14f-a6ce0ef94acc" + ] + } + }, + { + "model": "runner.port", + "pk": "789915c8-14da-49ac-9249-b1e99ce1f5d3", + "fields": { + "created_date": "2019-12-11T22:53:17.956Z", + "modified_date": "2020-02-04T15:29:59.121Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "mutect_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 24213327, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.vcf", + "checksum": "sha1$dc5d1aeb90cee217d736222d2dada308973832d6", + "location": "bid://dd8d50f9-389f-49e4-ae3a-17510322684c", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect" + }, + "value": { + "size": 24213327, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.vcf", + "checksum": "sha1$dc5d1aeb90cee217d736222d2dada308973832d6", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.vcf", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect" + }, + "files": [ + "dd8d50f9-389f-49e4-ae3a-17510322684c" + ] + } + }, + { + "model": "runner.port", + "pk": "c4a65c71-128e-417b-a020-4edf6f2cfbe9", + "fields": { + "created_date": "2019-12-11T22:53:17.968Z", + "modified_date": "2020-02-04T15:29:59.125Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "combine_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".tbi" + ], + "db_value": { + "size": 13440159, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz", + "checksum": "sha1$11cb5a6370052fdfb1d83da53a7161cf3592e8f5", + "location": "bid://5d58f2d4-46dc-49f3-8e39-5c1e43a3d55b", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf", + "secondaryFiles": [ + { + "size": 430453, + "class": "File", + "nameext": ".tbi", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz.tbi", + "checksum": "sha1$dd9315feeb320ec777dac7297b3a9bfc7a5d6c33", + "location": "bid://ae7708c1-6e92-480b-a550-5c847056e0ca", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz" + } + ] + }, + "value": { + "size": 13440159, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz", + "checksum": "sha1$11cb5a6370052fdfb1d83da53a7161cf3592e8f5", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf", + "secondaryFiles": [ + { + "size": 430453, + "class": "File", + "nameext": ".tbi", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz.tbi", + "checksum": "sha1$dd9315feeb320ec777dac7297b3a9bfc7a5d6c33", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz.tbi", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz" + } + ] + }, + "files": [ + "5d58f2d4-46dc-49f3-8e39-5c1e43a3d55b" + ] + } + }, + { + "model": "runner.port", + "pk": "d112b0b3-24e1-47d4-b57f-0969412bd679", + "fields": { + "created_date": "2019-12-11T22:53:18.014Z", + "modified_date": "2020-02-04T15:29:59.129Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "merged_file", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 19739, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vcf", + "checksum": "sha1$c016b28102cd0e828dda14b1dfca985f822849ed", + "location": "bid://d72930a5-6916-4d32-b9de-55c9e27a92df", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass" + }, + "value": { + "size": 19739, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vcf", + "checksum": "sha1$c016b28102cd0e828dda14b1dfca985f822849ed", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vcf", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass" + }, + "files": [ + "d72930a5-6916-4d32-b9de-55c9e27a92df" + ] + } + }, + { + "model": "runner.port", + "pk": "a5354486-b417-4b9a-9912-f8a297050b4b", + "fields": { + "created_date": "2019-12-11T22:53:18.026Z", + "modified_date": "2020-02-04T15:29:59.133Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "portal_file", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 5795, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.portal.txt", + "checksum": "sha1$14d8ca3da33d4d318fa5f5e2cdf77f8687a62148", + "location": "bid://2e0d7c0a-be9c-4969-a65e-0139e95ebdc1", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.portal" + }, + "value": { + "size": 5795, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.portal.txt", + "checksum": "sha1$14d8ca3da33d4d318fa5f5e2cdf77f8687a62148", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.portal.txt", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.portal" + }, + "files": [ + "2e0d7c0a-be9c-4969-a65e-0139e95ebdc1" + ] + } + }, + { + "model": "runner.port", + "pk": "bc60b89d-8146-4f31-8c62-65ccf93576d8", + "fields": { + "created_date": "2019-12-11T22:53:17.965Z", + "modified_date": "2020-02-04T15:29:59.137Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "vardict_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 403491742, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.vcf", + "checksum": "sha1$cbcd1bd27821f1c527434bfe9abace8d3320819e", + "location": "bid://2167517e-4230-4660-a3e2-f1f53d492e60", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict" + }, + "value": { + "size": 403491742, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.vcf", + "checksum": "sha1$cbcd1bd27821f1c527434bfe9abace8d3320819e", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.vcf", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict" + }, + "files": [ + "2167517e-4230-4660-a3e2-f1f53d492e60" + ] + } + }, + { + "model": "runner.port", + "pk": "17a83add-f932-435f-aa7e-1898312cbd3a", + "fields": { + "created_date": "2019-12-11T22:53:18.003Z", + "modified_date": "2020-02-04T15:29:59.147Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "facets_rdata", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 8622126, + "class": "File", + "nameext": ".Rdata", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.Rdata", + "checksum": "sha1$1e47fce47992626a03fe84ebcb3e95a0fecea4f1", + "location": "bid://587840dc-bcb6-48e6-9000-ae912c415d7c", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens" + }, + { + "size": 8618530, + "class": "File", + "nameext": ".Rdata", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.Rdata", + "checksum": "sha1$b990bfe8c0471672e76056a0f291b5d4ee81d4d9", + "location": "bid://c1b4ba39-e14b-4535-88f1-53de2f5809c9", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity" + } + ], + "value": [ + { + "size": 8622126, + "class": "File", + "nameext": ".Rdata", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.Rdata", + "checksum": "sha1$1e47fce47992626a03fe84ebcb3e95a0fecea4f1", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.Rdata", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens" + }, + { + "size": 8618530, + "class": "File", + "nameext": ".Rdata", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.Rdata", + "checksum": "sha1$b990bfe8c0471672e76056a0f291b5d4ee81d4d9", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.Rdata", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity" + } + ], + "files": [ + "587840dc-bcb6-48e6-9000-ae912c415d7c", + "c1b4ba39-e14b-4535-88f1-53de2f5809c9" + ] + } + }, + { + "model": "runner.port", + "pk": "88c2cfc2-1379-436b-ae7e-381e9fa8d41d", + "fields": { + "created_date": "2019-12-11T22:53:17.928Z", + "modified_date": "2020-02-04T15:29:59.154Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "qual_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 5494, + "class": "File", + "nameext": ".quality_by_cycle_metrics", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "checksum": "sha1$dad5640a5406c875b7fdaf4103b6edc2f763be56", + "location": "bid://df4b1eb1-640f-486c-846f-6df01c5896ac", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics" + }, + { + "size": 5508, + "class": "File", + "nameext": ".quality_by_cycle_metrics", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "checksum": "sha1$e804183b1e07cfa754330005de8ff5c864130a41", + "location": "bid://5ed9c450-1af5-422c-8c74-f60219ad3d26", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics" + } + ], + "value": [ + { + "size": 5494, + "class": "File", + "nameext": ".quality_by_cycle_metrics", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "checksum": "sha1$dad5640a5406c875b7fdaf4103b6edc2f763be56", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics" + }, + { + "size": 5508, + "class": "File", + "nameext": ".quality_by_cycle_metrics", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "checksum": "sha1$e804183b1e07cfa754330005de8ff5c864130a41", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics" + } + ], + "files": [ + "5ed9c450-1af5-422c-8c74-f60219ad3d26", + "df4b1eb1-640f-486c-846f-6df01c5896ac" + ] + } + }, + { + "model": "runner.port", + "pk": "07d8bc0d-2425-43b8-8a4f-281e6802f706", + "fields": { + "created_date": "2019-12-11T22:53:18.008Z", + "modified_date": "2020-02-04T15:29:59.158Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "facets_counts", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 32693698, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads.dat.gz", + "checksum": "sha1$a6f95a5e09c9e581321079f1f5fedd003ae5c221", + "location": "bid://262c3d19-2d59-403d-bd2b-66e0fe404413", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads.dat" + }, + "value": { + "size": 32693698, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads.dat.gz", + "checksum": "sha1$a6f95a5e09c9e581321079f1f5fedd003ae5c221", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads.dat.gz", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads.dat" + }, + "files": [ + "262c3d19-2d59-403d-bd2b-66e0fe404413" + ] + } + }, + { + "model": "runner.port", + "pk": "70e4ee3c-e265-4c83-80db-d1719aada8f7", + "fields": { + "created_date": "2019-12-11T22:53:17.935Z", + "modified_date": "2020-02-04T15:29:59.164Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "doc_basecounts", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 13779990, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_P001_d.rg.md_FP_base_counts.txt", + "checksum": "sha1$f2677685cda917f388dd395b7715d07ae1090ff4", + "location": "bid://dfc3e0f6-be3c-4a1c-a2b7-fc8fb8791b1d", + "nameroot": "s_C_K2902H_P001_d.rg.md_FP_base_counts" + }, + { + "size": 13586169, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_N001_d.rg.md_FP_base_counts.txt", + "checksum": "sha1$a218a74b136aac74f9227e6cea7720c14fb0abce", + "location": "bid://4c1e5a08-70c1-4dcf-9d4b-b4d0d67ba3a7", + "nameroot": "s_C_K2902H_N001_d.rg.md_FP_base_counts" + } + ], + "value": [ + { + "size": 13779990, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_P001_d.rg.md_FP_base_counts.txt", + "checksum": "sha1$f2677685cda917f388dd395b7715d07ae1090ff4", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md_FP_base_counts.txt", + "nameroot": "s_C_K2902H_P001_d.rg.md_FP_base_counts" + }, + { + "size": 13586169, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_N001_d.rg.md_FP_base_counts.txt", + "checksum": "sha1$a218a74b136aac74f9227e6cea7720c14fb0abce", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md_FP_base_counts.txt", + "nameroot": "s_C_K2902H_N001_d.rg.md_FP_base_counts" + } + ], + "files": [ + "4c1e5a08-70c1-4dcf-9d4b-b4d0d67ba3a7", + "dfc3e0f6-be3c-4a1c-a2b7-fc8fb8791b1d" + ] + } + }, + { + "model": "runner.port", + "pk": "ef869104-5820-4313-9d8d-59d0cb8278a0", + "fields": { + "created_date": "2019-12-11T22:53:17.942Z", + "modified_date": "2020-02-04T15:29:59.171Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "gcbias_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 6648, + "class": "File", + "nameext": ".gcbiasmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.gcbiasmetrics", + "checksum": "sha1$bb7469356a97449579bdd25e0ab600d2a8fa426d", + "location": "bid://23fdfe62-3e90-4db4-b533-acadf2f4e1b2", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 6632, + "class": "File", + "nameext": ".gcbiasmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.gcbiasmetrics", + "checksum": "sha1$01cbb4e6bca86f1d857ccb6446b7188d6892d71a", + "location": "bid://b950c7ff-84c1-4476-99e1-6f0b16626f76", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "value": [ + { + "size": 6648, + "class": "File", + "nameext": ".gcbiasmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.gcbiasmetrics", + "checksum": "sha1$bb7469356a97449579bdd25e0ab600d2a8fa426d", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.gcbiasmetrics", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 6632, + "class": "File", + "nameext": ".gcbiasmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.gcbiasmetrics", + "checksum": "sha1$01cbb4e6bca86f1d857ccb6446b7188d6892d71a", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.gcbiasmetrics", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "files": [ + "23fdfe62-3e90-4db4-b533-acadf2f4e1b2", + "b950c7ff-84c1-4476-99e1-6f0b16626f76" + ] + } + }, + { + "model": "runner.port", + "pk": "fdbb93c3-2287-4491-bcaa-826a189b98be", + "fields": { + "created_date": "2019-12-11T22:53:17.946Z", + "modified_date": "2020-02-04T15:29:59.182Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "gcbias_summary", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 1201, + "class": "File", + "nameext": ".summary", + "basename": "s_C_K2902H_P001_d.rg.md.gcbias.summary", + "checksum": "sha1$c6ca330351060e014b450e87b8fdd43731be79f6", + "location": "bid://3cab6e36-70f5-46df-aa00-a4473cb8ed50", + "nameroot": "s_C_K2902H_P001_d.rg.md.gcbias" + }, + { + "size": 1199, + "class": "File", + "nameext": ".summary", + "basename": "s_C_K2902H_N001_d.rg.md.gcbias.summary", + "checksum": "sha1$1932d9f758e45392212f1cf3c08a07ba988bde8c", + "location": "bid://44f519d5-a59c-4baa-bf08-2792460c78bc", + "nameroot": "s_C_K2902H_N001_d.rg.md.gcbias" + } + ], + "value": [ + { + "size": 1201, + "class": "File", + "nameext": ".summary", + "basename": "s_C_K2902H_P001_d.rg.md.gcbias.summary", + "checksum": "sha1$c6ca330351060e014b450e87b8fdd43731be79f6", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.gcbias.summary", + "nameroot": "s_C_K2902H_P001_d.rg.md.gcbias" + }, + { + "size": 1199, + "class": "File", + "nameext": ".summary", + "basename": "s_C_K2902H_N001_d.rg.md.gcbias.summary", + "checksum": "sha1$1932d9f758e45392212f1cf3c08a07ba988bde8c", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.gcbias.summary", + "nameroot": "s_C_K2902H_N001_d.rg.md.gcbias" + } + ], + "files": [ + "3cab6e36-70f5-46df-aa00-a4473cb8ed50", + "44f519d5-a59c-4baa-bf08-2792460c78bc" + ] + } + }, + { + "model": "runner.port", + "pk": "c2bf6266-d610-42b5-a474-8e17f94ac159", + "fields": { + "created_date": "2019-12-11T22:53:17.908Z", + "modified_date": "2020-02-04T15:29:59.188Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "insert_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 7754, + "class": "File", + "nameext": ".ismetrics", + "basename": "s_C_K2902H_P001_d.rg.md.ismetrics", + "checksum": "sha1$db6602f7efaf6fcce248ac81838e52c3e252fd24", + "location": "bid://c211d274-6cf8-4f37-a201-1441b3f3c716", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 7041, + "class": "File", + "nameext": ".ismetrics", + "basename": "s_C_K2902H_N001_d.rg.md.ismetrics", + "checksum": "sha1$ea3bd53219598f06bbae0868dcf4ebbcc38a4a5e", + "location": "bid://8265b3ed-0c3c-496c-ab97-ea312cf878db", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "value": [ + { + "size": 7754, + "class": "File", + "nameext": ".ismetrics", + "basename": "s_C_K2902H_P001_d.rg.md.ismetrics", + "checksum": "sha1$db6602f7efaf6fcce248ac81838e52c3e252fd24", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.ismetrics", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 7041, + "class": "File", + "nameext": ".ismetrics", + "basename": "s_C_K2902H_N001_d.rg.md.ismetrics", + "checksum": "sha1$ea3bd53219598f06bbae0868dcf4ebbcc38a4a5e", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.ismetrics", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "files": [ + "8265b3ed-0c3c-496c-ab97-ea312cf878db", + "c211d274-6cf8-4f37-a201-1441b3f3c716" + ] + } + }, + { + "model": "runner.port", + "pk": "1b99610f-fb5e-44e3-ae0d-06935ec428f3", + "fields": { + "created_date": "2019-12-11T22:53:17.952Z", + "modified_date": "2020-02-04T15:29:59.195Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "conpair_pileups", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 55203868, + "class": "File", + "nameext": ".pileup", + "basename": "s_C_K2902H_P001_d.rg.md.pileup", + "checksum": "sha1$611ccefbf82e2cc1414acd833fcf7252483d1241", + "location": "bid://8b2f58fc-ff9a-4d00-a3e2-c62228b99993", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 33915095, + "class": "File", + "nameext": ".pileup", + "basename": "s_C_K2902H_N001_d.rg.md.pileup", + "checksum": "sha1$3dacd4c14bd6a19468145e911e58e7a258199d4b", + "location": "bid://995ae979-5156-4107-a9e6-20ce77f59ecb", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "value": [ + { + "size": 55203868, + "class": "File", + "nameext": ".pileup", + "basename": "s_C_K2902H_P001_d.rg.md.pileup", + "checksum": "sha1$611ccefbf82e2cc1414acd833fcf7252483d1241", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.pileup", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 33915095, + "class": "File", + "nameext": ".pileup", + "basename": "s_C_K2902H_N001_d.rg.md.pileup", + "checksum": "sha1$3dacd4c14bd6a19468145e911e58e7a258199d4b", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.pileup", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "files": [ + "8b2f58fc-ff9a-4d00-a3e2-c62228b99993", + "995ae979-5156-4107-a9e6-20ce77f59ecb" + ] + } + }, + { + "model": "runner.port", + "pk": "5dfbdb99-c066-4367-88fb-61b4a36ec862", + "fields": { + "created_date": "2019-12-11T22:53:17.982Z", + "modified_date": "2020-02-04T15:29:59.199Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "mutect_norm_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".tbi" + ], + "db_value": { + "size": 129554, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz", + "checksum": "sha1$a8f6c855b471bcf37a456ad441f72c8cf1b43be9", + "location": "bid://7ba48896-0c1a-443e-8258-0a35914dfd3e", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf", + "secondaryFiles": [ + { + "size": 32515, + "class": "File", + "nameext": ".tbi", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz.tbi", + "checksum": "sha1$e4a5c3663691f31da1bba6352dc16e35f3a8a197", + "location": "bid://18c3cd81-baa9-4e25-8616-743956972e25", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz" + } + ] + }, + "value": { + "size": 129554, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz", + "checksum": "sha1$a8f6c855b471bcf37a456ad441f72c8cf1b43be9", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf", + "secondaryFiles": [ + { + "size": 32515, + "class": "File", + "nameext": ".tbi", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz.tbi", + "checksum": "sha1$e4a5c3663691f31da1bba6352dc16e35f3a8a197", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz.tbi", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz" + } + ] + }, + "files": [ + "7ba48896-0c1a-443e-8258-0a35914dfd3e" + ] + } + }, + { + "model": "runner.port", + "pk": "5a4cdbde-d41d-4028-9f11-803a998dd8dd", + "fields": { + "created_date": "2019-12-11T22:53:17.959Z", + "modified_date": "2020-02-04T15:29:59.203Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "mutect_callstats", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 172715192, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.txt", + "checksum": "sha1$7920889c2817038fb047c01d40187a083d928180", + "location": "bid://86a62cf2-398d-4876-b195-e2780ba594bd", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect" + }, + "value": { + "size": 172715192, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.txt", + "checksum": "sha1$7920889c2817038fb047c01d40187a083d928180", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.txt", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect" + }, + "files": [ + "86a62cf2-398d-4876-b195-e2780ba594bd" + ] + } + }, + { + "model": "runner.port", + "pk": "a9207ba2-c6a9-43de-ad25-14079ec6f993", + "fields": { + "created_date": "2019-12-11T22:53:17.975Z", + "modified_date": "2020-02-04T15:29:59.212Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "vardict_norm_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".tbi" + ], + "db_value": { + "size": 13247144, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz", + "checksum": "sha1$d377fe9dea989c10fc9bff2a02f215ac75aec897", + "location": "bid://92c9dd48-f4de-4788-b7a3-fe9ff7d17d7b", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf", + "secondaryFiles": [ + { + "size": 429036, + "class": "File", + "nameext": ".tbi", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz.tbi", + "checksum": "sha1$e47841e84cd7b1c1ec384fa152d6ef4218b97704", + "location": "bid://9d092d5d-8b05-4a1b-bbc7-1238fb7b8eeb", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz" + } + ] + }, + "value": { + "size": 13247144, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz", + "checksum": "sha1$d377fe9dea989c10fc9bff2a02f215ac75aec897", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf", + "secondaryFiles": [ + { + "size": 429036, + "class": "File", + "nameext": ".tbi", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz.tbi", + "checksum": "sha1$e47841e84cd7b1c1ec384fa152d6ef4218b97704", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz.tbi", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz" + } + ] + }, + "files": [ + "92c9dd48-f4de-4788-b7a3-fe9ff7d17d7b" + ] + } + }, + { + "model": "runner.port", + "pk": "16797b9c-6441-40af-bc6f-a422e6ee1d6b", + "fields": { + "created_date": "2019-12-11T22:53:17.990Z", + "modified_date": "2020-02-04T15:29:59.216Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "facets_txt_hisens", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 11388, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.cncf.txt", + "checksum": "sha1$e7474ae2f7a0479c54d379f089ac0b823ac06c2a", + "location": "bid://b16cea6f-7590-4a4f-9be2-38e045bf60cf", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.cncf" + }, + "value": { + "size": 11388, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.cncf.txt", + "checksum": "sha1$e7474ae2f7a0479c54d379f089ac0b823ac06c2a", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.cncf.txt", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.cncf" + }, + "files": [ + "b16cea6f-7590-4a4f-9be2-38e045bf60cf" + ] + } + }, + { + "model": "runner.port", + "pk": "08b3287d-5e5f-4517-a3de-3d12bee361d0", + "fields": { + "created_date": "2019-12-11T22:53:17.993Z", + "modified_date": "2020-02-04T15:29:59.220Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "facets_txt_purity", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 7525, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.cncf.txt", + "checksum": "sha1$0b46c330b744e3ef85d1f9c5ed585ee348cd6480", + "location": "bid://3a95e8f1-aa34-4f81-b77a-ab59307c1d5f", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.cncf" + }, + "value": { + "size": 7525, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.cncf.txt", + "checksum": "sha1$0b46c330b744e3ef85d1f9c5ed585ee348cd6480", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.cncf.txt", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.cncf" + }, + "files": [ + "3a95e8f1-aa34-4f81-b77a-ab59307c1d5f" + ] + } + }, + { + "model": "runner.port", + "pk": "6526dc8e-00fb-467b-9dcd-c608673b03f9", + "fields": { + "created_date": "2019-12-11T22:53:17.925Z", + "modified_date": "2020-02-04T15:29:59.226Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "per_target_coverage", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 19302184, + "class": "File", + "nameext": ".hstmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.hstmetrics", + "checksum": "sha1$b8a270c8a6c15845afd2f0b87c4f6d4318b0ded2", + "location": "bid://3f92509f-90a9-4de8-ad81-1d021607918b", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 19114455, + "class": "File", + "nameext": ".hstmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.hstmetrics", + "checksum": "sha1$63c8d87423a1c41b71e4347cf19ab6cb63285d94", + "location": "bid://afe65a89-6272-4276-bb34-d401f41a480a", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "value": [ + { + "size": 19302184, + "class": "File", + "nameext": ".hstmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.hstmetrics", + "checksum": "sha1$b8a270c8a6c15845afd2f0b87c4f6d4318b0ded2", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.hstmetrics", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 19114455, + "class": "File", + "nameext": ".hstmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.hstmetrics", + "checksum": "sha1$63c8d87423a1c41b71e4347cf19ab6cb63285d94", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.hstmetrics", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "files": [ + "3f92509f-90a9-4de8-ad81-1d021607918b", + "afe65a89-6272-4276-bb34-d401f41a480a" + ] + } + }, + { + "model": "runner.port", + "pk": "51a1c390-195d-419b-8a6e-84a7879857a1", + "fields": { + "created_date": "2019-12-11T22:53:18.011Z", + "modified_date": "2020-02-04T15:29:59.230Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "merged_file_unfiltered", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 2741838, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.vcf", + "checksum": "sha1$12f83bbc5e86c8dce79eeb145535f0c91e6ac6fb", + "location": "bid://daef2d43-6a6f-4c3c-9e80-076e3e8288cb", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs" + }, + "value": { + "size": 2741838, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.vcf", + "checksum": "sha1$12f83bbc5e86c8dce79eeb145535f0c91e6ac6fb", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.vcf", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs" + }, + "files": [ + "daef2d43-6a6f-4c3c-9e80-076e3e8288cb" + ] + } + }, + { + "model": "file_system.file", + "pk": "914dce04-bc41-427e-9b6c-3084bfa61250", + "fields": { + "created_date": "2019-12-09T23:37:00.416Z", + "modified_date": "2019-12-09T23:37:00.416Z", + "file_name": "dbsnp_138.b37.excluding_sites_after_129.vcf", + "path": "/juno/work/ci/resources/request_files/dbsnp/dbsnp_138.b37.excluding_sites_after_129.vcf", + "file_type": 11, + "size": 2432705678, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "c868b6e9-92bd-4855-9726-7945e4471973", + "fields": { + "created_date": "2019-12-10T15:40:05.224Z", + "modified_date": "2019-12-10T15:40:05.224Z", + "file_name": "Mills_and_1000G_gold_standard.indels.b37.vcf", + "path": "/juno/work/ci/resources/request_files/indels_1000g/Mills_and_1000G_gold_standard.indels.b37.vcf", + "file_type": 11, + "size": 86369975, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "6f644f7f-a7b7-4573-a40a-6c5838f58b75", + "fields": { + "created_date": "2019-12-10T15:41:25.361Z", + "modified_date": "2019-12-10T15:41:25.361Z", + "file_name": "1000G_phase1.snps.high_confidence.b37.vcf", + "path": "/juno/work/ci/resources/request_files/snps_1000g/1000G_phase1.snps.high_confidence.b37.vcf", + "file_type": 11, + "size": 7313069069, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "100204c9-c560-43d9-ab4d-8c03bc207f4e", + "fields": { + "created_date": "2019-12-10T15:41:47.402Z", + "modified_date": "2019-12-10T15:41:47.402Z", + "file_name": "CosmicCodingMuts_v67_b37_20131024__NDS.vcf", + "path": "/juno/work/ci/resources/request_files/cosmic/CosmicCodingMuts_v67_b37_20131024__NDS.vcf", + "file_type": 11, + "size": 112402812, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "5c1dfb8e-d831-43f1-892b-f3c0bf043ca2", + "fields": { + "created_date": "2019-12-10T15:42:27.587Z", + "modified_date": "2019-12-10T15:42:27.587Z", + "file_name": "ExAC_nonTCGA.r0.3.1.sites.vep.vcf.gz", + "path": "/juno/work/ci/resources/vep/cache/ExAC_nonTCGA.r0.3.1.sites.vep.vcf.gz", + "file_type": 11, + "size": 337197976, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "3814d1da-e507-4e7d-b65b-b4ae7e07ec61", + "fields": { + "created_date": "2019-10-24T00:23:15.075Z", + "modified_date": "2019-10-24T00:23:15.075Z", + "file_name": "refGene_b37.sorted.txt", + "path": "/juno/work/ci/resources/request_files/refseq/refGene_b37.sorted.txt", + "file_type": 10, + "size": 9953757, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "584079c8-13af-4816-9ad3-50ce86e13934", + "fields": { + "created_date": "2019-10-24T00:23:17.243Z", + "modified_date": "2019-10-24T00:23:17.243Z", + "file_name": "dbsnp_137.b37__RmDupsClean__plusPseudo50__DROP_SORT.vcf.gz", + "path": "/juno/work/ci/resources/genomes/GRCh37/facets_snps/dbsnp_137.b37__RmDupsClean__plusPseudo50__DROP_SORT.vcf.gz", + "file_type": 11, + "size": 1015019014, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "1edc9e89-8014-406f-92ee-74084eb981cd", + "fields": { + "created_date": "2019-10-24T00:23:22.167Z", + "modified_date": "2019-10-24T00:23:22.167Z", + "file_name": "FP_tiling_genotypes.txt", + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/FP_tiling_genotypes.txt", + "file_type": 10, + "size": 38179, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "b7c7d59f-73a4-4968-bbf5-cd6aed491b91", + "fields": { + "created_date": "2019-10-24T00:23:22.408Z", + "modified_date": "2019-10-24T00:23:22.408Z", + "file_name": "FP_tiling_intervals.intervals", + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/FP_tiling_intervals.intervals", + "file_type": 7, + "size": 50804, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "e0e6283e-24ba-466f-9ec6-b6d9d85b2acd", + "fields": { + "created_date": "2019-10-24T00:23:16.737Z", + "modified_date": "2019-10-24T00:23:16.737Z", + "file_name": "human.hg19.excl.tsv", + "path": "/juno/work/ci/resources/genomes/GRCh37/delly/human.hg19.excl.tsv", + "file_type": 9, + "size": 6984, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "a88b6dca-0601-4383-947f-27dbe8b83213", + "fields": { + "created_date": "2019-10-24T00:23:22.884Z", + "modified_date": "2019-10-24T00:23:22.884Z", + "file_name": "IDT_Exome_v1_FP_b37_baits.ilist", + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/IDT_Exome_v1_FP_b37_baits.ilist", + "file_type": 7, + "size": 7083292, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "92bff766-15fd-4316-8977-77afcef97dae", + "fields": { + "created_date": "2019-12-09T23:31:22.151Z", + "modified_date": "2019-12-09T23:31:22.151Z", + "file_name": "hotspot-list-union-v1-v2.maf", + "path": "/juno/work/ci/resources/roslin-qc/hotspot-list-union-v1-v2.maf", + "file_type": 24, + "size": 624846, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "c29140df-2bdf-4553-ba5d-b0bf07fb347e", + "fields": { + "created_date": "2019-10-24T00:23:23.578Z", + "modified_date": "2019-10-24T00:23:23.578Z", + "file_name": "IDT_Exome_v1_FP_b37_targets.ilist", + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/IDT_Exome_v1_FP_b37_targets.ilist", + "file_type": 7, + "size": 6997415, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "a0fa83e4-8f43-44ba-8dce-719c18bc33b9", + "fields": { + "created_date": "2019-10-24T00:24:03.054Z", + "modified_date": "2019-10-24T00:24:03.054Z", + "file_name": "s_C_006284_N002_d.Group3.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006284_N002_d.Group3.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 18001309333, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "1560276d-5d60-4bbf-bb16-2893fa5ec1b6", + "fields": { + "created_date": "2019-10-24T00:24:03.293Z", + "modified_date": "2019-10-24T00:24:03.293Z", + "file_name": "s_C_006537_N001_d.Group0.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006537_N001_d.Group0.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 13424642344, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "00e929a4-6ef8-46ca-ae7c-47fded158cbb", + "fields": { + "created_date": "2019-10-24T00:24:03.625Z", + "modified_date": "2019-10-24T00:24:03.625Z", + "file_name": "s_C_006550_N002_d.Group1.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006550_N002_d.Group1.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 13851651891, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "16aecbf7-94d8-4057-b6d0-409cf2d30f44", + "fields": { + "created_date": "2019-10-24T00:24:03.884Z", + "modified_date": "2019-10-24T00:24:03.884Z", + "file_name": "s_C_006609_N001_d.Group0.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006609_N001_d.Group0.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 16764556278, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "404e0dfd-b8c3-4c98-b07a-beadb4887939", + "fields": { + "created_date": "2019-10-24T00:24:04.123Z", + "modified_date": "2019-10-24T00:24:04.123Z", + "file_name": "s_C_006610_N001_d.Group1.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006610_N001_d.Group1.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 17797687748, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "e8dd7bdf-abfb-45e2-afd5-452ca86deb9d", + "fields": { + "created_date": "2019-10-24T00:24:04.371Z", + "modified_date": "2019-10-24T00:24:04.371Z", + "file_name": "s_C_006626_N001_d.Group19.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006626_N001_d.Group19.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 15450048427, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "07f85933-01ac-42f4-8c94-f751318e7376", + "fields": { + "created_date": "2019-10-24T00:24:04.617Z", + "modified_date": "2019-10-24T00:24:04.617Z", + "file_name": "s_C_006627_N001_d.Group20.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006627_N001_d.Group20.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 21418934197, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "0d64fb11-bc41-4963-9559-158411f15ce6", + "fields": { + "created_date": "2019-10-24T00:24:04.857Z", + "modified_date": "2019-10-24T00:24:04.857Z", + "file_name": "s_C_006628_N001_d.Group15.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006628_N001_d.Group15.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 20242506560, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "777be3e6-1cd5-4aef-a83d-db7061a11045", + "fields": { + "created_date": "2019-10-24T00:24:05.103Z", + "modified_date": "2019-10-24T00:24:05.103Z", + "file_name": "s_C_006630_N001_d.Group14.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006630_N001_d.Group14.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 18554952981, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "62373f4a-efc1-4ae7-8252-e5d4a91218ba", + "fields": { + "created_date": "2019-10-24T00:24:05.351Z", + "modified_date": "2019-10-24T00:24:05.351Z", + "file_name": "s_C_006631_N001_d.Group17.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006631_N001_d.Group17.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 17671380235, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "12ac7fba-2cbc-4ab5-b4c3-1fa44fc41e3e", + "fields": { + "created_date": "2019-10-24T00:24:05.592Z", + "modified_date": "2019-10-24T00:24:05.592Z", + "file_name": "s_C_006632_N001_d.Group16.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006632_N001_d.Group16.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 17956822592, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "b8f0c91b-9741-48dc-a617-7e4713819dc3", + "fields": { + "created_date": "2019-10-24T00:24:05.836Z", + "modified_date": "2019-10-24T00:24:05.836Z", + "file_name": "s_C_006633_N001_d.Group13.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006633_N001_d.Group13.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 14995930592, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "f05da7bc-d9ca-4a93-929f-4d52a09c19aa", + "fields": { + "created_date": "2019-10-24T00:24:06.083Z", + "modified_date": "2019-10-24T00:24:06.083Z", + "file_name": "s_C_006635_N001_d.Group8.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006635_N001_d.Group8.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 19452196435, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "d85ba214-e41d-4c0b-a7fd-d0c3cff0b052", + "fields": { + "created_date": "2019-10-24T00:24:06.409Z", + "modified_date": "2019-10-24T00:24:06.409Z", + "file_name": "s_C_006636_N001_d.Group9.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006636_N001_d.Group9.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 19189450319, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "45316ece-3691-4b9c-b636-3e02594580cf", + "fields": { + "created_date": "2019-10-24T00:24:06.658Z", + "modified_date": "2019-10-24T00:24:06.658Z", + "file_name": "s_C_006637_N002_d.Group0.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006637_N002_d.Group0.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 10888838079, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "aa352bb2-7209-4f14-9750-12e6c4f296ab", + "fields": { + "created_date": "2019-10-24T00:24:06.901Z", + "modified_date": "2019-10-24T00:24:06.901Z", + "file_name": "s_C_006638_N001_d.Group1.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006638_N001_d.Group1.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 10088003650, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "cc9c56f9-0432-4058-aec9-f61207718feb", + "fields": { + "created_date": "2019-10-24T00:24:07.146Z", + "modified_date": "2019-10-24T00:24:07.146Z", + "file_name": "s_C_006639_N001_d.Group6.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006639_N001_d.Group6.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 18437335538, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "b973583f-e8fd-4156-af89-852747dbce51", + "fields": { + "created_date": "2019-10-24T00:24:07.394Z", + "modified_date": "2019-10-24T00:24:07.394Z", + "file_name": "s_C_006640_N001_d.Group7.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006640_N001_d.Group7.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 18781758639, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "0978e54d-5f7e-4383-abcb-2cb675659c6b", + "fields": { + "created_date": "2019-10-24T00:24:07.716Z", + "modified_date": "2019-10-24T00:24:07.716Z", + "file_name": "s_C_006641_N001_d.Group4.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006641_N001_d.Group4.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 15954753147, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "cd114cae-5147-40a4-907f-82567b31bcc4", + "fields": { + "created_date": "2019-10-24T00:24:07.979Z", + "modified_date": "2019-10-24T00:24:07.979Z", + "file_name": "s_C_006642_N001_d.Group5.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006642_N001_d.Group5.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 17579506808, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "8eaf9fc4-c0fd-4d04-940d-754eac5f429e", + "fields": { + "created_date": "2019-10-24T00:24:08.240Z", + "modified_date": "2019-10-24T00:24:08.240Z", + "file_name": "s_C_006643_N001_d.Group2.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006643_N001_d.Group2.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 17298827865, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "b4583b1b-d570-4f92-a8f1-95a036c239f6", + "fields": { + "created_date": "2019-10-24T00:24:08.520Z", + "modified_date": "2019-10-24T00:24:08.520Z", + "file_name": "s_C_006644_N001_d.Group3.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006644_N001_d.Group3.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 19302206744, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "b1f6d1fd-163d-4616-8d15-67f888216e93", + "fields": { + "created_date": "2019-10-24T00:24:08.779Z", + "modified_date": "2019-10-24T00:24:08.779Z", + "file_name": "s_C_006645_N001_d.Group0.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006645_N001_d.Group0.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 15523622669, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "1998b585-d331-449b-b963-a8e42d64ec4b", + "fields": { + "created_date": "2019-10-24T00:24:09.034Z", + "modified_date": "2019-10-24T00:24:09.034Z", + "file_name": "s_C_006646_N001_d.Group1.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006646_N001_d.Group1.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 17007314582, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "8ad44576-6f3c-443d-84f2-71790469ce60", + "fields": { + "created_date": "2019-10-24T00:24:09.280Z", + "modified_date": "2019-10-24T00:24:09.281Z", + "file_name": "s_C_006647_N001_d.Group18.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006647_N001_d.Group18.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 20776680414, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "b89ed0be-70c6-4452-b98c-a6577ac07421", + "fields": { + "created_date": "2019-10-24T00:24:09.521Z", + "modified_date": "2019-10-24T00:24:09.521Z", + "file_name": "s_C_006648_N001_d.Group11.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006648_N001_d.Group11.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 17232710261, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "fdc12b20-3121-4176-afda-a161de7e5834", + "fields": { + "created_date": "2019-10-24T00:24:09.769Z", + "modified_date": "2019-10-24T00:24:09.769Z", + "file_name": "s_C_006649_N001_d.Group10.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006649_N001_d.Group10.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 17366153538, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dd0a5f64-011c-4461-963e-ba85d529a2dd", + "fields": { + "created_date": "2019-10-24T00:24:10.024Z", + "modified_date": "2019-10-24T00:24:10.024Z", + "file_name": "s_C_006650_N001_d.Group21.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006650_N001_d.Group21.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 16571180154, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "507e913b-66fe-43a8-bbef-da9944556898", + "fields": { + "created_date": "2019-10-24T00:24:10.268Z", + "modified_date": "2019-10-24T00:24:10.268Z", + "file_name": "s_C_006904_N001_d.Group0.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006904_N001_d.Group0.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 18185638557, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "df51e7ab-0582-4e3b-9242-a95f0ba0fde8", + "fields": { + "created_date": "2019-10-24T00:24:10.512Z", + "modified_date": "2019-10-24T00:24:10.512Z", + "file_name": "s_C_006905_N001_d.Group1.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006905_N001_d.Group1.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 18558003865, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "f363912b-96b1-4898-94fb-025bd9e4d859", + "fields": { + "created_date": "2019-10-24T00:24:10.758Z", + "modified_date": "2019-10-24T00:24:10.758Z", + "file_name": "s_C_006906_N001_d.Group1.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006906_N001_d.Group1.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 16951748171, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "8808aeca-3a6d-478d-b4b5-a4818d624271", + "fields": { + "created_date": "2019-10-24T00:24:10.995Z", + "modified_date": "2019-10-24T00:24:10.995Z", + "file_name": "s_C_006907_N001_d.Group0.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006907_N001_d.Group0.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 16389279357, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "754edfb4-83bc-466f-99b3-c8d29f3bacd9", + "fields": { + "created_date": "2019-10-24T00:24:11.235Z", + "modified_date": "2019-10-24T00:24:11.235Z", + "file_name": "s_C_006996_N001_d.Group0.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006996_N001_d.Group0.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 10690676737, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "0eb765d1-797f-482e-ab3f-a5ec90416ec8", + "fields": { + "created_date": "2019-10-24T00:24:11.482Z", + "modified_date": "2019-10-24T00:24:11.482Z", + "file_name": "s_C_0AEE89_N001_d.Group0.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_0AEE89_N001_d.Group0.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 13862649385, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "7afbce7f-0ae7-4120-8711-15de848a2bde", + "fields": { + "created_date": "2019-10-24T00:24:11.720Z", + "modified_date": "2019-10-24T00:24:11.720Z", + "file_name": "s_C_1NPV4P_N001_d.Group0.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_1NPV4P_N001_d.Group0.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 11105358516, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "a3ef2b60-a2e3-40ee-b06a-d2c1580aaad2", + "fields": { + "created_date": "2019-10-24T00:24:11.963Z", + "modified_date": "2019-10-24T00:24:11.963Z", + "file_name": "s_C_4W32NJ_N001_d.Group1.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_4W32NJ_N001_d.Group1.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 17582103301, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "e5f5ce8a-16e3-4310-afed-1e846bb4696b", + "fields": { + "created_date": "2019-10-24T00:24:12.210Z", + "modified_date": "2019-10-24T00:24:12.210Z", + "file_name": "s_C_H9KJFX_N001_d.Group2.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_H9KJFX_N001_d.Group2.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 19349236927, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "91770ec9-d82c-45b2-9ce7-da18b67cb4c0", + "fields": { + "created_date": "2019-10-24T00:24:12.513Z", + "modified_date": "2019-10-24T00:24:12.513Z", + "file_name": "s_C_P5FLLT_N001_d.Group4.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_P5FLLT_N001_d.Group4.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 20668078544, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "c5b27f38-4d0f-4fda-bf2d-c3c72fbbc3cf", + "fields": { + "created_date": "2019-10-24T00:24:12.759Z", + "modified_date": "2019-10-24T00:24:12.759Z", + "file_name": "s_C_VC7LNE_N001_d.Group5.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_VC7LNE_N001_d.Group5.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 18873117772, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "316a84f9-1e44-4294-acd9-44007db6fa9d", + "fields": { + "created_date": "2019-12-06T20:06:03.478Z", + "modified_date": "2019-12-06T20:06:03.478Z", + "file_name": "s_C_WV53F0_N001_d.Group0.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_WV53F0_N001_d.Group0.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 19501528278, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "96e3a791-2bc7-45f8-acc6-e519a29d5d0b", + "fields": { + "created_date": "2019-12-06T20:05:01.506Z", + "modified_date": "2019-12-06T20:05:01.506Z", + "file_name": "b37.fasta", + "path": "/juno/work/ci/resources/genomes/GRCh37/fasta/b37.fasta", + "file_type": 2, + "size": 3189750467, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "b6b418fe-6c83-43a2-8bdc-f3af2b0954a7", + "fields": { + "created_date": "2019-10-24T00:23:19.218Z", + "modified_date": "2019-10-24T00:23:19.218Z", + "file_name": "GRCm38.fasta", + "path": "/juno/work/ci/resources/genomes/GRCm38/GRCm38.fasta", + "file_type": 2, + "size": 2769885087, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "87b6a57c-f15b-49eb-9d22-d3893d2e00ef", + "fields": { + "created_date": "2019-12-09T23:34:12.885Z", + "modified_date": "2019-12-09T23:34:12.886Z", + "file_name": "hapmap_3.3.b37.vcf", + "path": "/juno/work/ci/resources/request_files/hapmap/hapmap_3.3.b37.vcf", + "file_type": 11, + "size": 225898391, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "242cebfb-2b22-4e69-9cbf-478c4f026c3d", + "fields": { + "created_date": "2019-11-29T21:15:53.295Z", + "modified_date": "2020-02-03T22:05:10.092Z", + "file_name": "S16-68609_IGO_09670_D_1_S11_R1_001.fastq.gz", + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0390_BH7HCTBBXY/Project_09670_D/Sample_S16-68609_IGO_09670_D_1/S16-68609_IGO_09670_D_1_S11_R1_001.fastq.gz", + "file_type": 1, + "size": 5966546453, + "file_group": "1a1b29cf-3bc2-4f6c-b376-d4c5d701166a" + } + }, + { + "model": "file_system.file", + "pk": "02cfb077-f61c-4659-9877-752c456e8f80", + "fields": { + "created_date": "2019-11-29T21:15:53.254Z", + "modified_date": "2020-02-03T22:05:10.069Z", + "file_name": "S16-68609_IGO_09670_D_1_S11_R2_001.fastq.gz", + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0390_BH7HCTBBXY/Project_09670_D/Sample_S16-68609_IGO_09670_D_1/S16-68609_IGO_09670_D_1_S11_R2_001.fastq.gz", + "file_type": 1, + "size": 5832468368, + "file_group": "1a1b29cf-3bc2-4f6c-b376-d4c5d701166a" + } + }, + { + "model": "file_system.file", + "pk": "d320fc3a-07e6-46c6-88f4-ad6480cf446e", + "fields": { + "created_date": "2019-11-29T21:15:51.010Z", + "modified_date": "2020-02-03T22:05:10.138Z", + "file_name": "P-0017035-N01-WES_IGO_09670_D_46_S12_R1_001.fastq.gz", + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0391_AH7FKJBBXY/Project_09670_D/Sample_P-0017035-N01-WES_IGO_09670_D_46/P-0017035-N01-WES_IGO_09670_D_46_S12_R1_001.fastq.gz", + "file_type": 1, + "size": 3576965127, + "file_group": "1a1b29cf-3bc2-4f6c-b376-d4c5d701166a" + } + }, + { + "model": "file_system.file", + "pk": "47be3848-e16b-4126-9e64-1d3f5a67b927", + "fields": { + "created_date": "2019-11-29T21:15:50.983Z", + "modified_date": "2020-02-03T22:05:10.112Z", + "file_name": "P-0017035-N01-WES_IGO_09670_D_46_S12_R2_001.fastq.gz", + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0391_AH7FKJBBXY/Project_09670_D/Sample_P-0017035-N01-WES_IGO_09670_D_46/P-0017035-N01-WES_IGO_09670_D_46_S12_R2_001.fastq.gz", + "file_type": 1, + "size": 3592299152, + "file_group": "1a1b29cf-3bc2-4f6c-b376-d4c5d701166a" + } + }, + { + "model": "file_system.filemetadata", + "pk": "6ad10ee7-c875-46cb-9a69-57acd461cf41", + "fields": { + "created_date": "2019-12-09T23:37:00.429Z", + "modified_date": "2019-12-09T23:37:00.429Z", + "file": "914dce04-bc41-427e-9b6c-3084bfa61250", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "ae8c6fe5-f9e3-4650-9f09-8906342e4783", + "fields": { + "created_date": "2019-12-10T15:40:05.251Z", + "modified_date": "2019-12-10T15:40:05.251Z", + "file": "c868b6e9-92bd-4855-9726-7945e4471973", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "abfd67dc-9139-4165-aa46-de34de1903d6", + "fields": { + "created_date": "2019-12-10T15:41:25.375Z", + "modified_date": "2019-12-10T15:41:25.375Z", + "file": "6f644f7f-a7b7-4573-a40a-6c5838f58b75", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "de7089b7-8a69-4948-b601-5b965e4e9dae", + "fields": { + "created_date": "2019-12-10T15:41:47.412Z", + "modified_date": "2019-12-10T15:41:47.412Z", + "file": "100204c9-c560-43d9-ab4d-8c03bc207f4e", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "300442b0-9009-4d2c-9dc1-c226a7c09ee8", + "fields": { + "created_date": "2019-12-10T15:42:27.601Z", + "modified_date": "2019-12-10T15:42:27.601Z", + "file": "5c1dfb8e-d831-43f1-892b-f3c0bf043ca2", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "10454e5e-9a20-4beb-af95-fcf2d856ecaf", + "fields": { + "created_date": "2019-10-24T00:23:15.094Z", + "modified_date": "2019-10-24T00:23:15.094Z", + "file": "3814d1da-e507-4e7d-b65b-b4ae7e07ec61", + "version": 0, + "metadata": { + "genome": "GRCh37", + "data_type": "refseq" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "d386a959-9036-4eaf-8793-4ee7aaff0c07", + "fields": { + "created_date": "2019-10-24T00:23:17.253Z", + "modified_date": "2019-10-24T00:23:17.253Z", + "file": "584079c8-13af-4816-9ad3-50ce86e13934", + "version": 0, + "metadata": { + "genome": "GRCh37", + "data_type": "facets_snps" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "0d21e695-1518-430b-833a-4287bd8b4823", + "fields": { + "created_date": "2019-10-24T00:23:22.177Z", + "modified_date": "2019-10-24T00:23:22.177Z", + "file": "1edc9e89-8014-406f-92ee-74084eb981cd", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "FP_genotypes" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "85784758-ab15-4e0d-9ec7-285b63fb29e1", + "fields": { + "created_date": "2019-10-24T00:23:22.418Z", + "modified_date": "2019-10-24T00:23:22.418Z", + "file": "b7c7d59f-73a4-4968-bbf5-cd6aed491b91", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "FP_intervals" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "c572a28f-c8a7-4fae-b6a5-b1de88f49eda", + "fields": { + "created_date": "2019-10-24T00:23:16.747Z", + "modified_date": "2019-10-24T00:23:16.747Z", + "file": "e0e6283e-24ba-466f-9ec6-b6d9d85b2acd", + "version": 0, + "metadata": { + "genome": "GRCh37", + "data_type": "delly" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "f275945d-81d3-4790-9dca-90f665a97041", + "fields": { + "created_date": "2019-10-24T00:23:22.894Z", + "modified_date": "2019-10-24T00:23:22.894Z", + "file": "a88b6dca-0601-4383-947f-27dbe8b83213", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "baits_list" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "d82d6bf2-1014-47b5-9475-95ad04a3c729", + "fields": { + "created_date": "2019-12-09T23:31:22.187Z", + "modified_date": "2019-12-09T23:31:22.187Z", + "file": "92bff766-15fd-4316-8977-77afcef97dae", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "ec0f3369-0dec-4a35-9cff-f7e1e95834e7", + "fields": { + "created_date": "2019-10-24T00:23:23.589Z", + "modified_date": "2019-10-24T00:23:23.589Z", + "file": "c29140df-2bdf-4553-ba5d-b0bf07fb347e", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "targets_list" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "c96af6d8-1320-49a2-93b5-d90c87f581d9", + "fields": { + "created_date": "2019-10-24T00:24:03.064Z", + "modified_date": "2019-10-24T00:24:03.064Z", + "file": "a0fa83e4-8f43-44ba-8dce-719c18bc33b9", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "9a040d42-11df-4105-88ac-5bc20a8e82f2", + "fields": { + "created_date": "2019-10-24T00:24:03.303Z", + "modified_date": "2019-10-24T00:24:03.303Z", + "file": "1560276d-5d60-4bbf-bb16-2893fa5ec1b6", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "8b76946d-15c6-49b4-ba6b-9f970666a5ef", + "fields": { + "created_date": "2019-10-24T00:24:03.636Z", + "modified_date": "2019-10-24T00:24:03.636Z", + "file": "00e929a4-6ef8-46ca-ae7c-47fded158cbb", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "96e9bc30-a8d0-4627-b9f1-8c0dd6611db6", + "fields": { + "created_date": "2019-10-24T00:24:03.895Z", + "modified_date": "2019-10-24T00:24:03.895Z", + "file": "16aecbf7-94d8-4057-b6d0-409cf2d30f44", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "eda44586-5ca2-4c1d-904e-327211bb64ee", + "fields": { + "created_date": "2019-10-24T00:24:04.133Z", + "modified_date": "2019-10-24T00:24:04.133Z", + "file": "404e0dfd-b8c3-4c98-b07a-beadb4887939", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "64b8c142-f933-4ad5-8cf9-2960b02bdf7b", + "fields": { + "created_date": "2019-10-24T00:24:04.381Z", + "modified_date": "2019-10-24T00:24:04.381Z", + "file": "e8dd7bdf-abfb-45e2-afd5-452ca86deb9d", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "1a62e03c-7225-4786-a67f-fff159ec4711", + "fields": { + "created_date": "2019-10-24T00:24:04.627Z", + "modified_date": "2019-10-24T00:24:04.627Z", + "file": "07f85933-01ac-42f4-8c94-f751318e7376", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "b539ca59-25f3-45cc-991f-fc87b7378cd5", + "fields": { + "created_date": "2019-10-24T00:24:04.868Z", + "modified_date": "2019-10-24T00:24:04.868Z", + "file": "0d64fb11-bc41-4963-9559-158411f15ce6", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "e8add0c9-e115-4bab-980d-ffa0cfcb667a", + "fields": { + "created_date": "2019-10-24T00:24:05.113Z", + "modified_date": "2019-10-24T00:24:05.113Z", + "file": "777be3e6-1cd5-4aef-a83d-db7061a11045", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "66ebd65b-87d2-42ea-8e15-594182394412", + "fields": { + "created_date": "2019-10-24T00:24:05.361Z", + "modified_date": "2019-10-24T00:24:05.361Z", + "file": "62373f4a-efc1-4ae7-8252-e5d4a91218ba", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "059139ea-63c6-4673-9d0d-c51cf76a0001", + "fields": { + "created_date": "2019-10-24T00:24:05.600Z", + "modified_date": "2019-10-24T00:24:05.601Z", + "file": "12ac7fba-2cbc-4ab5-b4c3-1fa44fc41e3e", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "adc259a3-e3d0-4b3f-b7b2-4abd57794152", + "fields": { + "created_date": "2019-10-24T00:24:05.847Z", + "modified_date": "2019-10-24T00:24:05.847Z", + "file": "b8f0c91b-9741-48dc-a617-7e4713819dc3", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "69339850-3a8a-403d-ba03-45d256304fbc", + "fields": { + "created_date": "2019-10-24T00:24:06.093Z", + "modified_date": "2019-10-24T00:24:06.093Z", + "file": "f05da7bc-d9ca-4a93-929f-4d52a09c19aa", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "a795bdc0-2cf1-4a37-88de-e8d93df9f90c", + "fields": { + "created_date": "2019-10-24T00:24:06.419Z", + "modified_date": "2019-10-24T00:24:06.419Z", + "file": "d85ba214-e41d-4c0b-a7fd-d0c3cff0b052", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "8ea26aab-b30f-416c-8949-4d65726b42ad", + "fields": { + "created_date": "2019-10-24T00:24:06.667Z", + "modified_date": "2019-10-24T00:24:06.667Z", + "file": "45316ece-3691-4b9c-b636-3e02594580cf", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "fa32607e-faef-4e10-be2c-5252e1aa10f1", + "fields": { + "created_date": "2019-10-24T00:24:06.911Z", + "modified_date": "2019-10-24T00:24:06.911Z", + "file": "aa352bb2-7209-4f14-9750-12e6c4f296ab", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "67e166d4-fcf2-42a4-b42a-09611ea19bf5", + "fields": { + "created_date": "2019-10-24T00:24:07.160Z", + "modified_date": "2019-10-24T00:24:07.160Z", + "file": "cc9c56f9-0432-4058-aec9-f61207718feb", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "8e8dbab1-ca4e-42f5-9209-fbcb812cc367", + "fields": { + "created_date": "2019-10-24T00:24:07.404Z", + "modified_date": "2019-10-24T00:24:07.404Z", + "file": "b973583f-e8fd-4156-af89-852747dbce51", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "e779ddb7-b090-40f7-8647-52a82819df74", + "fields": { + "created_date": "2019-10-24T00:24:07.725Z", + "modified_date": "2019-10-24T00:24:07.725Z", + "file": "0978e54d-5f7e-4383-abcb-2cb675659c6b", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "393564d7-931d-4baf-9b7c-9d013b0ccb5d", + "fields": { + "created_date": "2019-10-24T00:24:07.989Z", + "modified_date": "2019-10-24T00:24:07.989Z", + "file": "cd114cae-5147-40a4-907f-82567b31bcc4", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "f068eaa1-edb0-4486-b715-cc6b37e34325", + "fields": { + "created_date": "2019-10-24T00:24:08.249Z", + "modified_date": "2019-10-24T00:24:08.249Z", + "file": "8eaf9fc4-c0fd-4d04-940d-754eac5f429e", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "73e82d33-aa7a-45dd-bd0f-29be4be714a1", + "fields": { + "created_date": "2019-10-24T00:24:08.532Z", + "modified_date": "2019-10-24T00:24:08.532Z", + "file": "b4583b1b-d570-4f92-a8f1-95a036c239f6", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "ce087f33-c593-47ab-b450-f088bc7ee005", + "fields": { + "created_date": "2019-10-24T00:24:08.789Z", + "modified_date": "2019-10-24T00:24:08.789Z", + "file": "b1f6d1fd-163d-4616-8d15-67f888216e93", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "b1fe6c80-ae66-4ade-ad0f-51525b9d629d", + "fields": { + "created_date": "2019-10-24T00:24:09.045Z", + "modified_date": "2019-10-24T00:24:09.046Z", + "file": "1998b585-d331-449b-b963-a8e42d64ec4b", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "a530f4ad-fc3e-4128-b39c-d660bf8885f5", + "fields": { + "created_date": "2019-10-24T00:24:09.290Z", + "modified_date": "2019-10-24T00:24:09.290Z", + "file": "8ad44576-6f3c-443d-84f2-71790469ce60", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "af440113-a72d-4862-b47b-8d141389ac45", + "fields": { + "created_date": "2019-10-24T00:24:09.530Z", + "modified_date": "2019-10-24T00:24:09.530Z", + "file": "b89ed0be-70c6-4452-b98c-a6577ac07421", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "6e6de7f4-74ec-4f08-9798-abdee1c6617c", + "fields": { + "created_date": "2019-10-24T00:24:09.779Z", + "modified_date": "2019-10-24T00:24:09.779Z", + "file": "fdc12b20-3121-4176-afda-a161de7e5834", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "4d364c04-9c5b-4780-ab28-b7127d7df444", + "fields": { + "created_date": "2019-10-24T00:24:10.035Z", + "modified_date": "2019-10-24T00:24:10.035Z", + "file": "dd0a5f64-011c-4461-963e-ba85d529a2dd", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "48d0a5b9-c412-4b74-ab37-5732c5289eea", + "fields": { + "created_date": "2019-10-24T00:24:10.278Z", + "modified_date": "2019-10-24T00:24:10.278Z", + "file": "507e913b-66fe-43a8-bbef-da9944556898", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "412085e9-e5c5-4236-9811-c0bb2862c4b8", + "fields": { + "created_date": "2019-10-24T00:24:10.522Z", + "modified_date": "2019-10-24T00:24:10.522Z", + "file": "df51e7ab-0582-4e3b-9242-a95f0ba0fde8", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "2a17b794-572e-45be-9048-0b3fb2c47dd7", + "fields": { + "created_date": "2019-10-24T00:24:10.768Z", + "modified_date": "2019-10-24T00:24:10.768Z", + "file": "f363912b-96b1-4898-94fb-025bd9e4d859", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "a313383f-9605-436c-b8c0-4480262723fe", + "fields": { + "created_date": "2019-10-24T00:24:11.005Z", + "modified_date": "2019-10-24T00:24:11.005Z", + "file": "8808aeca-3a6d-478d-b4b5-a4818d624271", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "ab8f54ad-a962-4ebe-a03e-5aa50bc6c047", + "fields": { + "created_date": "2019-10-24T00:24:11.244Z", + "modified_date": "2019-10-24T00:24:11.244Z", + "file": "754edfb4-83bc-466f-99b3-c8d29f3bacd9", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "d0669bc4-3afc-4b0e-9900-dc7774a32d70", + "fields": { + "created_date": "2019-10-24T00:24:11.492Z", + "modified_date": "2019-10-24T00:24:11.492Z", + "file": "0eb765d1-797f-482e-ab3f-a5ec90416ec8", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "edbe8dbe-e622-4095-bcd2-05792ea6b498", + "fields": { + "created_date": "2019-10-24T00:24:11.730Z", + "modified_date": "2019-10-24T00:24:11.731Z", + "file": "7afbce7f-0ae7-4120-8711-15de848a2bde", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "3e47586d-0a03-4d05-b174-6196ebbd28d4", + "fields": { + "created_date": "2019-10-24T00:24:11.974Z", + "modified_date": "2019-10-24T00:24:11.974Z", + "file": "a3ef2b60-a2e3-40ee-b06a-d2c1580aaad2", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "c4c158b1-3535-4847-8ada-2178a6558956", + "fields": { + "created_date": "2019-10-24T00:24:12.219Z", + "modified_date": "2019-10-24T00:24:12.219Z", + "file": "e5f5ce8a-16e3-4310-afed-1e846bb4696b", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "3feb253c-be4b-4357-b7f2-958ae64cced0", + "fields": { + "created_date": "2019-10-24T00:24:12.525Z", + "modified_date": "2019-10-24T00:24:12.525Z", + "file": "91770ec9-d82c-45b2-9ce7-da18b67cb4c0", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "215f0a3b-ca9e-4786-9426-ca3f6eb79d5a", + "fields": { + "created_date": "2019-10-24T00:24:12.769Z", + "modified_date": "2019-10-24T00:24:12.769Z", + "file": "c5b27f38-4d0f-4fda-bf2d-c3c72fbbc3cf", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "79a4b7e4-bf97-4672-9e22-44e859feda9e", + "fields": { + "created_date": "2019-12-06T20:06:03.487Z", + "modified_date": "2019-12-06T20:06:03.487Z", + "file": "316a84f9-1e44-4294-acd9-44007db6fa9d", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "61a79866-b376-47e4-9d2e-f48ba2db7eba", + "fields": { + "created_date": "2019-12-06T20:05:01.781Z", + "modified_date": "2019-12-06T20:05:01.781Z", + "file": "96e3a791-2bc7-45f8-acc6-e519a29d5d0b", + "version": 0, + "metadata": { + "genome": "GRCh37", + "data_type": "fasta" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "2257c5e7-356a-422e-b409-ecddac244f00", + "fields": { + "created_date": "2019-10-24T00:23:19.228Z", + "modified_date": "2019-10-24T00:23:19.228Z", + "file": "b6b418fe-6c83-43a2-8bdc-f3af2b0954a7", + "version": 0, + "metadata": { + "genome": "GRCh38", + "data_type": "fasta" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "25dc1fa1-b0d5-4924-9ccb-bb18ec59f4ac", + "fields": { + "created_date": "2019-12-09T23:34:12.902Z", + "modified_date": "2019-12-09T23:34:12.902Z", + "file": "87b6a57c-f15b-49eb-9d22-d3893d2e00ef", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "6ef7063a-3abc-4fe9-bee9-db2d39f6f084", + "fields": { + "created_date": "2020-02-03T22:05:10.089Z", + "modified_date": "2020-02-03T22:05:10.089Z", + "file": "242cebfb-2b22-4e69-9cbf-478c4f026c3d", + "version": 2, + "metadata": { + "R": "R1", + "sex": "M", + "runId": "PITT_0390", + "recipe": "WholeExomeSequencing", + "baitSet": "IDT_Exome_v1_FP_BAITS", + "piEmail": "", + "runDate": "2019-08-15", + "runMode": "HiSeq High Output", + "species": "Human", + "sampleId": "09670_D_1", + "barcodeId": "IDT366", + "libraryId": null, + "patientId": "C-K2902H", + "requestId": "09670_D", + "flowCellId": "H7HCTBBXY", + "readLength": "101/8/101", + "sampleName": "C-K2902H-P001-d", + "captureName": null, + "igocomplete": true, + "labHeadName": "John Smith", + "sampleClass": "Primary", + "barcodeIndex": "ACATACGG", + "labHeadEmail": "user@internet.com", + "oncoTreeCode": "DDLS", + "preservation": "Frozen", + "sampleOrigin": "Tissue", + "specimenType": "Biopsy", + "flowCellLanes": [ + 1, + 2, + 3, + 4, + 5, + 6 + ], + "libraryVolume": null, + "pooledNormals": null, + "tumorOrNormal": "Tumor", + "captureInputNg": null, + "collectionYear": "", + "tissueLocation": "", + "dataAnalystName": "", + "dataAnalystEmail": "", + "externalSampleId": "S16-68609", + "investigatorName": "Bob Sagat", + "investigatorEmail": "user2@internet.com", + "projectManagerName": "Franklin, Rosalind", + "investigatorSampleId": "S16-68609", + "captureConcentrationNm": null, + "libraryConcentrationNgul": 40.03237153464453 + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "08beab48-57bc-41b1-9776-e0cb84949401", + "fields": { + "created_date": "2020-02-03T22:05:10.065Z", + "modified_date": "2020-02-03T22:05:10.065Z", + "file": "02cfb077-f61c-4659-9877-752c456e8f80", + "version": 2, + "metadata": { + "R": "R2", + "sex": "M", + "runId": "PITT_0390", + "recipe": "WholeExomeSequencing", + "baitSet": "IDT_Exome_v1_FP_BAITS", + "piEmail": "", + "runDate": "2019-08-15", + "runMode": "HiSeq High Output", + "species": "Human", + "sampleId": "09670_D_1", + "barcodeId": "IDT366", + "libraryId": "09670_D_1_1_1_1_1", + "patientId": "C-K2902H", + "requestId": "09670_D", + "flowCellId": "H7HCTBBXY", + "readLength": "101/8/101", + "sampleName": "C-K2902H-P001-d", + "captureName": null, + "igocomplete": true, + "labHeadName": "John Smith", + "sampleClass": "Primary", + "barcodeIndex": "ACATACGG", + "labHeadEmail": "user@internet.com", + "oncoTreeCode": "DDLS", + "preservation": "Frozen", + "sampleOrigin": "Tissue", + "specimenType": "Biopsy", + "flowCellLanes": [ + 1, + 2, + 3, + 4, + 5, + 6 + ], + "libraryVolume": null, + "pooledNormals": null, + "tumorOrNormal": "Tumor", + "captureInputNg": null, + "collectionYear": "", + "tissueLocation": "", + "dataAnalystName": "", + "dataAnalystEmail": "", + "externalSampleId": "S16-68609", + "investigatorName": "Bob Sagat", + "investigatorEmail": "user2@internet.com", + "projectManagerName": "Franklin, Rosalind", + "investigatorSampleId": "S16-68609", + "captureConcentrationNm": null, + "libraryConcentrationNgul": 40.03237153464453 + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "705149b0-69c1-4672-b4e8-ed71a8eb5ebe", + "fields": { + "created_date": "2020-02-03T22:05:10.135Z", + "modified_date": "2020-02-03T22:05:10.136Z", + "file": "d320fc3a-07e6-46c6-88f4-ad6480cf446e", + "version": 2, + "metadata": { + "R": "R1", + "sex": "M", + "runId": "PITT_0391", + "recipe": "WholeExomeSequencing", + "baitSet": "IDT_Exome_v1_FP_BAITS", + "piEmail": "", + "runDate": "2019-08-19", + "runMode": "HiSeq High Output", + "species": "Human", + "sampleId": "09670_D_46", + "barcodeId": null, + "libraryId": null, + "patientId": "C-K2902H", + "requestId": "09670_D", + "flowCellId": "H7FKJBBXY", + "readLength": "101/8/101", + "sampleName": "C-K2902H-N001-d", + "captureName": null, + "igocomplete": true, + "labHeadName": "John Smith", + "sampleClass": "Normal", + "barcodeIndex": null, + "labHeadEmail": "user@internet.com", + "oncoTreeCode": null, + "preservation": "EDTA-Streck", + "sampleOrigin": "Whole Blood", + "specimenType": "Blood", + "flowCellLanes": [ + 5, + 6, + 7, + 8 + ], + "libraryVolume": null, + "pooledNormals": null, + "tumorOrNormal": "Normal", + "captureInputNg": null, + "collectionYear": "", + "tissueLocation": "", + "dataAnalystName": "", + "dataAnalystEmail": "", + "externalSampleId": "P-0017035-N01-WES", + "investigatorName": "Bob Sagat", + "investigatorEmail": "user2@internet.com", + "projectManagerName": "Franklin, Rosalind", + "investigatorSampleId": "P-0017035-N01-WES", + "captureConcentrationNm": null, + "libraryConcentrationNgul": 32.135796910139796 + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "2d8b63f4-90ba-4fc0-8fc5-37be735b566a", + "fields": { + "created_date": "2020-02-03T22:05:10.109Z", + "modified_date": "2020-02-03T22:05:10.109Z", + "file": "47be3848-e16b-4126-9e64-1d3f5a67b927", + "version": 2, + "metadata": { + "R": "R2", + "sex": "M", + "runId": "PITT_0391", + "recipe": "WholeExomeSequencing", + "baitSet": "IDT_Exome_v1_FP_BAITS", + "piEmail": "", + "runDate": "2019-08-19", + "runMode": "HiSeq High Output", + "species": "Human", + "sampleId": "09670_D_46", + "barcodeId": null, + "libraryId": "09670_D_46_1", + "patientId": "C-K2902H", + "requestId": "09670_D", + "flowCellId": "H7FKJBBXY", + "readLength": "101/8/101", + "sampleName": "C-K2902H-N001-d", + "captureName": null, + "igocomplete": true, + "labHeadName": "John Smith", + "sampleClass": "Normal", + "barcodeIndex": null, + "labHeadEmail": "user@internet.com", + "oncoTreeCode": null, + "preservation": "EDTA-Streck", + "sampleOrigin": "Whole Blood", + "specimenType": "Blood", + "flowCellLanes": [ + 5, + 6, + 7, + 8 + ], + "libraryVolume": null, + "pooledNormals": null, + "tumorOrNormal": "Normal", + "captureInputNg": null, + "collectionYear": "", + "tissueLocation": "", + "dataAnalystName": "", + "dataAnalystEmail": "", + "externalSampleId": "P-0017035-N01-WES", + "investigatorName": "Bob Sagat", + "investigatorEmail": "user2@internet.com", + "projectManagerName": "Franklin, Rosalind", + "investigatorSampleId": "P-0017035-N01-WES", + "captureConcentrationNm": null, + "libraryConcentrationNgul": 32.135796910139796 + }, + "user": null + } + }, + { + "model": "file_system.file", + "pk": "b835c33c-d241-42fc-beb2-e1ce1c41a77d", + "fields": { + "created_date": "2019-12-14T12:08:14.368Z", + "modified_date": "2019-12-14T12:08:14.368Z", + "file_name": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.annotate-variants.vcf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.annotate-variants.vcf", + "file_type": 11, + "size": 65612975, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "f9f55509-fcae-45f7-bdd2-72aebb59178e", + "fields": { + "created_date": "2019-12-14T12:08:13.539Z", + "modified_date": "2019-12-14T12:08:13.539Z", + "file_name": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.muts.maf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.muts.maf", + "file_type": 24, + "size": 181310718, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "e528ce76-0c6f-4088-8e22-38ece693bcdd", + "fields": { + "created_date": "2019-12-14T12:08:13.575Z", + "modified_date": "2019-12-14T12:08:13.575Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.bam", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 22899967017, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "f6d0fd8d-cae6-469d-ab57-f22ab55178c9", + "fields": { + "created_date": "2019-12-14T12:08:13.614Z", + "modified_date": "2019-12-14T12:08:13.614Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads.bam", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 14961505727, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "0f1e06cb-c77b-4988-994f-797eab18cbea", + "fields": { + "created_date": "2019-12-14T12:08:13.658Z", + "modified_date": "2019-12-14T12:08:13.658Z", + "file_name": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk000_cl.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk000_cl.stats", + "file_type": 21, + "size": 2641, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "48dd6384-7034-4cc7-9027-7df71496eb27", + "fields": { + "created_date": "2019-12-14T12:08:13.676Z", + "modified_date": "2019-12-14T12:08:13.676Z", + "file_name": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk001_cl.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk001_cl.stats", + "file_type": 21, + "size": 2611, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "2c2b195f-514c-4107-af3a-8488cf6547ea", + "fields": { + "created_date": "2019-12-14T12:08:13.695Z", + "modified_date": "2019-12-14T12:08:13.695Z", + "file_name": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk002_cl.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk002_cl.stats", + "file_type": 21, + "size": 2576, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "2af79d18-4ba7-4aef-8505-bd775d47b00d", + "fields": { + "created_date": "2019-12-14T12:08:13.713Z", + "modified_date": "2019-12-14T12:08:13.713Z", + "file_name": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk000_cl.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk000_cl.stats", + "file_type": 21, + "size": 2764, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "2a1736ce-50fd-4721-92da-474f67318c8d", + "fields": { + "created_date": "2019-12-14T12:08:13.731Z", + "modified_date": "2019-12-14T12:08:13.731Z", + "file_name": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk001_cl.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk001_cl.stats", + "file_type": 21, + "size": 2714, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "e6d2247d-c056-467b-8ddb-6cf6e0387f26", + "fields": { + "created_date": "2019-12-14T12:08:13.754Z", + "modified_date": "2019-12-14T12:08:13.754Z", + "file_name": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk000_cl.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk000_cl.stats", + "file_type": 21, + "size": 2818, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "aecc788a-ebd8-4e3d-bb25-6bc6a373f5fa", + "fields": { + "created_date": "2019-12-14T12:08:13.778Z", + "modified_date": "2019-12-14T12:08:13.778Z", + "file_name": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk001_cl.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk001_cl.stats", + "file_type": 21, + "size": 2815, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "e0ad9888-930b-4c87-9797-a5a88894cb2a", + "fields": { + "created_date": "2019-12-14T12:08:13.803Z", + "modified_date": "2019-12-14T12:08:13.803Z", + "file_name": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk002_cl.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk002_cl.stats", + "file_type": 21, + "size": 2775, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "75f8f49a-ffe7-4cf4-8956-0adacfe9f6f6", + "fields": { + "created_date": "2019-12-14T12:08:13.820Z", + "modified_date": "2019-12-14T12:08:13.820Z", + "file_name": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk000_cl.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk000_cl.stats", + "file_type": 21, + "size": 2873, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "2a41fde8-172a-439c-8a9e-9681069c87fa", + "fields": { + "created_date": "2019-12-14T12:08:13.836Z", + "modified_date": "2019-12-14T12:08:13.836Z", + "file_name": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk001_cl.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk001_cl.stats", + "file_type": 21, + "size": 2826, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "463c0311-e32f-40ae-a1a2-d831431997b7", + "fields": { + "created_date": "2019-12-14T12:08:13.858Z", + "modified_date": "2019-12-14T12:08:13.858Z", + "file_name": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.maf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.maf", + "file_type": 24, + "size": 59073, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "0fdc6110-b18f-4ef0-9c50-9905bf4a22a9", + "fields": { + "created_date": "2019-12-14T12:08:13.880Z", + "modified_date": "2019-12-14T12:08:13.880Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "file_type": 21, + "size": 8189, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "9290ce2b-2dbd-4253-a4dd-9edf7fe79114", + "fields": { + "created_date": "2019-12-14T12:08:13.896Z", + "modified_date": "2019-12-14T12:08:13.896Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "file_type": 21, + "size": 8219, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "b9cd207a-f8d5-4c41-8506-f8bb6b0f61af", + "fields": { + "created_date": "2019-12-14T12:08:13.930Z", + "modified_date": "2019-12-14T12:08:13.930Z", + "file_name": "s_C_K2902H_P001_d.rg.md.asmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.asmetrics", + "file_type": 21, + "size": 2171, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "22a814db-f3ad-4fb2-ae81-c56b41f01f13", + "fields": { + "created_date": "2019-12-14T12:08:13.947Z", + "modified_date": "2019-12-14T12:08:13.947Z", + "file_name": "s_C_K2902H_N001_d.rg.md.asmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.asmetrics", + "file_type": 21, + "size": 2134, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "48a16d33-0fd4-41df-9bca-fe87c15c119e", + "fields": { + "created_date": "2019-12-14T12:08:13.969Z", + "modified_date": "2019-12-14T12:08:13.969Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.out", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.out", + "file_type": 21, + "size": 603, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "734731f7-a505-4aaa-957e-ce706342f555", + "fields": { + "created_date": "2019-12-14T12:08:13.986Z", + "modified_date": "2019-12-14T12:08:13.986Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.out", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.out", + "file_type": 21, + "size": 602, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "a813b899-7525-480b-9a8d-fe844abf06cf", + "fields": { + "created_date": "2019-12-14T12:08:14.009Z", + "modified_date": "2019-12-14T12:08:14.009Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.CNCF.png", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.CNCF.png", + "file_type": 21, + "size": 124853, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "9cbfedb0-dac4-4151-ac25-2553fc46fad6", + "fields": { + "created_date": "2019-12-14T12:08:14.027Z", + "modified_date": "2019-12-14T12:08:14.027Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.CNCF.png", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.CNCF.png", + "file_type": 21, + "size": 111084, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "1e25988d-2f5d-45bf-ab60-a3e8bf3b0811", + "fields": { + "created_date": "2019-12-14T12:08:14.050Z", + "modified_date": "2019-12-14T12:08:14.050Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.seg", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.seg", + "file_type": 21, + "size": 4777, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "97923d95-86f5-4f95-ab20-3cb7882b79cc", + "fields": { + "created_date": "2019-12-14T12:08:14.068Z", + "modified_date": "2019-12-14T12:08:14.068Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.seg", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.seg", + "file_type": 21, + "size": 3222, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "ad08e7ac-2877-41da-a16a-f468f3130158", + "fields": { + "created_date": "2019-12-14T12:08:14.092Z", + "modified_date": "2019-12-14T12:08:14.092Z", + "file_name": "s_C_K2902H_P001_d.rg.md.gcbias.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.gcbias.pdf", + "file_type": 21, + "size": 6784, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "7694cc12-25c1-4585-93ce-fa5c540b5f17", + "fields": { + "created_date": "2019-12-14T12:08:14.108Z", + "modified_date": "2019-12-14T12:08:14.108Z", + "file_name": "s_C_K2902H_N001_d.rg.md.gcbias.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.gcbias.pdf", + "file_type": 21, + "size": 6794, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "4d8d1cf0-fc62-4ed6-a0bd-0dfbef86b277", + "fields": { + "created_date": "2019-12-14T12:08:14.131Z", + "modified_date": "2019-12-14T12:08:14.131Z", + "file_name": "s_C_K2902H_P001_d.rg.md.hsmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.hsmetrics", + "file_type": 21, + "size": 5016, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "e4475a18-ce54-40c1-82cf-dd9323157658", + "fields": { + "created_date": "2019-12-14T12:08:14.147Z", + "modified_date": "2019-12-14T12:08:14.147Z", + "file_name": "s_C_K2902H_N001_d.rg.md.hsmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.hsmetrics", + "file_type": 21, + "size": 5029, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "ff35af28-dbe9-47e6-b55b-2d7d01c4cc63", + "fields": { + "created_date": "2019-12-14T12:08:14.168Z", + "modified_date": "2019-12-14T12:08:14.168Z", + "file_name": "s_C_K2902H_P001_d.rg.md.ismetrics.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.ismetrics.pdf", + "file_type": 21, + "size": 13994, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "8954096e-64c4-4393-9721-95c5b880b18b", + "fields": { + "created_date": "2019-12-14T12:08:14.183Z", + "modified_date": "2019-12-14T12:08:14.183Z", + "file_name": "s_C_K2902H_N001_d.rg.md.ismetrics.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.ismetrics.pdf", + "file_type": 21, + "size": 12712, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "bdc504e0-bf83-4093-b14f-a6ce0ef94acc", + "fields": { + "created_date": "2019-12-14T12:08:14.203Z", + "modified_date": "2019-12-14T12:08:14.203Z", + "file_name": "s_C_K2902H_P001_d.rg.md_metrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md_metrics", + "file_type": 21, + "size": 2900, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "11a1da3d-5dad-493f-83a5-c5d5fe14d39e", + "fields": { + "created_date": "2019-12-14T12:08:14.219Z", + "modified_date": "2019-12-14T12:08:14.219Z", + "file_name": "s_C_K2902H_N001_d.rg.md_metrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md_metrics", + "file_type": 21, + "size": 2866, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dd8d50f9-389f-49e4-ae3a-17510322684c", + "fields": { + "created_date": "2019-12-14T12:08:14.242Z", + "modified_date": "2019-12-14T12:08:14.242Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.vcf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.vcf", + "file_type": 11, + "size": 24213327, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "5d58f2d4-46dc-49f3-8e39-5c1e43a3d55b", + "fields": { + "created_date": "2019-12-14T12:08:14.263Z", + "modified_date": "2019-12-14T12:08:14.263Z", + "file_name": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz", + "file_type": 21, + "size": 13440159, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "d72930a5-6916-4d32-b9de-55c9e27a92df", + "fields": { + "created_date": "2019-12-14T12:08:14.302Z", + "modified_date": "2019-12-14T12:08:14.302Z", + "file_name": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vcf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vcf", + "file_type": 11, + "size": 19739, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "2e0d7c0a-be9c-4969-a65e-0139e95ebdc1", + "fields": { + "created_date": "2019-12-14T12:08:14.324Z", + "modified_date": "2019-12-14T12:08:14.324Z", + "file_name": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.portal.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.portal.txt", + "file_type": 10, + "size": 5795, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "2167517e-4230-4660-a3e2-f1f53d492e60", + "fields": { + "created_date": "2019-12-14T12:08:14.346Z", + "modified_date": "2019-12-14T12:08:14.346Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.vcf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.vcf", + "file_type": 11, + "size": 403491742, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "587840dc-bcb6-48e6-9000-ae912c415d7c", + "fields": { + "created_date": "2019-12-14T12:08:14.390Z", + "modified_date": "2019-12-14T12:08:14.390Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.Rdata", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.Rdata", + "file_type": 21, + "size": 8622126, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "c1b4ba39-e14b-4535-88f1-53de2f5809c9", + "fields": { + "created_date": "2019-12-14T12:08:14.406Z", + "modified_date": "2019-12-14T12:08:14.406Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.Rdata", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.Rdata", + "file_type": 21, + "size": 8618530, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "df4b1eb1-640f-486c-846f-6df01c5896ac", + "fields": { + "created_date": "2019-12-14T12:08:14.428Z", + "modified_date": "2019-12-14T12:08:14.428Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "file_type": 21, + "size": 5494, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "5ed9c450-1af5-422c-8c74-f60219ad3d26", + "fields": { + "created_date": "2019-12-14T12:08:14.445Z", + "modified_date": "2019-12-14T12:08:14.445Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "file_type": 21, + "size": 5508, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "262c3d19-2d59-403d-bd2b-66e0fe404413", + "fields": { + "created_date": "2019-12-14T12:08:14.466Z", + "modified_date": "2019-12-14T12:08:14.466Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads.dat.gz", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads.dat.gz", + "file_type": 21, + "size": 32693698, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dfc3e0f6-be3c-4a1c-a2b7-fc8fb8791b1d", + "fields": { + "created_date": "2019-12-14T12:08:14.488Z", + "modified_date": "2019-12-14T12:08:14.488Z", + "file_name": "s_C_K2902H_P001_d.rg.md_FP_base_counts.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md_FP_base_counts.txt", + "file_type": 10, + "size": 13779990, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "4c1e5a08-70c1-4dcf-9d4b-b4d0d67ba3a7", + "fields": { + "created_date": "2019-12-14T12:08:14.504Z", + "modified_date": "2019-12-14T12:08:14.504Z", + "file_name": "s_C_K2902H_N001_d.rg.md_FP_base_counts.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md_FP_base_counts.txt", + "file_type": 10, + "size": 13586169, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "23fdfe62-3e90-4db4-b533-acadf2f4e1b2", + "fields": { + "created_date": "2019-12-14T12:08:14.527Z", + "modified_date": "2019-12-14T12:08:14.527Z", + "file_name": "s_C_K2902H_P001_d.rg.md.gcbiasmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.gcbiasmetrics", + "file_type": 21, + "size": 6648, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "b950c7ff-84c1-4476-99e1-6f0b16626f76", + "fields": { + "created_date": "2019-12-14T12:08:14.544Z", + "modified_date": "2019-12-14T12:08:14.544Z", + "file_name": "s_C_K2902H_N001_d.rg.md.gcbiasmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.gcbiasmetrics", + "file_type": 21, + "size": 6632, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "3cab6e36-70f5-46df-aa00-a4473cb8ed50", + "fields": { + "created_date": "2019-12-14T12:08:14.574Z", + "modified_date": "2019-12-14T12:08:14.575Z", + "file_name": "s_C_K2902H_P001_d.rg.md.gcbias.summary", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.gcbias.summary", + "file_type": 21, + "size": 1201, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "44f519d5-a59c-4baa-bf08-2792460c78bc", + "fields": { + "created_date": "2019-12-14T12:08:14.593Z", + "modified_date": "2019-12-14T12:08:14.593Z", + "file_name": "s_C_K2902H_N001_d.rg.md.gcbias.summary", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.gcbias.summary", + "file_type": 21, + "size": 1199, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "c211d274-6cf8-4f37-a201-1441b3f3c716", + "fields": { + "created_date": "2019-12-14T12:08:14.616Z", + "modified_date": "2019-12-14T12:08:14.616Z", + "file_name": "s_C_K2902H_P001_d.rg.md.ismetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.ismetrics", + "file_type": 21, + "size": 7754, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "8265b3ed-0c3c-496c-ab97-ea312cf878db", + "fields": { + "created_date": "2019-12-14T12:08:14.635Z", + "modified_date": "2019-12-14T12:08:14.635Z", + "file_name": "s_C_K2902H_N001_d.rg.md.ismetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.ismetrics", + "file_type": 21, + "size": 7041, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "8b2f58fc-ff9a-4d00-a3e2-c62228b99993", + "fields": { + "created_date": "2019-12-14T12:08:14.658Z", + "modified_date": "2019-12-14T12:08:14.658Z", + "file_name": "s_C_K2902H_P001_d.rg.md.pileup", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.pileup", + "file_type": 21, + "size": 55203868, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "995ae979-5156-4107-a9e6-20ce77f59ecb", + "fields": { + "created_date": "2019-12-14T12:08:14.675Z", + "modified_date": "2019-12-14T12:08:14.675Z", + "file_name": "s_C_K2902H_N001_d.rg.md.pileup", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.pileup", + "file_type": 21, + "size": 33915095, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "7ba48896-0c1a-443e-8258-0a35914dfd3e", + "fields": { + "created_date": "2019-12-14T12:08:14.697Z", + "modified_date": "2019-12-14T12:08:14.697Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz", + "file_type": 21, + "size": 129554, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "86a62cf2-398d-4876-b195-e2780ba594bd", + "fields": { + "created_date": "2019-12-14T12:08:14.738Z", + "modified_date": "2019-12-14T12:08:14.738Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.txt", + "file_type": 10, + "size": 172715192, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "92c9dd48-f4de-4788-b7a3-fe9ff7d17d7b", + "fields": { + "created_date": "2019-12-14T12:08:14.762Z", + "modified_date": "2019-12-14T12:08:14.762Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz", + "file_type": 21, + "size": 13247144, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "b16cea6f-7590-4a4f-9be2-38e045bf60cf", + "fields": { + "created_date": "2019-12-14T12:08:14.800Z", + "modified_date": "2019-12-14T12:08:14.800Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.cncf.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.cncf.txt", + "file_type": 10, + "size": 11388, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "3a95e8f1-aa34-4f81-b77a-ab59307c1d5f", + "fields": { + "created_date": "2019-12-14T12:08:14.822Z", + "modified_date": "2019-12-14T12:08:14.822Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.cncf.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.cncf.txt", + "file_type": 10, + "size": 7525, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "3f92509f-90a9-4de8-ad81-1d021607918b", + "fields": { + "created_date": "2019-12-14T12:08:14.844Z", + "modified_date": "2019-12-14T12:08:14.844Z", + "file_name": "s_C_K2902H_P001_d.rg.md.hstmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.hstmetrics", + "file_type": 21, + "size": 19302184, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "afe65a89-6272-4276-bb34-d401f41a480a", + "fields": { + "created_date": "2019-12-14T12:08:14.860Z", + "modified_date": "2019-12-14T12:08:14.860Z", + "file_name": "s_C_K2902H_N001_d.rg.md.hstmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.hstmetrics", + "file_type": 21, + "size": 19114455, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daef2d43-6a6f-4c3c-9e80-076e3e8288cb", + "fields": { + "created_date": "2019-12-14T12:08:14.883Z", + "modified_date": "2019-12-14T12:08:14.883Z", + "file_name": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.vcf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.vcf", + "file_type": 11, + "size": 2741838, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.filemetadata", + "pk": "72a12af0-87e5-4499-b637-354ecfffd143", + "fields": { + "created_date": "2019-12-14T12:08:14.373Z", + "modified_date": "2019-12-14T12:08:14.373Z", + "file": "b835c33c-d241-42fc-beb2-e1ce1c41a77d", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "84581b79-b529-48d8-859d-cdb1c6fa0d64", + "fields": { + "created_date": "2019-12-14T12:08:13.552Z", + "modified_date": "2019-12-14T12:08:13.552Z", + "file": "f9f55509-fcae-45f7-bdd2-72aebb59178e", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "704672d7-5287-41c3-ac85-5216531cbcf7", + "fields": { + "created_date": "2019-12-14T12:08:13.580Z", + "modified_date": "2019-12-14T12:08:13.580Z", + "file": "e528ce76-0c6f-4088-8e22-38ece693bcdd", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "ead69a0e-81b5-4284-bf78-35d08d99ea2e", + "fields": { + "created_date": "2019-12-14T12:08:13.619Z", + "modified_date": "2019-12-14T12:08:13.619Z", + "file": "f6d0fd8d-cae6-469d-ab57-f22ab55178c9", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "01ea8211-218f-4625-a438-faa044bd1a6e", + "fields": { + "created_date": "2019-12-14T12:08:13.663Z", + "modified_date": "2019-12-14T12:08:13.663Z", + "file": "0f1e06cb-c77b-4988-994f-797eab18cbea", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "65c49729-041b-4f19-9131-82898ed0b61a", + "fields": { + "created_date": "2019-12-14T12:08:13.681Z", + "modified_date": "2019-12-14T12:08:13.681Z", + "file": "48dd6384-7034-4cc7-9027-7df71496eb27", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "0850f29d-b7bb-4b24-b7bd-a375bdc765b6", + "fields": { + "created_date": "2019-12-14T12:08:13.700Z", + "modified_date": "2019-12-14T12:08:13.700Z", + "file": "2c2b195f-514c-4107-af3a-8488cf6547ea", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "2b6174b0-2318-4de2-b485-59ff36594027", + "fields": { + "created_date": "2019-12-14T12:08:13.718Z", + "modified_date": "2019-12-14T12:08:13.718Z", + "file": "2af79d18-4ba7-4aef-8505-bd775d47b00d", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "2421fc51-3aeb-4cee-9eb0-67c7807eee41", + "fields": { + "created_date": "2019-12-14T12:08:13.736Z", + "modified_date": "2019-12-14T12:08:13.736Z", + "file": "2a1736ce-50fd-4721-92da-474f67318c8d", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "6d47e4f7-5bfe-4678-806c-4562a1389897", + "fields": { + "created_date": "2019-12-14T12:08:13.759Z", + "modified_date": "2019-12-14T12:08:13.759Z", + "file": "e6d2247d-c056-467b-8ddb-6cf6e0387f26", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "71931b44-b644-4402-b3f2-526b25474a4a", + "fields": { + "created_date": "2019-12-14T12:08:13.785Z", + "modified_date": "2019-12-14T12:08:13.785Z", + "file": "aecc788a-ebd8-4e3d-bb25-6bc6a373f5fa", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "86a688e6-2db8-4647-be8d-e529f5038ca8", + "fields": { + "created_date": "2019-12-14T12:08:13.807Z", + "modified_date": "2019-12-14T12:08:13.807Z", + "file": "e0ad9888-930b-4c87-9797-a5a88894cb2a", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "4d2b5fa3-1bee-4650-89f9-40e9a28ac957", + "fields": { + "created_date": "2019-12-14T12:08:13.824Z", + "modified_date": "2019-12-14T12:08:13.824Z", + "file": "75f8f49a-ffe7-4cf4-8956-0adacfe9f6f6", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "31bb5596-e277-4821-abc8-2f7495fa6dc0", + "fields": { + "created_date": "2019-12-14T12:08:13.841Z", + "modified_date": "2019-12-14T12:08:13.841Z", + "file": "2a41fde8-172a-439c-8a9e-9681069c87fa", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "5628c6c1-c5db-418d-9401-4a126e9447cb", + "fields": { + "created_date": "2019-12-14T12:08:13.863Z", + "modified_date": "2019-12-14T12:08:13.863Z", + "file": "463c0311-e32f-40ae-a1a2-d831431997b7", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "3d21ff17-1aa1-44de-a0c4-867499102c9d", + "fields": { + "created_date": "2019-12-14T12:08:13.884Z", + "modified_date": "2019-12-14T12:08:13.884Z", + "file": "0fdc6110-b18f-4ef0-9c50-9905bf4a22a9", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "fb4fed4a-1c35-483d-8d6b-7c22ceb74b5b", + "fields": { + "created_date": "2019-12-14T12:08:13.900Z", + "modified_date": "2019-12-14T12:08:13.900Z", + "file": "9290ce2b-2dbd-4253-a4dd-9edf7fe79114", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "f36e741f-128e-4aa6-8bcc-c784e9f15dc1", + "fields": { + "created_date": "2019-12-14T12:08:13.935Z", + "modified_date": "2019-12-14T12:08:13.935Z", + "file": "b9cd207a-f8d5-4c41-8506-f8bb6b0f61af", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "722de789-595e-4a9b-b810-62c64696fac7", + "fields": { + "created_date": "2019-12-14T12:08:13.952Z", + "modified_date": "2019-12-14T12:08:13.952Z", + "file": "22a814db-f3ad-4fb2-ae81-c56b41f01f13", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "0dfbeac9-adab-4202-bc5e-a1bd8985b0cb", + "fields": { + "created_date": "2019-12-14T12:08:13.973Z", + "modified_date": "2019-12-14T12:08:13.973Z", + "file": "48a16d33-0fd4-41df-9bca-fe87c15c119e", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "66929d7f-0abc-435c-8c92-a84b35328067", + "fields": { + "created_date": "2019-12-14T12:08:13.991Z", + "modified_date": "2019-12-14T12:08:13.991Z", + "file": "734731f7-a505-4aaa-957e-ce706342f555", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "e151c4e1-c9c7-4e8b-83d9-b172e5688fe2", + "fields": { + "created_date": "2019-12-14T12:08:14.014Z", + "modified_date": "2019-12-14T12:08:14.014Z", + "file": "a813b899-7525-480b-9a8d-fe844abf06cf", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "ba1bc7c9-be10-4035-8e50-db39c390859d", + "fields": { + "created_date": "2019-12-14T12:08:14.031Z", + "modified_date": "2019-12-14T12:08:14.032Z", + "file": "9cbfedb0-dac4-4151-ac25-2553fc46fad6", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "9b8ac7d6-8edb-4a4c-8c13-6f906b355fbb", + "fields": { + "created_date": "2019-12-14T12:08:14.055Z", + "modified_date": "2019-12-14T12:08:14.055Z", + "file": "1e25988d-2f5d-45bf-ab60-a3e8bf3b0811", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "d19c12b4-2fa8-4a51-9769-8d07b266c073", + "fields": { + "created_date": "2019-12-14T12:08:14.074Z", + "modified_date": "2019-12-14T12:08:14.074Z", + "file": "97923d95-86f5-4f95-ab20-3cb7882b79cc", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "2413c312-0d3c-4736-9dab-54d7a1f8944b", + "fields": { + "created_date": "2019-12-14T12:08:14.097Z", + "modified_date": "2019-12-14T12:08:14.097Z", + "file": "ad08e7ac-2877-41da-a16a-f468f3130158", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "0b44502d-24ae-4c76-b2df-d1c82dc7204e", + "fields": { + "created_date": "2019-12-14T12:08:14.113Z", + "modified_date": "2019-12-14T12:08:14.113Z", + "file": "7694cc12-25c1-4585-93ce-fa5c540b5f17", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "9626b151-e5ce-4a8d-9a2d-5525ffefffea", + "fields": { + "created_date": "2019-12-14T12:08:14.135Z", + "modified_date": "2019-12-14T12:08:14.135Z", + "file": "4d8d1cf0-fc62-4ed6-a0bd-0dfbef86b277", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "73b90583-7ba5-479a-bf60-ae38fcb5101c", + "fields": { + "created_date": "2019-12-14T12:08:14.152Z", + "modified_date": "2019-12-14T12:08:14.152Z", + "file": "e4475a18-ce54-40c1-82cf-dd9323157658", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "022eb502-f9e7-470f-ba57-5a1fd64b4da6", + "fields": { + "created_date": "2019-12-14T12:08:14.172Z", + "modified_date": "2019-12-14T12:08:14.172Z", + "file": "ff35af28-dbe9-47e6-b55b-2d7d01c4cc63", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "960aa982-1fb2-4631-b6b9-9a785a038307", + "fields": { + "created_date": "2019-12-14T12:08:14.187Z", + "modified_date": "2019-12-14T12:08:14.187Z", + "file": "8954096e-64c4-4393-9721-95c5b880b18b", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "3e5cedc4-25ab-48f0-b00a-b1c11145a962", + "fields": { + "created_date": "2019-12-14T12:08:14.208Z", + "modified_date": "2019-12-14T12:08:14.208Z", + "file": "bdc504e0-bf83-4093-b14f-a6ce0ef94acc", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "af754099-8e4e-4b38-950e-b77c6d81e105", + "fields": { + "created_date": "2019-12-14T12:08:14.223Z", + "modified_date": "2019-12-14T12:08:14.223Z", + "file": "11a1da3d-5dad-493f-83a5-c5d5fe14d39e", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "6234948a-050c-4a5f-bb84-089ffa56e2ea", + "fields": { + "created_date": "2019-12-14T12:08:14.246Z", + "modified_date": "2019-12-14T12:08:14.246Z", + "file": "dd8d50f9-389f-49e4-ae3a-17510322684c", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "acfe275c-f258-4a51-afd2-85c71d54eefd", + "fields": { + "created_date": "2019-12-14T12:08:14.268Z", + "modified_date": "2019-12-14T12:08:14.268Z", + "file": "5d58f2d4-46dc-49f3-8e39-5c1e43a3d55b", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "f2821b20-55b8-4874-aa4e-4e7138a8b63b", + "fields": { + "created_date": "2019-12-14T12:08:14.307Z", + "modified_date": "2019-12-14T12:08:14.307Z", + "file": "d72930a5-6916-4d32-b9de-55c9e27a92df", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "7493cb24-e54e-48ce-89a2-f3a9beab499d", + "fields": { + "created_date": "2019-12-14T12:08:14.329Z", + "modified_date": "2019-12-14T12:08:14.329Z", + "file": "2e0d7c0a-be9c-4969-a65e-0139e95ebdc1", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "00abf8aa-8c97-41e0-b294-8299d1315763", + "fields": { + "created_date": "2019-12-14T12:08:14.351Z", + "modified_date": "2019-12-14T12:08:14.351Z", + "file": "2167517e-4230-4660-a3e2-f1f53d492e60", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "5c6a0c54-ae10-41ad-8d48-2191f23f6ee9", + "fields": { + "created_date": "2019-12-14T12:08:14.394Z", + "modified_date": "2019-12-14T12:08:14.394Z", + "file": "587840dc-bcb6-48e6-9000-ae912c415d7c", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "75c071df-9735-4f5e-9d11-338364c3f3f5", + "fields": { + "created_date": "2019-12-14T12:08:14.411Z", + "modified_date": "2019-12-14T12:08:14.411Z", + "file": "c1b4ba39-e14b-4535-88f1-53de2f5809c9", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "6ff6f734-4ac5-4c0b-ae9c-1c66915a4de6", + "fields": { + "created_date": "2019-12-14T12:08:14.432Z", + "modified_date": "2019-12-14T12:08:14.432Z", + "file": "df4b1eb1-640f-486c-846f-6df01c5896ac", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "9c20e7a4-03be-4764-89bc-e6365f4a2f9a", + "fields": { + "created_date": "2019-12-14T12:08:14.449Z", + "modified_date": "2019-12-14T12:08:14.449Z", + "file": "5ed9c450-1af5-422c-8c74-f60219ad3d26", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "8c5372f6-7d52-4d58-8ed0-1b3ef7e72a01", + "fields": { + "created_date": "2019-12-14T12:08:14.470Z", + "modified_date": "2019-12-14T12:08:14.470Z", + "file": "262c3d19-2d59-403d-bd2b-66e0fe404413", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "8a4038d5-9ecb-40ed-a964-1163f83abb17", + "fields": { + "created_date": "2019-12-14T12:08:14.492Z", + "modified_date": "2019-12-14T12:08:14.492Z", + "file": "dfc3e0f6-be3c-4a1c-a2b7-fc8fb8791b1d", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "c1314a25-14fe-4420-b272-af86064e0d17", + "fields": { + "created_date": "2019-12-14T12:08:14.509Z", + "modified_date": "2019-12-14T12:08:14.509Z", + "file": "4c1e5a08-70c1-4dcf-9d4b-b4d0d67ba3a7", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "9ba79561-0602-408b-b963-cb46c53658ea", + "fields": { + "created_date": "2019-12-14T12:08:14.532Z", + "modified_date": "2019-12-14T12:08:14.532Z", + "file": "23fdfe62-3e90-4db4-b533-acadf2f4e1b2", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "cb3bf695-96b9-4fce-a562-48fdad6939f6", + "fields": { + "created_date": "2019-12-14T12:08:14.548Z", + "modified_date": "2019-12-14T12:08:14.548Z", + "file": "b950c7ff-84c1-4476-99e1-6f0b16626f76", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "95bbe477-eac9-4f0c-8207-d2dc6bfe536f", + "fields": { + "created_date": "2019-12-14T12:08:14.580Z", + "modified_date": "2019-12-14T12:08:14.580Z", + "file": "3cab6e36-70f5-46df-aa00-a4473cb8ed50", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "41764b23-c374-4d24-884f-5341047ba4e3", + "fields": { + "created_date": "2019-12-14T12:08:14.598Z", + "modified_date": "2019-12-14T12:08:14.598Z", + "file": "44f519d5-a59c-4baa-bf08-2792460c78bc", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "fb5431c0-e7ae-4ef0-b71c-fa81838977c4", + "fields": { + "created_date": "2019-12-14T12:08:14.621Z", + "modified_date": "2019-12-14T12:08:14.621Z", + "file": "c211d274-6cf8-4f37-a201-1441b3f3c716", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "13deb153-5dad-4e83-9e61-91262e14e416", + "fields": { + "created_date": "2019-12-14T12:08:14.640Z", + "modified_date": "2019-12-14T12:08:14.640Z", + "file": "8265b3ed-0c3c-496c-ab97-ea312cf878db", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "e93ee833-0002-4e3e-8cf1-69e81a18c65b", + "fields": { + "created_date": "2019-12-14T12:08:14.663Z", + "modified_date": "2019-12-14T12:08:14.663Z", + "file": "8b2f58fc-ff9a-4d00-a3e2-c62228b99993", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "a2950c05-2e28-42b2-9594-bf05be09dd09", + "fields": { + "created_date": "2019-12-14T12:08:14.679Z", + "modified_date": "2019-12-14T12:08:14.679Z", + "file": "995ae979-5156-4107-a9e6-20ce77f59ecb", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "732c5c6a-0e3e-42bf-9ae0-dd014c03ff60", + "fields": { + "created_date": "2019-12-14T12:08:14.702Z", + "modified_date": "2019-12-14T12:08:14.702Z", + "file": "7ba48896-0c1a-443e-8258-0a35914dfd3e", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "b3af6100-e256-49e3-9e0b-76e4db510f10", + "fields": { + "created_date": "2019-12-14T12:08:14.743Z", + "modified_date": "2019-12-14T12:08:14.743Z", + "file": "86a62cf2-398d-4876-b195-e2780ba594bd", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "7d8dd044-53eb-4735-982d-d07804986d46", + "fields": { + "created_date": "2019-12-14T12:08:14.766Z", + "modified_date": "2019-12-14T12:08:14.766Z", + "file": "92c9dd48-f4de-4788-b7a3-fe9ff7d17d7b", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "9957d731-e1ad-431e-a1a9-1fd825dca32a", + "fields": { + "created_date": "2019-12-14T12:08:14.805Z", + "modified_date": "2019-12-14T12:08:14.805Z", + "file": "b16cea6f-7590-4a4f-9be2-38e045bf60cf", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "5e3401fc-64b8-4047-838d-19cb6589cd63", + "fields": { + "created_date": "2019-12-14T12:08:14.827Z", + "modified_date": "2019-12-14T12:08:14.827Z", + "file": "3a95e8f1-aa34-4f81-b77a-ab59307c1d5f", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "70889fa4-5c6a-4ee4-9dd4-b7b9a16f6d68", + "fields": { + "created_date": "2019-12-14T12:08:14.848Z", + "modified_date": "2019-12-14T12:08:14.848Z", + "file": "3f92509f-90a9-4de8-ad81-1d021607918b", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "d81be683-8fb2-42c1-94a7-e4e777bce313", + "fields": { + "created_date": "2019-12-14T12:08:14.865Z", + "modified_date": "2019-12-14T12:08:14.865Z", + "file": "afe65a89-6272-4276-bb34-d401f41a480a", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "f63728b5-80b8-4783-80a1-2b5c60d51955", + "fields": { + "created_date": "2019-12-14T12:08:14.887Z", + "modified_date": "2019-12-14T12:08:14.887Z", + "file": "daef2d43-6a6f-4c3c-9e80-076e3e8288cb", + "version": 0, + "metadata": {}, + "user": null + } + } +] diff --git a/fixtures/tests/daa13d24-50ea-11ea-b9c7-ac1f6b453620.run.full.json b/fixtures/tests/daa13d24-50ea-11ea-b9c7-ac1f6b453620.run.full.json new file mode 100644 index 000000000..9fc6836a6 --- /dev/null +++ b/fixtures/tests/daa13d24-50ea-11ea-b9c7-ac1f6b453620.run.full.json @@ -0,0 +1,6854 @@ +[ + { + "model": "runner.run", + "pk": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:02.012Z", + "modified_date": "2020-01-14T23:03:35.530Z", + "name": "ROSLIN 09670_D, 22 of 54 (12/11/2019, 22:53:02)", + "app": "cb5d793b-e650-4b7d-bfcd-882858e29cc5", + "status": 4, + "execution_id": "df43cc77-bed4-4233-9817-6d12e25d9e1c", + "job_statuses": {}, + "output_metadata": { + "assay": "IDT_Exome_v1_FP_b37" + }, + "tags": { + "requestId": "09670_D_1581878020" + } + } + }, + { + "model": "runner.port", + "pk": "dabf34dc-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.822Z", + "modified_date": "2020-02-04T15:29:30.720Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "dbsnp", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".idx" + ], + "db_value": { + "class": "File", + "location": "bid://dabdfd38-50ea-11ea-b9c7-ac1f6b453620" + }, + "value": { + "path": "/juno/work/ci/resources/request_files/dbsnp/dbsnp_138.b37.excluding_sites_after_129.1581878020.vcf", + "size": 2432705678, + "class": "File" + }, + "files": [ + "dabdfd38-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dab4dad2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.827Z", + "modified_date": "2020-02-04T15:29:30.724Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "indels_1000g", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".idx" + ], + "db_value": { + "class": "File", + "location": "bid://dab3905a-50ea-11ea-b9c7-ac1f6b453620" + }, + "value": { + "path": "/juno/work/ci/resources/request_files/indels_1000g/Mills_and_1000G_gold_standard.indels.b37.1581878020.vcf", + "size": 86369975, + "class": "File" + }, + "files": [ + "dab3905a-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dab54634-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.831Z", + "modified_date": "2020-02-04T15:29:30.750Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "snps_1000g", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".idx" + ], + "db_value": { + "class": "File", + "location": "bid://daa1a6d8-50ea-11ea-b9c7-ac1f6b453620" + }, + "value": { + "path": "/juno/work/ci/resources/request_files/snps_1000g/1000G_phase1.snps.high_confidence.b37.1581878020.vcf", + "size": 7313069069, + "class": "File" + }, + "files": [ + "daa1a6d8-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "daceaa7a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.836Z", + "modified_date": "2020-02-04T15:29:30.924Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "cosmic", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".idx" + ], + "db_value": { + "class": "File", + "location": "bid://daad9ff6-50ea-11ea-b9c7-ac1f6b453620" + }, + "value": { + "path": "/juno/work/ci/resources/request_files/cosmic/CosmicCodingMuts_v67_b37_20131024__NDS.1581878020.vcf", + "size": 112402812, + "class": "File" + }, + "files": [ + "daad9ff6-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dab8acb6-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.843Z", + "modified_date": "2020-02-04T15:29:31.049Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "exac_filter", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".tbi" + ], + "db_value": { + "class": "File", + "location": "bid://dab5fed0-50ea-11ea-b9c7-ac1f6b453620" + }, + "value": { + "path": "/juno/work/ci/resources/vep/cache/ExAC_nonTCGA.r0.3.1.sites.vep.vcf.1581878020.gz", + "size": 337197976, + "class": "File" + }, + "files": [ + "dab5fed0-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "daaee9ce-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.802Z", + "modified_date": "2020-02-04T15:29:52.626Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "db_files", + "port_type": 0, + "schema": { + "type": "record", + "fields": { + "refseq": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "vep_data": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "vep_path": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "custom_enst": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "facets_snps": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "hotspot_vcf": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "fp_genotypes": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "fp_intervals": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "hotspot_list": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "delly_exclude": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "bait_intervals": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "conpair_markers": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "hotspot_list_maf": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "target_intervals": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "conpair_markers_bed": { + "type": [ + "null", + "array" + ], + "items": "string" + } + } + }, + "secondary_files": [], + "db_value": { + "refseq": { + "class": "File", + "location": "bid://dac9d9c8-50ea-11ea-b9c7-ac1f6b453620" + }, + "vep_data": "/var/cache", + "vep_path": "/usr/bin/vep", + "custom_enst": "/usr/bin/vcf2maf/data/isoform_overrides_at_mskcc", + "facets_snps": { + "class": "File", + "location": "bid://dab111c2-50ea-11ea-b9c7-ac1f6b453620" + }, + "hotspot_vcf": "/usr/bin/basicfiltering/data/hotspot-list-union-v1-v2.vcf", + "fp_genotypes": { + "class": "File", + "location": "bid://dac595d4-50ea-11ea-b9c7-ac1f6b453620" + }, + "fp_intervals": { + "class": "File", + "location": "bid://daa96544-50ea-11ea-b9c7-ac1f6b453620" + }, + "hotspot_list": "/usr/bin/ngs-filters/data/hotspot-list-union-v1-v2.txt", + "delly_exclude": { + "class": "File", + "location": "bid://daa7b032-50ea-11ea-b9c7-ac1f6b453620" + }, + "bait_intervals": { + "class": "File", + "location": "bid://daced162-50ea-11ea-b9c7-ac1f6b453620" + }, + "conpair_markers": "/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.txt", + "hotspot_list_maf": { + "class": "File", + "location": "bid://dab3b580-50ea-11ea-b9c7-ac1f6b453620" + }, + "target_intervals": { + "class": "File", + "location": "bid://daa0f882-50ea-11ea-b9c7-ac1f6b453620" + }, + "conpair_markers_bed": "/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.bed" + }, + "value": { + "refseq": { + "path": "/juno/work/ci/resources/request_files/refseq/refGene_b37.sorted.1581878020.txt", + "size": 9953757, + "class": "File" + }, + "vep_data": "/var/cache", + "vep_path": "/usr/bin/vep", + "custom_enst": "/usr/bin/vcf2maf/data/isoform_overrides_at_mskcc", + "facets_snps": { + "path": "/juno/work/ci/resources/genomes/GRCh37/facets_snps/dbsnp_137.b37__RmDupsClean__plusPseudo50__DROP_SORT.vcf.1581878020.gz", + "size": 1015019014, + "class": "File" + }, + "hotspot_vcf": "/usr/bin/basicfiltering/data/hotspot-list-union-v1-v2.vcf", + "fp_genotypes": { + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/FP_tiling_genotypes.1581878020.txt", + "size": 38179, + "class": "File" + }, + "fp_intervals": { + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/FP_tiling_intervals.1581878020.intervals", + "size": 50804, + "class": "File" + }, + "hotspot_list": "/usr/bin/ngs-filters/data/hotspot-list-union-v1-v2.txt", + "delly_exclude": { + "path": "/juno/work/ci/resources/genomes/GRCh37/delly/human.hg19.excl.1581878020.tsv", + "size": 6984, + "class": "File" + }, + "bait_intervals": { + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/IDT_Exome_v1_FP_b37_baits.1581878020.ilist", + "size": 7083292, + "class": "File" + }, + "conpair_markers": "/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.txt", + "hotspot_list_maf": { + "path": "/juno/work/ci/resources/roslin-qc/hotspot-list-union-v1-v2.1581878020.maf", + "size": 624846, + "class": "File" + }, + "target_intervals": { + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/IDT_Exome_v1_FP_b37_targets.1581878020.ilist", + "size": 6997415, + "class": "File" + }, + "conpair_markers_bed": "/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.bed" + }, + "files": [ + "dac595d4-50ea-11ea-b9c7-ac1f6b453620", + "dac9d9c8-50ea-11ea-b9c7-ac1f6b453620", + "dab111c2-50ea-11ea-b9c7-ac1f6b453620", + "dab3b580-50ea-11ea-b9c7-ac1f6b453620", + "daced162-50ea-11ea-b9c7-ac1f6b453620", + "daa96544-50ea-11ea-b9c7-ac1f6b453620", + "daa0f882-50ea-11ea-b9c7-ac1f6b453620", + "daa7b032-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dac67260-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.852Z", + "modified_date": "2020-02-04T15:29:52.795Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "curated_bams", + "port_type": 0, + "schema": { + "type": "array", + "items": [ + "null", + "array" + ] + }, + "secondary_files": [ + "^.bai" + ], + "db_value": [ + { + "class": "File", + "location": "bid://dac975dc-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dabb1d34-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dab569fc-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dab96020-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dacb2198-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://daa7ddaa-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://daad53d4-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dac91556-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dab98686-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dabdb3aa-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://daad1f18-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://da9de9b2-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dab1cb76-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dab5b524-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dab46df4-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dab31efe-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dacefc1e-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://daa1dc98-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dab3db5a-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dabb66b8-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://daa83930-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dabc433a-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://da9e6d7e-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://daa5b7a0-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dab1f13c-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dac14e20-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dabcb4aa-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dac8139a-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://daa86414-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://daa6730c-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://da9f2480-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://daa3ffdc-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://daa8e420-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dac20b94-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dacf4ff2-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://daac8620-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://daaec3b8-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://daac3936-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://da9f6166-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://daaf0d5a-50ea-11ea-b9c7-ac1f6b453620" + } + ], + "value": [ + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006284_N002_d.Group3.rg.md.abra.printreads.1581878020.bam", + "size": 18001309333, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006537_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "size": 13424642344, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006550_N002_d.Group1.rg.md.abra.printreads.1581878020.bam", + "size": 13851651891, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006609_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "size": 16764556278, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006610_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "size": 17797687748, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006626_N001_d.Group19.rg.md.abra.printreads.1581878020.bam", + "size": 15450048427, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006627_N001_d.Group20.rg.md.abra.printreads.1581878020.bam", + "size": 21418934197, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006628_N001_d.Group15.rg.md.abra.printreads.1581878020.bam", + "size": 20242506560, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006630_N001_d.Group14.rg.md.abra.printreads.1581878020.bam", + "size": 18554952981, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006631_N001_d.Group17.rg.md.abra.printreads.1581878020.bam", + "size": 17671380235, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006632_N001_d.Group16.rg.md.abra.printreads.1581878020.bam", + "size": 17956822592, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006633_N001_d.Group13.rg.md.abra.printreads.1581878020.bam", + "size": 14995930592, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006635_N001_d.Group8.rg.md.abra.printreads.1581878020.bam", + "size": 19452196435, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006636_N001_d.Group9.rg.md.abra.printreads.1581878020.bam", + "size": 19189450319, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006637_N002_d.Group0.rg.md.abra.printreads.1581878020.bam", + "size": 10888838079, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006638_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "size": 10088003650, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006639_N001_d.Group6.rg.md.abra.printreads.1581878020.bam", + "size": 18437335538, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006640_N001_d.Group7.rg.md.abra.printreads.1581878020.bam", + "size": 18781758639, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006641_N001_d.Group4.rg.md.abra.printreads.1581878020.bam", + "size": 15954753147, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006642_N001_d.Group5.rg.md.abra.printreads.1581878020.bam", + "size": 17579506808, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006643_N001_d.Group2.rg.md.abra.printreads.1581878020.bam", + "size": 17298827865, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006644_N001_d.Group3.rg.md.abra.printreads.1581878020.bam", + "size": 19302206744, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006645_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "size": 15523622669, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006646_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "size": 17007314582, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006647_N001_d.Group18.rg.md.abra.printreads.1581878020.bam", + "size": 20776680414, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006648_N001_d.Group11.rg.md.abra.printreads.1581878020.bam", + "size": 17232710261, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006649_N001_d.Group10.rg.md.abra.printreads.1581878020.bam", + "size": 17366153538, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006650_N001_d.Group21.rg.md.abra.printreads.1581878020.bam", + "size": 16571180154, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006904_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "size": 18185638557, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006905_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "size": 18558003865, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006906_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "size": 16951748171, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006907_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "size": 16389279357, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006996_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "size": 10690676737, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_0AEE89_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "size": 13862649385, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_1NPV4P_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "size": 11105358516, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_4W32NJ_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "size": 17582103301, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_H9KJFX_N001_d.Group2.rg.md.abra.printreads.1581878020.bam", + "size": 19349236927, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_P5FLLT_N001_d.Group4.rg.md.abra.printreads.1581878020.bam", + "size": 20668078544, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_VC7LNE_N001_d.Group5.rg.md.abra.printreads.1581878020.bam", + "size": 18873117772, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_WV53F0_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "size": 19501528278, + "class": "File" + } + ], + "files": [ + "dab569fc-50ea-11ea-b9c7-ac1f6b453620", + "daad53d4-50ea-11ea-b9c7-ac1f6b453620", + "dab3db5a-50ea-11ea-b9c7-ac1f6b453620", + "dac91556-50ea-11ea-b9c7-ac1f6b453620", + "dac20b94-50ea-11ea-b9c7-ac1f6b453620", + "daad1f18-50ea-11ea-b9c7-ac1f6b453620", + "dabb1d34-50ea-11ea-b9c7-ac1f6b453620", + "dab96020-50ea-11ea-b9c7-ac1f6b453620", + "daa5b7a0-50ea-11ea-b9c7-ac1f6b453620", + "daaf0d5a-50ea-11ea-b9c7-ac1f6b453620", + "dacb2198-50ea-11ea-b9c7-ac1f6b453620", + "dab46df4-50ea-11ea-b9c7-ac1f6b453620", + "daa86414-50ea-11ea-b9c7-ac1f6b453620", + "dabdb3aa-50ea-11ea-b9c7-ac1f6b453620", + "daa8e420-50ea-11ea-b9c7-ac1f6b453620", + "dab98686-50ea-11ea-b9c7-ac1f6b453620", + "dacf4ff2-50ea-11ea-b9c7-ac1f6b453620", + "daa3ffdc-50ea-11ea-b9c7-ac1f6b453620", + "dab1f13c-50ea-11ea-b9c7-ac1f6b453620", + "daa83930-50ea-11ea-b9c7-ac1f6b453620", + "daac3936-50ea-11ea-b9c7-ac1f6b453620", + "dac975dc-50ea-11ea-b9c7-ac1f6b453620", + "daac8620-50ea-11ea-b9c7-ac1f6b453620", + "dab31efe-50ea-11ea-b9c7-ac1f6b453620", + "da9e6d7e-50ea-11ea-b9c7-ac1f6b453620", + "dabc433a-50ea-11ea-b9c7-ac1f6b453620", + "dac14e20-50ea-11ea-b9c7-ac1f6b453620", + "da9de9b2-50ea-11ea-b9c7-ac1f6b453620", + "daa1dc98-50ea-11ea-b9c7-ac1f6b453620", + "da9f6166-50ea-11ea-b9c7-ac1f6b453620", + "dacefc1e-50ea-11ea-b9c7-ac1f6b453620", + "dabb66b8-50ea-11ea-b9c7-ac1f6b453620", + "dab5b524-50ea-11ea-b9c7-ac1f6b453620", + "dac8139a-50ea-11ea-b9c7-ac1f6b453620", + "daa6730c-50ea-11ea-b9c7-ac1f6b453620", + "daaec3b8-50ea-11ea-b9c7-ac1f6b453620", + "daa7ddaa-50ea-11ea-b9c7-ac1f6b453620", + "dab1cb76-50ea-11ea-b9c7-ac1f6b453620", + "da9f2480-50ea-11ea-b9c7-ac1f6b453620", + "dabcb4aa-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dac7e294-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.808Z", + "modified_date": "2020-02-04T15:29:52.632Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "ref_fasta", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".amb", + ".ann", + ".bwt", + ".pac", + ".sa", + ".fai", + "^.dict" + ], + "db_value": { + "class": "File", + "location": "bid://dabd44b0-50ea-11ea-b9c7-ac1f6b453620" + }, + "value": { + "path": "/juno/work/ci/resources/genomes/GRCh37/fasta/b37.1581878020.fasta", + "size": 3189750467, + "class": "File" + }, + "files": [ + "dabd44b0-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dacfa4c0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.814Z", + "modified_date": "2020-02-04T15:29:52.640Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "mouse_fasta", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".amb", + ".ann", + ".bwt", + ".pac", + ".sa", + ".fai", + "^.dict" + ], + "db_value": { + "class": "File", + "location": "bid://daaf32ee-50ea-11ea-b9c7-ac1f6b453620" + }, + "value": { + "path": "/juno/work/ci/resources/genomes/GRCm38/GRCm38.1581878020.fasta", + "size": 2769885087, + "class": "File" + }, + "files": [ + "daaf32ee-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "da9e2d64-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.818Z", + "modified_date": "2020-02-04T15:29:52.648Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "hapmap", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".idx" + ], + "db_value": { + "class": "File", + "location": "bid://dabd69fe-50ea-11ea-b9c7-ac1f6b453620" + }, + "value": { + "path": "/juno/work/ci/resources/request_files/hapmap/hapmap_3.3.b37.1581878020.vcf", + "size": 225898391, + "class": "File" + }, + "files": [ + "dabd69fe-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "daa3cd78-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.862Z", + "modified_date": "2020-02-04T15:29:52.797Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "runparams", + "port_type": 0, + "schema": { + "type": "record", + "fields": { + "genome": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "tmp_dir": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "intervals": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "mutect_rf": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "complex_nn": { + "type": [ + "null", + "array" + ], + "items": "float" + }, + "complex_tn": { + "type": [ + "null", + "array" + ], + "items": "float" + }, + "covariates": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "delly_type": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "facets_cval": { + "type": [ + "null", + "array" + ], + "items": "int" + }, + "mutect_dcov": { + "type": [ + "null", + "array" + ], + "items": "int" + }, + "num_threads": { + "type": [ + "null", + "array" + ], + "items": "int" + }, + "scripts_bin": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "abra_ram_min": { + "type": [ + "null", + "array" + ], + "items": "int" + }, + "abra_scratch": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "facets_pcval": { + "type": [ + "null", + "array" + ], + "items": "int" + }, + "gatk_jar_path": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "project_prefix": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "opt_dup_pix_dist": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "emit_original_quals": { + "type": [ + "null", + "array" + ], + "items": "boolean" + }, + "num_cpu_threads_per_data_thread": { + "type": [ + "null", + "array" + ], + "items": "int" + } + } + }, + "secondary_files": [], + "db_value": { + "genome": "GRCh37", + "tmp_dir": "/scratch", + "intervals": [ + "1", + "2", + "3", + "4", + "5", + "6", + "7", + "8", + "9", + "10", + "11", + "12", + "13", + "14", + "15", + "16", + "17", + "18", + "19", + "20", + "21", + "22", + "X", + "Y", + "MT" + ], + "mutect_rf": [ + "BadCigar" + ], + "complex_nn": 0.1, + "complex_tn": 0.2, + "covariates": [ + "CycleCovariate", + "ContextCovariate", + "ReadGroupCovariate", + "QualityScoreCovariate" + ], + "delly_type": [ + "DUP", + "DEL", + "INV", + "INS", + "BND" + ], + "facets_cval": 100, + "mutect_dcov": 50000, + "num_threads": 10, + "scripts_bin": "/usr/bin", + "abra_ram_min": 84000, + "abra_scratch": "/scratch", + "facets_pcval": 500, + "gatk_jar_path": "/usr/bin/gatk.jar", + "project_prefix": [ + "09670_D" + ], + "opt_dup_pix_dist": "2500", + "emit_original_quals": true, + "num_cpu_threads_per_data_thread": 6 + }, + "value": { + "genome": "GRCh37", + "tmp_dir": "/scratch", + "intervals": [ + "1", + "2", + "3", + "4", + "5", + "6", + "7", + "8", + "9", + "10", + "11", + "12", + "13", + "14", + "15", + "16", + "17", + "18", + "19", + "20", + "21", + "22", + "X", + "Y", + "MT" + ], + "mutect_rf": [ + "BadCigar" + ], + "complex_nn": 0.1, + "complex_tn": 0.2, + "covariates": [ + "CycleCovariate", + "ContextCovariate", + "ReadGroupCovariate", + "QualityScoreCovariate" + ], + "delly_type": [ + "DUP", + "DEL", + "INV", + "INS", + "BND" + ], + "facets_cval": 100, + "mutect_dcov": 50000, + "num_threads": 10, + "scripts_bin": "/usr/bin", + "abra_ram_min": 84000, + "abra_scratch": "/scratch", + "facets_pcval": 500, + "gatk_jar_path": "/usr/bin/gatk.jar", + "project_prefix": [ + "09670_D" + ], + "opt_dup_pix_dist": "2500", + "emit_original_quals": true, + "num_cpu_threads_per_data_thread": 6 + }, + "files": [] + } + }, + { + "model": "runner.port", + "pk": "dab2faaa-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.869Z", + "modified_date": "2020-02-04T15:29:52.810Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "pair", + "port_type": 0, + "schema": { + "type": "array", + "items": "record" + }, + "secondary_files": [], + "db_value": [ + { + "CN": "MSKCC", + "ID": "s_C_K2902H_P001_d", + "LB": "09670_D_1_1_1_1_1", + "PL": "Illumina", + "PU": [ + "H7HCTBBXY_ACATACGG" + ], + "R1": [ + { + "class": "File", + "location": "bid://dabbf808-50ea-11ea-b9c7-ac1f6b453620" + } + ], + "R2": [ + { + "class": "File", + "location": "bid://daad7a4e-50ea-11ea-b9c7-ac1f6b453620" + } + ], + "bam": [], + "zR1": [], + "zR2": [], + "RG_ID": [ + "s_C_K2902H_P001_d_H7HCTBBXY_ACATACGG" + ], + "adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGCCGTCTTCTGCTTG", + "adapter2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT", + "bwa_output": "s_C_K2902H_P001_d.bam" + }, + { + "CN": "MSKCC", + "ID": "s_C_K2902H_N001_d", + "LB": "09670_D_46_1", + "PL": "Illumina", + "PU": [ + "H7FKJBBXY" + ], + "R1": [ + { + "class": "File", + "location": "bid://dacc897a-50ea-11ea-b9c7-ac1f6b453620" + } + ], + "R2": [ + { + "class": "File", + "location": "bid://dab2170c-50ea-11ea-b9c7-ac1f6b453620" + } + ], + "bam": [], + "zR1": [], + "zR2": [], + "RG_ID": [ + "s_C_K2902H_N001_d_H7FKJBBXY" + ], + "adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGCCGTCTTCTGCTTG", + "adapter2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT", + "bwa_output": "s_C_K2902H_N001_d.bam" + } + ], + "value": [ + { + "CN": "MSKCC", + "ID": "s_C_K2902H_P001_d", + "LB": "09670_D_1_1_1_1_1", + "PL": "Illumina", + "PU": [ + "H7HCTBBXY_ACATACGG" + ], + "R1": [ + { + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0390_BH7HCTBBXY/Project_09670_D/Sample_S16-68609_IGO_09670_D_1/S16-68609_IGO_09670_D_1_S11_R1_001.fastq.1581878020.gz", + "size": 5966546453, + "class": "File" + } + ], + "R2": [ + { + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0390_BH7HCTBBXY/Project_09670_D/Sample_S16-68609_IGO_09670_D_1/S16-68609_IGO_09670_D_1_S11_R2_001.fastq.1581878020.gz", + "size": 5832468368, + "class": "File" + } + ], + "bam": [], + "zR1": [], + "zR2": [], + "RG_ID": [ + "s_C_K2902H_P001_d_H7HCTBBXY_ACATACGG" + ], + "adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGCCGTCTTCTGCTTG", + "adapter2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT", + "bwa_output": "s_C_K2902H_P001_d.bam" + }, + { + "CN": "MSKCC", + "ID": "s_C_K2902H_N001_d", + "LB": "09670_D_46_1", + "PL": "Illumina", + "PU": [ + "H7FKJBBXY" + ], + "R1": [ + { + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0391_AH7FKJBBXY/Project_09670_D/Sample_P-0017035-N01-WES_IGO_09670_D_46/P-0017035-N01-WES_IGO_09670_D_46_S12_R1_001.fastq.1581878020.gz", + "size": 3576965127, + "class": "File" + } + ], + "R2": [ + { + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0391_AH7FKJBBXY/Project_09670_D/Sample_P-0017035-N01-WES_IGO_09670_D_46/P-0017035-N01-WES_IGO_09670_D_46_S12_R2_001.fastq.1581878020.gz", + "size": 3592299152, + "class": "File" + } + ], + "bam": [], + "zR1": [], + "zR2": [], + "RG_ID": [ + "s_C_K2902H_N001_d_H7FKJBBXY" + ], + "adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGCCGTCTTCTGCTTG", + "adapter2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT", + "bwa_output": "s_C_K2902H_N001_d.bam" + } + ], + "files": [ + "daad7a4e-50ea-11ea-b9c7-ac1f6b453620", + "dabbf808-50ea-11ea-b9c7-ac1f6b453620", + "dab2170c-50ea-11ea-b9c7-ac1f6b453620", + "dacc897a-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "daab50d4-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.971Z", + "modified_date": "2020-02-04T15:29:58.827Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "annotate_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 65612975, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.annotate-variants.vcf", + "checksum": "sha1$0201d57f5fd370615df7ce8b78f49ae512692e0e", + "location": "bid://dab424ca-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.annotate-variants" + }, + "value": { + "size": 65612975, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.annotate-variants.vcf", + "checksum": "sha1$0201d57f5fd370615df7ce8b78f49ae512692e0e", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.annotate-variants.vcf", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.annotate-variants" + }, + "files": [ + "dab424ca-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "daca9804-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:18.030Z", + "modified_date": "2020-02-04T15:29:59.003Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "maf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 181310718, + "class": "File", + "nameext": ".maf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.muts.maf", + "checksum": "sha1$15db27138a1586bf4f017b572154875c5ff129db", + "location": "bid://dacd0954-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.muts" + }, + "value": { + "size": 181310718, + "class": "File", + "nameext": ".maf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.muts.maf", + "checksum": "sha1$15db27138a1586bf4f017b572154875c5ff129db", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.muts.maf", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.muts" + }, + "files": [ + "dacd0954-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "daa6cdac-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.873Z", + "modified_date": "2020-02-04T15:29:59.010Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "bams", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + "^.bai" + ], + "db_value": [ + { + "size": 22899967017, + "class": "File", + "nameext": ".bam", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.bam", + "checksum": "sha1$d67cf2c24cacfeaa222893c5d4303aed55556457", + "location": "bid://daba66aa-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads", + "secondaryFiles": [ + { + "size": 6252264, + "class": "File", + "nameext": ".bai", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.bai", + "checksum": "sha1$776fc843bcdbd215452e611f03d7d9b42ad05a09", + "location": "bid://a0184edc-0a1c-40e7-9d41-69dda2e1e23e", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads" + } + ] + }, + { + "size": 14961505727, + "class": "File", + "nameext": ".bam", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.bam", + "checksum": "sha1$45f52cc5db96a9d90784ddcee324cedbe1ac5618", + "location": "bid://dab07dc0-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads", + "secondaryFiles": [ + { + "size": 6010352, + "class": "File", + "nameext": ".bai", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.bai", + "checksum": "sha1$67a9aff1f1cd7be0240b7fefe740f7852dee4933", + "location": "bid://12ffa7a4-b853-452d-8076-fde5bac09aec", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads" + } + ] + } + ], + "value": [ + { + "size": 22899967017, + "class": "File", + "nameext": ".bam", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.bam", + "checksum": "sha1$d67cf2c24cacfeaa222893c5d4303aed55556457", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.bam", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads", + "secondaryFiles": [ + { + "size": 6252264, + "class": "File", + "nameext": ".bai", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.bai", + "checksum": "sha1$776fc843bcdbd215452e611f03d7d9b42ad05a09", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.bai", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads" + } + ] + }, + { + "size": 14961505727, + "class": "File", + "nameext": ".bam", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.bam", + "checksum": "sha1$45f52cc5db96a9d90784ddcee324cedbe1ac5618", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads.bam", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads", + "secondaryFiles": [ + { + "size": 6010352, + "class": "File", + "nameext": ".bai", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.bai", + "checksum": "sha1$67a9aff1f1cd7be0240b7fefe740f7852dee4933", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads.bai", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads" + } + ] + } + ], + "files": [ + "daba66aa-50ea-11ea-b9c7-ac1f6b453620", + "dab07dc0-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dac5d0f8-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.876Z", + "modified_date": "2020-02-04T15:29:59.025Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "clstats1", + "port_type": 1, + "schema": { + "type": "array", + "items": "array" + }, + "secondary_files": [], + "db_value": [ + [ + { + "size": 2641, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk000_cl.stats", + "checksum": "sha1$c3c14c67c47c1a9502a528685d8f24f1eda9dccd", + "location": "bid://daa90ff4-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk000_cl" + }, + { + "size": 2611, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk001_cl.stats", + "checksum": "sha1$15260c3f7d8a521e7d2021f2581f8ffd96ff9519", + "location": "bid://dac27a66-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk001_cl" + }, + { + "size": 2576, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk002_cl.stats", + "checksum": "sha1$ef853b586f31afefcabe8be9ba28bcddd5e47919", + "location": "bid://dab05854-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk002_cl" + } + ], + [ + { + "size": 2764, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk000_cl.stats", + "checksum": "sha1$581103c999b49f012af12d4dd579a48ab7573991", + "location": "bid://daab79ba-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk000_cl" + }, + { + "size": 2714, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk001_cl.stats", + "checksum": "sha1$fe2dd352e11bc48feefc6f7e1035ea0b5c8265dc", + "location": "bid://daa9905a-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk001_cl" + } + ] + ], + "value": [ + [ + { + "size": 2641, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk000_cl.stats", + "checksum": "sha1$c3c14c67c47c1a9502a528685d8f24f1eda9dccd", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk000_cl.stats", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk000_cl" + }, + { + "size": 2611, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk001_cl.stats", + "checksum": "sha1$15260c3f7d8a521e7d2021f2581f8ffd96ff9519", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk001_cl.stats", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk001_cl" + }, + { + "size": 2576, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk002_cl.stats", + "checksum": "sha1$ef853b586f31afefcabe8be9ba28bcddd5e47919", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk002_cl.stats", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk002_cl" + } + ], + [ + { + "size": 2764, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk000_cl.stats", + "checksum": "sha1$581103c999b49f012af12d4dd579a48ab7573991", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk000_cl.stats", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk000_cl" + }, + { + "size": 2714, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk001_cl.stats", + "checksum": "sha1$fe2dd352e11bc48feefc6f7e1035ea0b5c8265dc", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk001_cl.stats", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk001_cl" + } + ] + ], + "files": [ + "daa90ff4-50ea-11ea-b9c7-ac1f6b453620", + "daa9905a-50ea-11ea-b9c7-ac1f6b453620", + "daab79ba-50ea-11ea-b9c7-ac1f6b453620", + "dab05854-50ea-11ea-b9c7-ac1f6b453620", + "dac27a66-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "daafc5b0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.879Z", + "modified_date": "2020-02-04T15:29:59.042Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "clstats2", + "port_type": 1, + "schema": { + "type": "array", + "items": "array" + }, + "secondary_files": [], + "db_value": [ + [ + { + "size": 2818, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk000_cl.stats", + "checksum": "sha1$883cf9ba173211144550938349dfdbeefb6f38ee", + "location": "bid://dabaafca-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk000_cl" + }, + { + "size": 2815, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk001_cl.stats", + "checksum": "sha1$78e3a8aab3b20c83dee40acea967e25893ec2065", + "location": "bid://dab3444c-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk001_cl" + }, + { + "size": 2775, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk002_cl.stats", + "checksum": "sha1$83cee0ca80ff374fd6049f9cbf475fb81a380d91", + "location": "bid://dacfcb44-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk002_cl" + } + ], + [ + { + "size": 2873, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk000_cl.stats", + "checksum": "sha1$2f9093a15e3a538e80653637690e0410779df620", + "location": "bid://dacba802-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk000_cl" + }, + { + "size": 2826, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk001_cl.stats", + "checksum": "sha1$e583971745676ccfbbb0b09474f74ecef10ea922", + "location": "bid://dabed8d4-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk001_cl" + } + ] + ], + "value": [ + [ + { + "size": 2818, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk000_cl.stats", + "checksum": "sha1$883cf9ba173211144550938349dfdbeefb6f38ee", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk000_cl.stats", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk000_cl" + }, + { + "size": 2815, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk001_cl.stats", + "checksum": "sha1$78e3a8aab3b20c83dee40acea967e25893ec2065", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk001_cl.stats", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk001_cl" + }, + { + "size": 2775, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk002_cl.stats", + "checksum": "sha1$83cee0ca80ff374fd6049f9cbf475fb81a380d91", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk002_cl.stats", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk002_cl" + } + ], + [ + { + "size": 2873, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk000_cl.stats", + "checksum": "sha1$2f9093a15e3a538e80653637690e0410779df620", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk000_cl.stats", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk000_cl" + }, + { + "size": 2826, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk001_cl.stats", + "checksum": "sha1$e583971745676ccfbbb0b09474f74ecef10ea922", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk001_cl.stats", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk001_cl" + } + ] + ], + "files": [ + "dabed8d4-50ea-11ea-b9c7-ac1f6b453620", + "dacba802-50ea-11ea-b9c7-ac1f6b453620", + "dab3444c-50ea-11ea-b9c7-ac1f6b453620", + "dacfcb44-50ea-11ea-b9c7-ac1f6b453620", + "dabaafca-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dac87ab0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:18.020Z", + "modified_date": "2020-02-04T15:29:59.046Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "maf_file", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 59073, + "class": "File", + "nameext": ".maf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.maf", + "checksum": "sha1$bc1d7f73cc72eecf3b13f88402d6952c92d933de", + "location": "bid://dab17ef0-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep" + }, + "value": { + "size": 59073, + "class": "File", + "nameext": ".maf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.maf", + "checksum": "sha1$bc1d7f73cc72eecf3b13f88402d6952c92d933de", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.maf", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep" + }, + "files": [ + "dab17ef0-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dab2d71e-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.932Z", + "modified_date": "2020-02-04T15:29:59.053Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "qual_pdf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 8189, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "checksum": "sha1$9ff5ad812b693a79512b12506f59d5d67df87c05", + "location": "bid://da9eab36-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle" + }, + { + "size": 8219, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "checksum": "sha1$716fb1c1bcd8040ecc6e4452cbbae25a20435c52", + "location": "bid://dab62496-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle" + } + ], + "value": [ + { + "size": 8189, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "checksum": "sha1$9ff5ad812b693a79512b12506f59d5d67df87c05", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle" + }, + { + "size": 8219, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "checksum": "sha1$716fb1c1bcd8040ecc6e4452cbbae25a20435c52", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle" + } + ], + "files": [ + "da9eab36-50ea-11ea-b9c7-ac1f6b453620", + "dab62496-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dab8d01a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.892Z", + "modified_date": "2020-02-04T15:29:59.059Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "as_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 2171, + "class": "File", + "nameext": ".asmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.asmetrics", + "checksum": "sha1$7e891f9f68deedb83626c728109097d9c562f7a1", + "location": "bid://dac1cad0-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 2134, + "class": "File", + "nameext": ".asmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.asmetrics", + "checksum": "sha1$65ab3f206ead19b7ae3aa0eb4a9d1c5e7dff9843", + "location": "bid://dab8f3f6-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "value": [ + { + "size": 2171, + "class": "File", + "nameext": ".asmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.asmetrics", + "checksum": "sha1$7e891f9f68deedb83626c728109097d9c562f7a1", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.asmetrics", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 2134, + "class": "File", + "nameext": ".asmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.asmetrics", + "checksum": "sha1$65ab3f206ead19b7ae3aa0eb4a9d1c5e7dff9843", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.asmetrics", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "files": [ + "dab8f3f6-50ea-11ea-b9c7-ac1f6b453620", + "dac1cad0-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dab7f9ec-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.997Z", + "modified_date": "2020-02-04T15:29:59.066Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "facets_out", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 603, + "class": "File", + "nameext": ".out", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.out", + "checksum": "sha1$adf1df0bad06a20de898606152b4562d13de5fba", + "location": "bid://daacadd0-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens" + }, + { + "size": 602, + "class": "File", + "nameext": ".out", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.out", + "checksum": "sha1$f376bc7c0c427199a8319cbe95fc368abc914535", + "location": "bid://daaa358c-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity" + } + ], + "value": [ + { + "size": 603, + "class": "File", + "nameext": ".out", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.out", + "checksum": "sha1$adf1df0bad06a20de898606152b4562d13de5fba", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.out", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens" + }, + { + "size": 602, + "class": "File", + "nameext": ".out", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.out", + "checksum": "sha1$f376bc7c0c427199a8319cbe95fc368abc914535", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.out", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity" + } + ], + "files": [ + "daacadd0-50ea-11ea-b9c7-ac1f6b453620", + "daaa358c-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dab0ed96-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.986Z", + "modified_date": "2020-02-04T15:29:59.077Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "facets_png", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 124853, + "class": "File", + "nameext": ".png", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.CNCF.png", + "checksum": "sha1$aa3cfccae19203ef9fa352574ecdbf8db6b42d5a", + "location": "bid://daae0d88-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.CNCF" + }, + { + "size": 111084, + "class": "File", + "nameext": ".png", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.CNCF.png", + "checksum": "sha1$dd13091946cb9b1ae3c002c0b86f8c1ca8f7bdea", + "location": "bid://daaaaf62-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.CNCF" + } + ], + "value": [ + { + "size": 124853, + "class": "File", + "nameext": ".png", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.CNCF.png", + "checksum": "sha1$aa3cfccae19203ef9fa352574ecdbf8db6b42d5a", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.CNCF.png", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.CNCF" + }, + { + "size": 111084, + "class": "File", + "nameext": ".png", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.CNCF.png", + "checksum": "sha1$dd13091946cb9b1ae3c002c0b86f8c1ca8f7bdea", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.CNCF.png", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.CNCF" + } + ], + "files": [ + "daaaaf62-50ea-11ea-b9c7-ac1f6b453620", + "daae0d88-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dabdd952-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:18.005Z", + "modified_date": "2020-02-04T15:29:59.084Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "facets_seg", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 4777, + "class": "File", + "nameext": ".seg", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.seg", + "checksum": "sha1$31d0a6687ac647922e9d67a0d2d6a28a7e16ec7a", + "location": "bid://dac746b8-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens" + }, + { + "size": 3222, + "class": "File", + "nameext": ".seg", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.seg", + "checksum": "sha1$d15b1f7136fb9d107297f35abffd2ee9c9a229ac", + "location": "bid://daaa865e-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity" + } + ], + "value": [ + { + "size": 4777, + "class": "File", + "nameext": ".seg", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.seg", + "checksum": "sha1$31d0a6687ac647922e9d67a0d2d6a28a7e16ec7a", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.seg", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens" + }, + { + "size": 3222, + "class": "File", + "nameext": ".seg", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.seg", + "checksum": "sha1$d15b1f7136fb9d107297f35abffd2ee9c9a229ac", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.seg", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity" + } + ], + "files": [ + "dac746b8-50ea-11ea-b9c7-ac1f6b453620", + "daaa865e-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "daccb562-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.939Z", + "modified_date": "2020-02-04T15:29:59.091Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "gcbias_pdf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 6784, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_P001_d.rg.md.gcbias.pdf", + "checksum": "sha1$4d1ed6c4bda99d26a031b9e9651f2f4abe8cfdd2", + "location": "bid://dac63ac0-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md.gcbias" + }, + { + "size": 6794, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_N001_d.rg.md.gcbias.pdf", + "checksum": "sha1$010c3e9323875594fa4d4469c13b91db5a46e8cc", + "location": "bid://daa6f9b2-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.gcbias" + } + ], + "value": [ + { + "size": 6784, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_P001_d.rg.md.gcbias.pdf", + "checksum": "sha1$4d1ed6c4bda99d26a031b9e9651f2f4abe8cfdd2", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.gcbias.pdf", + "nameroot": "s_C_K2902H_P001_d.rg.md.gcbias" + }, + { + "size": 6794, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_N001_d.rg.md.gcbias.pdf", + "checksum": "sha1$010c3e9323875594fa4d4469c13b91db5a46e8cc", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.gcbias.pdf", + "nameroot": "s_C_K2902H_N001_d.rg.md.gcbias" + } + ], + "files": [ + "daa6f9b2-50ea-11ea-b9c7-ac1f6b453620", + "dac63ac0-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dacff34e-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.897Z", + "modified_date": "2020-02-04T15:29:59.098Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "hs_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 5016, + "class": "File", + "nameext": ".hsmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.hsmetrics", + "checksum": "sha1$d6ba79849a45f9fa69092453ada9f5992e7c0abb", + "location": "bid://daa754ac-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 5029, + "class": "File", + "nameext": ".hsmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.hsmetrics", + "checksum": "sha1$2b08239d16dc6787ab37a7403313d46264877c7e", + "location": "bid://dab9ac60-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "value": [ + { + "size": 5016, + "class": "File", + "nameext": ".hsmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.hsmetrics", + "checksum": "sha1$d6ba79849a45f9fa69092453ada9f5992e7c0abb", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.hsmetrics", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 5029, + "class": "File", + "nameext": ".hsmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.hsmetrics", + "checksum": "sha1$2b08239d16dc6787ab37a7403313d46264877c7e", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.hsmetrics", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "files": [ + "daa754ac-50ea-11ea-b9c7-ac1f6b453620", + "dab9ac60-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dac84914-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.920Z", + "modified_date": "2020-02-04T15:29:59.105Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "insert_pdf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 13994, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_P001_d.rg.md.ismetrics.pdf", + "checksum": "sha1$aa4d306c3b2327fe6e84ebf6b371ca79644ec649", + "location": "bid://dac340f4-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md.ismetrics" + }, + { + "size": 12712, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_N001_d.rg.md.ismetrics.pdf", + "checksum": "sha1$5a57d43594e74ac8615409802377346f212e1cf7", + "location": "bid://dacf7a18-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.ismetrics" + } + ], + "value": [ + { + "size": 13994, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_P001_d.rg.md.ismetrics.pdf", + "checksum": "sha1$aa4d306c3b2327fe6e84ebf6b371ca79644ec649", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.ismetrics.pdf", + "nameroot": "s_C_K2902H_P001_d.rg.md.ismetrics" + }, + { + "size": 12712, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_N001_d.rg.md.ismetrics.pdf", + "checksum": "sha1$5a57d43594e74ac8615409802377346f212e1cf7", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.ismetrics.pdf", + "nameroot": "s_C_K2902H_N001_d.rg.md.ismetrics" + } + ], + "files": [ + "dacf7a18-50ea-11ea-b9c7-ac1f6b453620", + "dac340f4-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dac110fe-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.884Z", + "modified_date": "2020-02-04T15:29:59.117Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "md_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 2900, + "class": "File", + "nameext": ".md_metrics", + "basename": "s_C_K2902H_P001_d.rg.md_metrics", + "checksum": "sha1$379ec0abb55e3b1ff9adb8ff82ed31689aa8062b", + "location": "bid://dab36a62-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg" + }, + { + "size": 2866, + "class": "File", + "nameext": ".md_metrics", + "basename": "s_C_K2902H_N001_d.rg.md_metrics", + "checksum": "sha1$d2005e5e85d9e581671522c74548c8623d2c1979", + "location": "bid://daafe950-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg" + } + ], + "value": [ + { + "size": 2900, + "class": "File", + "nameext": ".md_metrics", + "basename": "s_C_K2902H_P001_d.rg.md_metrics", + "checksum": "sha1$379ec0abb55e3b1ff9adb8ff82ed31689aa8062b", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md_metrics", + "nameroot": "s_C_K2902H_P001_d.rg" + }, + { + "size": 2866, + "class": "File", + "nameext": ".md_metrics", + "basename": "s_C_K2902H_N001_d.rg.md_metrics", + "checksum": "sha1$d2005e5e85d9e581671522c74548c8623d2c1979", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md_metrics", + "nameroot": "s_C_K2902H_N001_d.rg" + } + ], + "files": [ + "daafe950-50ea-11ea-b9c7-ac1f6b453620", + "dab36a62-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dab93cb2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.956Z", + "modified_date": "2020-02-04T15:29:59.121Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "mutect_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 24213327, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.vcf", + "checksum": "sha1$dc5d1aeb90cee217d736222d2dada308973832d6", + "location": "bid://dac43b26-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect" + }, + "value": { + "size": 24213327, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.vcf", + "checksum": "sha1$dc5d1aeb90cee217d736222d2dada308973832d6", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.vcf", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect" + }, + "files": [ + "dac43b26-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dac94652-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.968Z", + "modified_date": "2020-02-04T15:29:59.125Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "combine_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".tbi" + ], + "db_value": { + "size": 13440159, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz", + "checksum": "sha1$11cb5a6370052fdfb1d83da53a7161cf3592e8f5", + "location": "bid://dac9a854-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf", + "secondaryFiles": [ + { + "size": 430453, + "class": "File", + "nameext": ".tbi", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz.tbi", + "checksum": "sha1$dd9315feeb320ec777dac7297b3a9bfc7a5d6c33", + "location": "bid://ae7708c1-6e92-480b-a550-5c847056e0ca", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz" + } + ] + }, + "value": { + "size": 13440159, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz", + "checksum": "sha1$11cb5a6370052fdfb1d83da53a7161cf3592e8f5", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf", + "secondaryFiles": [ + { + "size": 430453, + "class": "File", + "nameext": ".tbi", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz.tbi", + "checksum": "sha1$dd9315feeb320ec777dac7297b3a9bfc7a5d6c33", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz.tbi", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz" + } + ] + }, + "files": [ + "dac9a854-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "daba4314-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:18.014Z", + "modified_date": "2020-02-04T15:29:59.129Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "merged_file", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 19739, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vcf", + "checksum": "sha1$c016b28102cd0e828dda14b1dfca985f822849ed", + "location": "bid://dab00e76-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass" + }, + "value": { + "size": 19739, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vcf", + "checksum": "sha1$c016b28102cd0e828dda14b1dfca985f822849ed", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vcf", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass" + }, + "files": [ + "dab00e76-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dab5dad6-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:18.026Z", + "modified_date": "2020-02-04T15:29:59.133Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "portal_file", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 5795, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.portal.txt", + "checksum": "sha1$14d8ca3da33d4d318fa5f5e2cdf77f8687a62148", + "location": "bid://dac8e07c-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.portal" + }, + "value": { + "size": 5795, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.portal.txt", + "checksum": "sha1$14d8ca3da33d4d318fa5f5e2cdf77f8687a62148", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.portal.txt", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.portal" + }, + "files": [ + "dac8e07c-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dabaf9bc-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.965Z", + "modified_date": "2020-02-04T15:29:59.137Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "vardict_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 403491742, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.vcf", + "checksum": "sha1$cbcd1bd27821f1c527434bfe9abace8d3320819e", + "location": "bid://dab0c884-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict" + }, + "value": { + "size": 403491742, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.vcf", + "checksum": "sha1$cbcd1bd27821f1c527434bfe9abace8d3320819e", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.vcf", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict" + }, + "files": [ + "dab0c884-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dab7224c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:18.003Z", + "modified_date": "2020-02-04T15:29:59.147Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "facets_rdata", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 8622126, + "class": "File", + "nameext": ".Rdata", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.Rdata", + "checksum": "sha1$1e47fce47992626a03fe84ebcb3e95a0fecea4f1", + "location": "bid://daa9bb7a-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens" + }, + { + "size": 8618530, + "class": "File", + "nameext": ".Rdata", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.Rdata", + "checksum": "sha1$b990bfe8c0471672e76056a0f291b5d4ee81d4d9", + "location": "bid://dab9d2c6-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity" + } + ], + "value": [ + { + "size": 8622126, + "class": "File", + "nameext": ".Rdata", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.Rdata", + "checksum": "sha1$1e47fce47992626a03fe84ebcb3e95a0fecea4f1", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.Rdata", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens" + }, + { + "size": 8618530, + "class": "File", + "nameext": ".Rdata", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.Rdata", + "checksum": "sha1$b990bfe8c0471672e76056a0f291b5d4ee81d4d9", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.Rdata", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity" + } + ], + "files": [ + "daa9bb7a-50ea-11ea-b9c7-ac1f6b453620", + "dab9d2c6-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dad01996-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.928Z", + "modified_date": "2020-02-04T15:29:59.154Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "qual_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 5494, + "class": "File", + "nameext": ".quality_by_cycle_metrics", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "checksum": "sha1$dad5640a5406c875b7fdaf4103b6edc2f763be56", + "location": "bid://dab64a3e-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics" + }, + { + "size": 5508, + "class": "File", + "nameext": ".quality_by_cycle_metrics", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "checksum": "sha1$e804183b1e07cfa754330005de8ff5c864130a41", + "location": "bid://dac55a88-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics" + } + ], + "value": [ + { + "size": 5494, + "class": "File", + "nameext": ".quality_by_cycle_metrics", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "checksum": "sha1$dad5640a5406c875b7fdaf4103b6edc2f763be56", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics" + }, + { + "size": 5508, + "class": "File", + "nameext": ".quality_by_cycle_metrics", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "checksum": "sha1$e804183b1e07cfa754330005de8ff5c864130a41", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics" + } + ], + "files": [ + "dac55a88-50ea-11ea-b9c7-ac1f6b453620", + "dab64a3e-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dac521c6-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:18.008Z", + "modified_date": "2020-02-04T15:29:59.158Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "facets_counts", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 32693698, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads.dat.gz", + "checksum": "sha1$a6f95a5e09c9e581321079f1f5fedd003ae5c221", + "location": "bid://dabc691e-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads.dat" + }, + "value": { + "size": 32693698, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads.dat.gz", + "checksum": "sha1$a6f95a5e09c9e581321079f1f5fedd003ae5c221", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads.dat.gz", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads.dat" + }, + "files": [ + "dabc691e-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dace5a0c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.935Z", + "modified_date": "2020-02-04T15:29:59.164Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "doc_basecounts", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 13779990, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_P001_d.rg.md_FP_base_counts.txt", + "checksum": "sha1$f2677685cda917f388dd395b7715d07ae1090ff4", + "location": "bid://dac6da70-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md_FP_base_counts" + }, + { + "size": 13586169, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_N001_d.rg.md_FP_base_counts.txt", + "checksum": "sha1$a218a74b136aac74f9227e6cea7720c14fb0abce", + "location": "bid://dac8ab7a-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md_FP_base_counts" + } + ], + "value": [ + { + "size": 13779990, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_P001_d.rg.md_FP_base_counts.txt", + "checksum": "sha1$f2677685cda917f388dd395b7715d07ae1090ff4", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md_FP_base_counts.txt", + "nameroot": "s_C_K2902H_P001_d.rg.md_FP_base_counts" + }, + { + "size": 13586169, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_N001_d.rg.md_FP_base_counts.txt", + "checksum": "sha1$a218a74b136aac74f9227e6cea7720c14fb0abce", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md_FP_base_counts.txt", + "nameroot": "s_C_K2902H_N001_d.rg.md_FP_base_counts" + } + ], + "files": [ + "dac8ab7a-50ea-11ea-b9c7-ac1f6b453620", + "dac6da70-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dac380f0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.942Z", + "modified_date": "2020-02-04T15:29:59.171Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "gcbias_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 6648, + "class": "File", + "nameext": ".gcbiasmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.gcbiasmetrics", + "checksum": "sha1$bb7469356a97449579bdd25e0ab600d2a8fa426d", + "location": "bid://daa80ba4-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 6632, + "class": "File", + "nameext": ".gcbiasmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.gcbiasmetrics", + "checksum": "sha1$01cbb4e6bca86f1d857ccb6446b7188d6892d71a", + "location": "bid://dacc01e4-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "value": [ + { + "size": 6648, + "class": "File", + "nameext": ".gcbiasmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.gcbiasmetrics", + "checksum": "sha1$bb7469356a97449579bdd25e0ab600d2a8fa426d", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.gcbiasmetrics", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 6632, + "class": "File", + "nameext": ".gcbiasmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.gcbiasmetrics", + "checksum": "sha1$01cbb4e6bca86f1d857ccb6446b7188d6892d71a", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.gcbiasmetrics", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "files": [ + "daa80ba4-50ea-11ea-b9c7-ac1f6b453620", + "dacc01e4-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dab91930-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.946Z", + "modified_date": "2020-02-04T15:29:59.182Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "gcbias_summary", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 1201, + "class": "File", + "nameext": ".summary", + "basename": "s_C_K2902H_P001_d.rg.md.gcbias.summary", + "checksum": "sha1$c6ca330351060e014b450e87b8fdd43731be79f6", + "location": "bid://daa012b4-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md.gcbias" + }, + { + "size": 1199, + "class": "File", + "nameext": ".summary", + "basename": "s_C_K2902H_N001_d.rg.md.gcbias.summary", + "checksum": "sha1$1932d9f758e45392212f1cf3c08a07ba988bde8c", + "location": "bid://dabc8eb2-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.gcbias" + } + ], + "value": [ + { + "size": 1201, + "class": "File", + "nameext": ".summary", + "basename": "s_C_K2902H_P001_d.rg.md.gcbias.summary", + "checksum": "sha1$c6ca330351060e014b450e87b8fdd43731be79f6", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.gcbias.summary", + "nameroot": "s_C_K2902H_P001_d.rg.md.gcbias" + }, + { + "size": 1199, + "class": "File", + "nameext": ".summary", + "basename": "s_C_K2902H_N001_d.rg.md.gcbias.summary", + "checksum": "sha1$1932d9f758e45392212f1cf3c08a07ba988bde8c", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.gcbias.summary", + "nameroot": "s_C_K2902H_N001_d.rg.md.gcbias" + } + ], + "files": [ + "daa012b4-50ea-11ea-b9c7-ac1f6b453620", + "dabc8eb2-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "daa466d4-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.908Z", + "modified_date": "2020-02-04T15:29:59.188Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "insert_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 7754, + "class": "File", + "nameext": ".ismetrics", + "basename": "s_C_K2902H_P001_d.rg.md.ismetrics", + "checksum": "sha1$db6602f7efaf6fcce248ac81838e52c3e252fd24", + "location": "bid://daa43358-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 7041, + "class": "File", + "nameext": ".ismetrics", + "basename": "s_C_K2902H_N001_d.rg.md.ismetrics", + "checksum": "sha1$ea3bd53219598f06bbae0868dcf4ebbcc38a4a5e", + "location": "bid://dacaf2a4-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "value": [ + { + "size": 7754, + "class": "File", + "nameext": ".ismetrics", + "basename": "s_C_K2902H_P001_d.rg.md.ismetrics", + "checksum": "sha1$db6602f7efaf6fcce248ac81838e52c3e252fd24", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.ismetrics", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 7041, + "class": "File", + "nameext": ".ismetrics", + "basename": "s_C_K2902H_N001_d.rg.md.ismetrics", + "checksum": "sha1$ea3bd53219598f06bbae0868dcf4ebbcc38a4a5e", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.ismetrics", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "files": [ + "dacaf2a4-50ea-11ea-b9c7-ac1f6b453620", + "daa43358-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "daa9e672-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.952Z", + "modified_date": "2020-02-04T15:29:59.195Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "conpair_pileups", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 55203868, + "class": "File", + "nameext": ".pileup", + "basename": "s_C_K2902H_P001_d.rg.md.pileup", + "checksum": "sha1$611ccefbf82e2cc1414acd833fcf7252483d1241", + "location": "bid://dab693e0-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 33915095, + "class": "File", + "nameext": ".pileup", + "basename": "s_C_K2902H_N001_d.rg.md.pileup", + "checksum": "sha1$3dacd4c14bd6a19468145e911e58e7a258199d4b", + "location": "bid://daaba0de-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "value": [ + { + "size": 55203868, + "class": "File", + "nameext": ".pileup", + "basename": "s_C_K2902H_P001_d.rg.md.pileup", + "checksum": "sha1$611ccefbf82e2cc1414acd833fcf7252483d1241", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.pileup", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 33915095, + "class": "File", + "nameext": ".pileup", + "basename": "s_C_K2902H_N001_d.rg.md.pileup", + "checksum": "sha1$3dacd4c14bd6a19468145e911e58e7a258199d4b", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.pileup", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "files": [ + "dab693e0-50ea-11ea-b9c7-ac1f6b453620", + "daaba0de-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "daa35c1c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.982Z", + "modified_date": "2020-02-04T15:29:59.199Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "mutect_norm_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".tbi" + ], + "db_value": { + "size": 129554, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz", + "checksum": "sha1$a8f6c855b471bcf37a456ad441f72c8cf1b43be9", + "location": "bid://dab9f8aa-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf", + "secondaryFiles": [ + { + "size": 32515, + "class": "File", + "nameext": ".tbi", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz.tbi", + "checksum": "sha1$e4a5c3663691f31da1bba6352dc16e35f3a8a197", + "location": "bid://18c3cd81-baa9-4e25-8616-743956972e25", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz" + } + ] + }, + "value": { + "size": 129554, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz", + "checksum": "sha1$a8f6c855b471bcf37a456ad441f72c8cf1b43be9", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf", + "secondaryFiles": [ + { + "size": 32515, + "class": "File", + "nameext": ".tbi", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz.tbi", + "checksum": "sha1$e4a5c3663691f31da1bba6352dc16e35f3a8a197", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz.tbi", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz" + } + ] + }, + "files": [ + "dab9f8aa-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dab865a8-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.959Z", + "modified_date": "2020-02-04T15:29:59.203Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "mutect_callstats", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 172715192, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.txt", + "checksum": "sha1$7920889c2817038fb047c01d40187a083d928180", + "location": "bid://dabc1d38-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect" + }, + "value": { + "size": 172715192, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.txt", + "checksum": "sha1$7920889c2817038fb047c01d40187a083d928180", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.txt", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect" + }, + "files": [ + "dabc1d38-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "daa24804-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.975Z", + "modified_date": "2020-02-04T15:29:59.212Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "vardict_norm_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".tbi" + ], + "db_value": { + "size": 13247144, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz", + "checksum": "sha1$d377fe9dea989c10fc9bff2a02f215ac75aec897", + "location": "bid://daa5298e-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf", + "secondaryFiles": [ + { + "size": 429036, + "class": "File", + "nameext": ".tbi", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz.tbi", + "checksum": "sha1$e47841e84cd7b1c1ec384fa152d6ef4218b97704", + "location": "bid://9d092d5d-8b05-4a1b-bbc7-1238fb7b8eeb", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz" + } + ] + }, + "value": { + "size": 13247144, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz", + "checksum": "sha1$d377fe9dea989c10fc9bff2a02f215ac75aec897", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf", + "secondaryFiles": [ + { + "size": 429036, + "class": "File", + "nameext": ".tbi", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz.tbi", + "checksum": "sha1$e47841e84cd7b1c1ec384fa152d6ef4218b97704", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz.tbi", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz" + } + ] + }, + "files": [ + "daa5298e-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "daa4facc-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.990Z", + "modified_date": "2020-02-04T15:29:59.216Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "facets_txt_hisens", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 11388, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.cncf.txt", + "checksum": "sha1$e7474ae2f7a0479c54d379f089ac0b823ac06c2a", + "location": "bid://dabe2330-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.cncf" + }, + "value": { + "size": 11388, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.cncf.txt", + "checksum": "sha1$e7474ae2f7a0479c54d379f089ac0b823ac06c2a", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.cncf.txt", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.cncf" + }, + "files": [ + "dabe2330-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "daa4cc0a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.993Z", + "modified_date": "2020-02-04T15:29:59.220Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "facets_txt_purity", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 7525, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.cncf.txt", + "checksum": "sha1$0b46c330b744e3ef85d1f9c5ed585ee348cd6480", + "location": "bid://dacc5c48-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.cncf" + }, + "value": { + "size": 7525, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.cncf.txt", + "checksum": "sha1$0b46c330b744e3ef85d1f9c5ed585ee348cd6480", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.cncf.txt", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.cncf" + }, + "files": [ + "dacc5c48-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dabb434a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.925Z", + "modified_date": "2020-02-04T15:29:59.226Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "per_target_coverage", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 19302184, + "class": "File", + "nameext": ".hstmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.hstmetrics", + "checksum": "sha1$b8a270c8a6c15845afd2f0b87c4f6d4318b0ded2", + "location": "bid://daa587c6-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 19114455, + "class": "File", + "nameext": ".hstmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.hstmetrics", + "checksum": "sha1$63c8d87423a1c41b71e4347cf19ab6cb63285d94", + "location": "bid://dace0714-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "value": [ + { + "size": 19302184, + "class": "File", + "nameext": ".hstmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.hstmetrics", + "checksum": "sha1$b8a270c8a6c15845afd2f0b87c4f6d4318b0ded2", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.hstmetrics", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 19114455, + "class": "File", + "nameext": ".hstmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.hstmetrics", + "checksum": "sha1$63c8d87423a1c41b71e4347cf19ab6cb63285d94", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.hstmetrics", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "files": [ + "daa587c6-50ea-11ea-b9c7-ac1f6b453620", + "dace0714-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dace320c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:18.011Z", + "modified_date": "2020-02-04T15:29:59.230Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "merged_file_unfiltered", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 2741838, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.vcf", + "checksum": "sha1$12f83bbc5e86c8dce79eeb145535f0c91e6ac6fb", + "location": "bid://dabad4d2-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs" + }, + "value": { + "size": 2741838, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.vcf", + "checksum": "sha1$12f83bbc5e86c8dce79eeb145535f0c91e6ac6fb", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.vcf", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs" + }, + "files": [ + "dabad4d2-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "file_system.file", + "pk": "dabdfd38-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-09T23:37:00.416Z", + "modified_date": "2019-12-09T23:37:00.416Z", + "file_name": "dbsnp_138.b37.excluding_sites_after_129.1581878020.vcf", + "path": "/juno/work/ci/resources/request_files/dbsnp/dbsnp_138.b37.excluding_sites_after_129.1581878020.vcf", + "file_type": 11, + "size": 2432705678, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dab3905a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-10T15:40:05.224Z", + "modified_date": "2019-12-10T15:40:05.224Z", + "file_name": "Mills_and_1000G_gold_standard.indels.b37.1581878020.vcf", + "path": "/juno/work/ci/resources/request_files/indels_1000g/Mills_and_1000G_gold_standard.indels.b37.1581878020.vcf", + "file_type": 11, + "size": 86369975, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daa1a6d8-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-10T15:41:25.361Z", + "modified_date": "2019-12-10T15:41:25.361Z", + "file_name": "1000G_phase1.snps.high_confidence.b37.1581878020.vcf", + "path": "/juno/work/ci/resources/request_files/snps_1000g/1000G_phase1.snps.high_confidence.b37.1581878020.vcf", + "file_type": 11, + "size": 7313069069, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daad9ff6-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-10T15:41:47.402Z", + "modified_date": "2019-12-10T15:41:47.402Z", + "file_name": "CosmicCodingMuts_v67_b37_20131024__NDS.1581878020.vcf", + "path": "/juno/work/ci/resources/request_files/cosmic/CosmicCodingMuts_v67_b37_20131024__NDS.1581878020.vcf", + "file_type": 11, + "size": 112402812, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dab5fed0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-10T15:42:27.587Z", + "modified_date": "2019-12-10T15:42:27.587Z", + "file_name": "ExAC_nonTCGA.r0.3.1.sites.vep.vcf.1581878020.gz", + "path": "/juno/work/ci/resources/vep/cache/ExAC_nonTCGA.r0.3.1.sites.vep.vcf.1581878020.gz", + "file_type": 11, + "size": 337197976, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dac9d9c8-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:15.075Z", + "modified_date": "2019-10-24T00:23:15.075Z", + "file_name": "refGene_b37.sorted.1581878020.txt", + "path": "/juno/work/ci/resources/request_files/refseq/refGene_b37.sorted.1581878020.txt", + "file_type": 10, + "size": 9953757, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dab111c2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:17.243Z", + "modified_date": "2019-10-24T00:23:17.243Z", + "file_name": "dbsnp_137.b37__RmDupsClean__plusPseudo50__DROP_SORT.vcf.1581878020.gz", + "path": "/juno/work/ci/resources/genomes/GRCh37/facets_snps/dbsnp_137.b37__RmDupsClean__plusPseudo50__DROP_SORT.vcf.1581878020.gz", + "file_type": 11, + "size": 1015019014, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dac595d4-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:22.167Z", + "modified_date": "2019-10-24T00:23:22.167Z", + "file_name": "FP_tiling_genotypes.1581878020.txt", + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/FP_tiling_genotypes.1581878020.txt", + "file_type": 10, + "size": 38179, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daa96544-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:22.408Z", + "modified_date": "2019-10-24T00:23:22.408Z", + "file_name": "FP_tiling_intervals.1581878020.intervals", + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/FP_tiling_intervals.1581878020.intervals", + "file_type": 7, + "size": 50804, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daa7b032-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:16.737Z", + "modified_date": "2019-10-24T00:23:16.737Z", + "file_name": "human.hg19.excl.1581878020.tsv", + "path": "/juno/work/ci/resources/genomes/GRCh37/delly/human.hg19.excl.1581878020.tsv", + "file_type": 9, + "size": 6984, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daced162-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:22.884Z", + "modified_date": "2019-10-24T00:23:22.884Z", + "file_name": "IDT_Exome_v1_FP_b37_baits.1581878020.ilist", + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/IDT_Exome_v1_FP_b37_baits.1581878020.ilist", + "file_type": 7, + "size": 7083292, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dab3b580-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-09T23:31:22.151Z", + "modified_date": "2019-12-09T23:31:22.151Z", + "file_name": "hotspot-list-union-v1-v2.1581878020.maf", + "path": "/juno/work/ci/resources/roslin-qc/hotspot-list-union-v1-v2.1581878020.maf", + "file_type": 24, + "size": 624846, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daa0f882-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:23.578Z", + "modified_date": "2019-10-24T00:23:23.578Z", + "file_name": "IDT_Exome_v1_FP_b37_targets.1581878020.ilist", + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/IDT_Exome_v1_FP_b37_targets.1581878020.ilist", + "file_type": 7, + "size": 6997415, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dac975dc-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:03.054Z", + "modified_date": "2019-10-24T00:24:03.054Z", + "file_name": "s_C_006284_N002_d.Group3.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006284_N002_d.Group3.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 18001309333, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dabb1d34-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:03.293Z", + "modified_date": "2019-10-24T00:24:03.293Z", + "file_name": "s_C_006537_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006537_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 13424642344, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dab569fc-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:03.625Z", + "modified_date": "2019-10-24T00:24:03.625Z", + "file_name": "s_C_006550_N002_d.Group1.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006550_N002_d.Group1.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 13851651891, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dab96020-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:03.884Z", + "modified_date": "2019-10-24T00:24:03.884Z", + "file_name": "s_C_006609_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006609_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 16764556278, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dacb2198-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:04.123Z", + "modified_date": "2019-10-24T00:24:04.123Z", + "file_name": "s_C_006610_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006610_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 17797687748, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daa7ddaa-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:04.371Z", + "modified_date": "2019-10-24T00:24:04.371Z", + "file_name": "s_C_006626_N001_d.Group19.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006626_N001_d.Group19.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 15450048427, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daad53d4-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:04.617Z", + "modified_date": "2019-10-24T00:24:04.617Z", + "file_name": "s_C_006627_N001_d.Group20.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006627_N001_d.Group20.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 21418934197, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dac91556-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:04.857Z", + "modified_date": "2019-10-24T00:24:04.857Z", + "file_name": "s_C_006628_N001_d.Group15.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006628_N001_d.Group15.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 20242506560, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dab98686-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:05.103Z", + "modified_date": "2019-10-24T00:24:05.103Z", + "file_name": "s_C_006630_N001_d.Group14.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006630_N001_d.Group14.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 18554952981, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dabdb3aa-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:05.351Z", + "modified_date": "2019-10-24T00:24:05.351Z", + "file_name": "s_C_006631_N001_d.Group17.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006631_N001_d.Group17.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 17671380235, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daad1f18-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:05.592Z", + "modified_date": "2019-10-24T00:24:05.592Z", + "file_name": "s_C_006632_N001_d.Group16.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006632_N001_d.Group16.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 17956822592, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "da9de9b2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:05.836Z", + "modified_date": "2019-10-24T00:24:05.836Z", + "file_name": "s_C_006633_N001_d.Group13.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006633_N001_d.Group13.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 14995930592, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dab1cb76-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:06.083Z", + "modified_date": "2019-10-24T00:24:06.083Z", + "file_name": "s_C_006635_N001_d.Group8.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006635_N001_d.Group8.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 19452196435, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dab5b524-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:06.409Z", + "modified_date": "2019-10-24T00:24:06.409Z", + "file_name": "s_C_006636_N001_d.Group9.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006636_N001_d.Group9.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 19189450319, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dab46df4-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:06.658Z", + "modified_date": "2019-10-24T00:24:06.658Z", + "file_name": "s_C_006637_N002_d.Group0.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006637_N002_d.Group0.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 10888838079, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dab31efe-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:06.901Z", + "modified_date": "2019-10-24T00:24:06.901Z", + "file_name": "s_C_006638_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006638_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 10088003650, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dacefc1e-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:07.146Z", + "modified_date": "2019-10-24T00:24:07.146Z", + "file_name": "s_C_006639_N001_d.Group6.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006639_N001_d.Group6.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 18437335538, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daa1dc98-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:07.394Z", + "modified_date": "2019-10-24T00:24:07.394Z", + "file_name": "s_C_006640_N001_d.Group7.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006640_N001_d.Group7.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 18781758639, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dab3db5a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:07.716Z", + "modified_date": "2019-10-24T00:24:07.716Z", + "file_name": "s_C_006641_N001_d.Group4.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006641_N001_d.Group4.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 15954753147, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dabb66b8-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:07.979Z", + "modified_date": "2019-10-24T00:24:07.979Z", + "file_name": "s_C_006642_N001_d.Group5.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006642_N001_d.Group5.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 17579506808, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daa83930-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:08.240Z", + "modified_date": "2019-10-24T00:24:08.240Z", + "file_name": "s_C_006643_N001_d.Group2.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006643_N001_d.Group2.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 17298827865, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dabc433a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:08.520Z", + "modified_date": "2019-10-24T00:24:08.520Z", + "file_name": "s_C_006644_N001_d.Group3.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006644_N001_d.Group3.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 19302206744, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "da9e6d7e-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:08.779Z", + "modified_date": "2019-10-24T00:24:08.779Z", + "file_name": "s_C_006645_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006645_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 15523622669, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daa5b7a0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:09.034Z", + "modified_date": "2019-10-24T00:24:09.034Z", + "file_name": "s_C_006646_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006646_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 17007314582, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dab1f13c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:09.280Z", + "modified_date": "2019-10-24T00:24:09.281Z", + "file_name": "s_C_006647_N001_d.Group18.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006647_N001_d.Group18.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 20776680414, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dac14e20-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:09.521Z", + "modified_date": "2019-10-24T00:24:09.521Z", + "file_name": "s_C_006648_N001_d.Group11.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006648_N001_d.Group11.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 17232710261, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dabcb4aa-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:09.769Z", + "modified_date": "2019-10-24T00:24:09.769Z", + "file_name": "s_C_006649_N001_d.Group10.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006649_N001_d.Group10.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 17366153538, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dac8139a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:10.024Z", + "modified_date": "2019-10-24T00:24:10.024Z", + "file_name": "s_C_006650_N001_d.Group21.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006650_N001_d.Group21.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 16571180154, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daa86414-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:10.268Z", + "modified_date": "2019-10-24T00:24:10.268Z", + "file_name": "s_C_006904_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006904_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 18185638557, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daa6730c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:10.512Z", + "modified_date": "2019-10-24T00:24:10.512Z", + "file_name": "s_C_006905_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006905_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 18558003865, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "da9f2480-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:10.758Z", + "modified_date": "2019-10-24T00:24:10.758Z", + "file_name": "s_C_006906_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006906_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 16951748171, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daa3ffdc-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:10.995Z", + "modified_date": "2019-10-24T00:24:10.995Z", + "file_name": "s_C_006907_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006907_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 16389279357, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daa8e420-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:11.235Z", + "modified_date": "2019-10-24T00:24:11.235Z", + "file_name": "s_C_006996_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006996_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 10690676737, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dac20b94-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:11.482Z", + "modified_date": "2019-10-24T00:24:11.482Z", + "file_name": "s_C_0AEE89_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_0AEE89_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 13862649385, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dacf4ff2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:11.720Z", + "modified_date": "2019-10-24T00:24:11.720Z", + "file_name": "s_C_1NPV4P_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_1NPV4P_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 11105358516, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daac8620-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:11.963Z", + "modified_date": "2019-10-24T00:24:11.963Z", + "file_name": "s_C_4W32NJ_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_4W32NJ_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 17582103301, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daaec3b8-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:12.210Z", + "modified_date": "2019-10-24T00:24:12.210Z", + "file_name": "s_C_H9KJFX_N001_d.Group2.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_H9KJFX_N001_d.Group2.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 19349236927, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daac3936-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:12.513Z", + "modified_date": "2019-10-24T00:24:12.513Z", + "file_name": "s_C_P5FLLT_N001_d.Group4.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_P5FLLT_N001_d.Group4.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 20668078544, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "da9f6166-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:12.759Z", + "modified_date": "2019-10-24T00:24:12.759Z", + "file_name": "s_C_VC7LNE_N001_d.Group5.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_VC7LNE_N001_d.Group5.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 18873117772, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daaf0d5a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-06T20:06:03.478Z", + "modified_date": "2019-12-06T20:06:03.478Z", + "file_name": "s_C_WV53F0_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_WV53F0_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 19501528278, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dabd44b0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-06T20:05:01.506Z", + "modified_date": "2019-12-06T20:05:01.506Z", + "file_name": "b37.1581878020.fasta", + "path": "/juno/work/ci/resources/genomes/GRCh37/fasta/b37.1581878020.fasta", + "file_type": 2, + "size": 3189750467, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daaf32ee-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:19.218Z", + "modified_date": "2019-10-24T00:23:19.218Z", + "file_name": "GRCm38.1581878020.fasta", + "path": "/juno/work/ci/resources/genomes/GRCm38/GRCm38.1581878020.fasta", + "file_type": 2, + "size": 2769885087, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dabd69fe-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-09T23:34:12.885Z", + "modified_date": "2019-12-09T23:34:12.886Z", + "file_name": "hapmap_3.3.b37.1581878020.vcf", + "path": "/juno/work/ci/resources/request_files/hapmap/hapmap_3.3.b37.1581878020.vcf", + "file_type": 11, + "size": 225898391, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dabbf808-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-11-29T21:15:53.295Z", + "modified_date": "2020-02-03T22:05:10.092Z", + "file_name": "S16-68609_IGO_09670_D_1_S11_R1_001.fastq.1581878020.gz", + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0390_BH7HCTBBXY/Project_09670_D/Sample_S16-68609_IGO_09670_D_1/S16-68609_IGO_09670_D_1_S11_R1_001.fastq.1581878020.gz", + "file_type": 1, + "size": 5966546453, + "file_group": "1a1b29cf-3bc2-4f6c-b376-d4c5d701166a" + } + }, + { + "model": "file_system.file", + "pk": "daad7a4e-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-11-29T21:15:53.254Z", + "modified_date": "2020-02-03T22:05:10.069Z", + "file_name": "S16-68609_IGO_09670_D_1_S11_R2_001.fastq.1581878020.gz", + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0390_BH7HCTBBXY/Project_09670_D/Sample_S16-68609_IGO_09670_D_1/S16-68609_IGO_09670_D_1_S11_R2_001.fastq.1581878020.gz", + "file_type": 1, + "size": 5832468368, + "file_group": "1a1b29cf-3bc2-4f6c-b376-d4c5d701166a" + } + }, + { + "model": "file_system.file", + "pk": "dacc897a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-11-29T21:15:51.010Z", + "modified_date": "2020-02-03T22:05:10.138Z", + "file_name": "P-0017035-N01-WES_IGO_09670_D_46_S12_R1_001.fastq.1581878020.gz", + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0391_AH7FKJBBXY/Project_09670_D/Sample_P-0017035-N01-WES_IGO_09670_D_46/P-0017035-N01-WES_IGO_09670_D_46_S12_R1_001.fastq.1581878020.gz", + "file_type": 1, + "size": 3576965127, + "file_group": "1a1b29cf-3bc2-4f6c-b376-d4c5d701166a" + } + }, + { + "model": "file_system.file", + "pk": "dab2170c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-11-29T21:15:50.983Z", + "modified_date": "2020-02-03T22:05:10.112Z", + "file_name": "P-0017035-N01-WES_IGO_09670_D_46_S12_R2_001.fastq.1581878020.gz", + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0391_AH7FKJBBXY/Project_09670_D/Sample_P-0017035-N01-WES_IGO_09670_D_46/P-0017035-N01-WES_IGO_09670_D_46_S12_R2_001.fastq.1581878020.gz", + "file_type": 1, + "size": 3592299152, + "file_group": "1a1b29cf-3bc2-4f6c-b376-d4c5d701166a" + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac4e968-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-09T23:37:00.429Z", + "modified_date": "2019-12-09T23:37:00.429Z", + "file": "dabdfd38-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daacfb6e-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-10T15:40:05.251Z", + "modified_date": "2019-12-10T15:40:05.251Z", + "file": "dab3905a-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dacd8974-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-10T15:41:25.375Z", + "modified_date": "2019-12-10T15:41:25.375Z", + "file": "daa1a6d8-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa0c0ba-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-10T15:41:47.412Z", + "modified_date": "2019-12-10T15:41:47.412Z", + "file": "daad9ff6-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa212c6-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-10T15:42:27.601Z", + "modified_date": "2019-12-10T15:42:27.601Z", + "file": "dab5fed0-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa55936-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:15.094Z", + "modified_date": "2019-10-24T00:23:15.094Z", + "file": "dac9d9c8-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "genome": "GRCh37", + "data_type": "refseq" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac0d3a0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:17.253Z", + "modified_date": "2019-10-24T00:23:17.253Z", + "file": "dab111c2-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "genome": "GRCh37", + "data_type": "facets_snps" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac7b15c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:22.177Z", + "modified_date": "2019-10-24T00:23:22.177Z", + "file": "dac595d4-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "FP_genotypes" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab1a6be-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:22.418Z", + "modified_date": "2019-10-24T00:23:22.418Z", + "file": "daa96544-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "FP_intervals" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dacbd61a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:16.747Z", + "modified_date": "2019-10-24T00:23:16.747Z", + "file": "daa7b032-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "genome": "GRCh37", + "data_type": "delly" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab8898e-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:22.894Z", + "modified_date": "2019-10-24T00:23:22.894Z", + "file": "daced162-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "baits_list" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab15aa6-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-09T23:31:22.187Z", + "modified_date": "2019-12-09T23:31:22.187Z", + "file": "dab3b580-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daae7bd8-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:23.589Z", + "modified_date": "2019-10-24T00:23:23.589Z", + "file": "daa0f882-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "targets_list" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daafa184-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:03.064Z", + "modified_date": "2019-10-24T00:24:03.064Z", + "file": "dac975dc-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab76a5e-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:03.303Z", + "modified_date": "2019-10-24T00:24:03.303Z", + "file": "dabb1d34-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daaa5ec2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:03.636Z", + "modified_date": "2019-10-24T00:24:03.636Z", + "file": "dab569fc-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daab28de-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:03.895Z", + "modified_date": "2019-10-24T00:24:03.895Z", + "file": "dab96020-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac18da4-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:04.133Z", + "modified_date": "2019-10-24T00:24:04.133Z", + "file": "dacb2198-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daaad870-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:04.381Z", + "modified_date": "2019-10-24T00:24:04.381Z", + "file": "daa7ddaa-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa27cd4-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:04.627Z", + "modified_date": "2019-10-24T00:24:04.627Z", + "file": "daad53d4-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dabd2156-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:04.868Z", + "modified_date": "2019-10-24T00:24:04.868Z", + "file": "dac91556-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dacdb340-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:05.113Z", + "modified_date": "2019-10-24T00:24:05.113Z", + "file": "dab98686-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab81dd2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:05.361Z", + "modified_date": "2019-10-24T00:24:05.361Z", + "file": "dabdb3aa-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab49310-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:05.600Z", + "modified_date": "2019-10-24T00:24:05.601Z", + "file": "daad1f18-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daaf5896-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:05.847Z", + "modified_date": "2019-10-24T00:24:05.847Z", + "file": "da9de9b2-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daaa0e36-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:06.093Z", + "modified_date": "2019-10-24T00:24:06.093Z", + "file": "dab1cb76-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daca0aec-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:06.419Z", + "modified_date": "2019-10-24T00:24:06.419Z", + "file": "dab5b524-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab26a22-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:06.667Z", + "modified_date": "2019-10-24T00:24:06.667Z", + "file": "dab46df4-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dabe6d54-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:06.911Z", + "modified_date": "2019-10-24T00:24:06.911Z", + "file": "dab31efe-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab78e4e-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:07.160Z", + "modified_date": "2019-10-24T00:24:07.160Z", + "file": "dacefc1e-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab74650-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:07.404Z", + "modified_date": "2019-10-24T00:24:07.404Z", + "file": "daa1dc98-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dacddcf8-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:07.725Z", + "modified_date": "2019-10-24T00:24:07.725Z", + "file": "dab3db5a-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dacd3596-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:07.989Z", + "modified_date": "2019-10-24T00:24:07.989Z", + "file": "dabb66b8-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab6d148-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:08.249Z", + "modified_date": "2019-10-24T00:24:08.249Z", + "file": "daa83930-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dacd5f58-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:08.532Z", + "modified_date": "2019-10-24T00:24:08.532Z", + "file": "dabc433a-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daaea022-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:08.789Z", + "modified_date": "2019-10-24T00:24:08.789Z", + "file": "da9e6d7e-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daaf7d3a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:09.045Z", + "modified_date": "2019-10-24T00:24:09.046Z", + "file": "daa5b7a0-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dabb8c10-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:09.290Z", + "modified_date": "2019-10-24T00:24:09.290Z", + "file": "dab1f13c-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daccdf74-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:09.530Z", + "modified_date": "2019-10-24T00:24:09.530Z", + "file": "dac14e20-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab7b27a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:09.779Z", + "modified_date": "2019-10-24T00:24:09.779Z", + "file": "dabcb4aa-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "da9d658c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:10.035Z", + "modified_date": "2019-10-24T00:24:10.035Z", + "file": "dac8139a-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dabbd440-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:10.278Z", + "modified_date": "2019-10-24T00:24:10.278Z", + "file": "daa86414-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daadc544-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:10.522Z", + "modified_date": "2019-10-24T00:24:10.522Z", + "file": "daa6730c-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa4992e-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:10.768Z", + "modified_date": "2019-10-24T00:24:10.768Z", + "file": "da9f2480-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa39b00-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:11.005Z", + "modified_date": "2019-10-24T00:24:11.005Z", + "file": "daa3ffdc-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa78404-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:11.244Z", + "modified_date": "2019-10-24T00:24:11.244Z", + "file": "daa8e420-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dabf7834-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:11.492Z", + "modified_date": "2019-10-24T00:24:11.492Z", + "file": "dac20b94-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daade97a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:11.730Z", + "modified_date": "2019-10-24T00:24:11.731Z", + "file": "dacf4ff2-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac47910-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:11.974Z", + "modified_date": "2019-10-24T00:24:11.974Z", + "file": "daac8620-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac71242-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:12.219Z", + "modified_date": "2019-10-24T00:24:12.219Z", + "file": "daaec3b8-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab7d642-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:12.525Z", + "modified_date": "2019-10-24T00:24:12.525Z", + "file": "daac3936-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dabeb4bc-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:12.769Z", + "modified_date": "2019-10-24T00:24:12.769Z", + "file": "da9f6166-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dace82de-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-06T20:06:03.487Z", + "modified_date": "2019-12-06T20:06:03.487Z", + "file": "daaf0d5a-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac09610-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-06T20:05:01.781Z", + "modified_date": "2019-12-06T20:05:01.781Z", + "file": "dabd44b0-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "genome": "GRCh37", + "data_type": "fasta" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab4b67e-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:19.228Z", + "modified_date": "2019-10-24T00:23:19.228Z", + "file": "daaf32ee-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "genome": "GRCh38", + "data_type": "fasta" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "da9f9db6-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-09T23:34:12.902Z", + "modified_date": "2019-12-09T23:34:12.902Z", + "file": "dabd69fe-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa2b244-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2020-02-03T22:05:10.089Z", + "modified_date": "2020-02-03T22:05:10.089Z", + "file": "dabbf808-50ea-11ea-b9c7-ac1f6b453620", + "version": 2, + "metadata": { + "R": "R1", + "sex": "M", + "runId": "PITT_0390_1581878020", + "recipe": "WholeExomeSequencing", + "baitSet": "IDT_Exome_v1_FP_BAITS", + "piEmail": "", + "runDate": "2019-08-15", + "runMode": "HiSeq High Output", + "species": "Human", + "sampleId": "09670_D_1_1581878020", + "barcodeId": "IDT366", + "libraryId": null, + "patientId": "C-K2902H_1581878020", + "requestId": "09670_D_1581878020", + "flowCellId": "H7HCTBBXY", + "readLength": "101/8/101", + "sampleName": "C-K2902H-P001-d_1581878020", + "captureName": null, + "igocomplete": true, + "labHeadName": "John Smith", + "sampleClass": "Primary", + "barcodeIndex": "ACATACGG", + "labHeadEmail": "user@internet.com", + "oncoTreeCode": "DDLS", + "preservation": "Frozen", + "sampleOrigin": "Tissue", + "specimenType": "Biopsy", + "flowCellLanes": [ + 1, + 2, + 3, + 4, + 5, + 6 + ], + "libraryVolume": null, + "pooledNormals": null, + "tumorOrNormal": "Tumor", + "captureInputNg": null, + "collectionYear": "", + "tissueLocation": "", + "dataAnalystName": "", + "dataAnalystEmail": "", + "externalSampleId": "S16-68609_1581878020", + "investigatorName": "Bob Sagat", + "investigatorEmail": "user2@internet.com", + "projectManagerName": "Franklin, Rosalind", + "investigatorSampleId": "S16-68609_1581878020", + "captureConcentrationNm": null, + "libraryConcentrationNgul": 40.03237153464453 + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "da9fda88-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2020-02-03T22:05:10.065Z", + "modified_date": "2020-02-03T22:05:10.065Z", + "file": "daad7a4e-50ea-11ea-b9c7-ac1f6b453620", + "version": 2, + "metadata": { + "R": "R2", + "sex": "M", + "runId": "PITT_0390_1581878020", + "recipe": "WholeExomeSequencing", + "baitSet": "IDT_Exome_v1_FP_BAITS", + "piEmail": "", + "runDate": "2019-08-15", + "runMode": "HiSeq High Output", + "species": "Human", + "sampleId": "09670_D_1_1581878020", + "barcodeId": "IDT366", + "libraryId": "09670_D_1_1_1_1_1", + "patientId": "C-K2902H_1581878020", + "requestId": "09670_D_1581878020", + "flowCellId": "H7HCTBBXY", + "readLength": "101/8/101", + "sampleName": "C-K2902H-P001-d_1581878020", + "captureName": null, + "igocomplete": true, + "labHeadName": "John Smith", + "sampleClass": "Primary", + "barcodeIndex": "ACATACGG", + "labHeadEmail": "user@internet.com", + "oncoTreeCode": "DDLS", + "preservation": "Frozen", + "sampleOrigin": "Tissue", + "specimenType": "Biopsy", + "flowCellLanes": [ + 1, + 2, + 3, + 4, + 5, + 6 + ], + "libraryVolume": null, + "pooledNormals": null, + "tumorOrNormal": "Tumor", + "captureInputNg": null, + "collectionYear": "", + "tissueLocation": "", + "dataAnalystName": "", + "dataAnalystEmail": "", + "externalSampleId": "S16-68609_1581878020", + "investigatorName": "Bob Sagat", + "investigatorEmail": "user2@internet.com", + "projectManagerName": "Franklin, Rosalind", + "investigatorSampleId": "S16-68609_1581878020", + "captureConcentrationNm": null, + "libraryConcentrationNgul": 40.03237153464453 + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab28ed0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2020-02-03T22:05:10.135Z", + "modified_date": "2020-02-03T22:05:10.136Z", + "file": "dacc897a-50ea-11ea-b9c7-ac1f6b453620", + "version": 2, + "metadata": { + "R": "R1", + "sex": "M", + "runId": "PITT_0391_1581878020", + "recipe": "WholeExomeSequencing", + "baitSet": "IDT_Exome_v1_FP_BAITS", + "piEmail": "", + "runDate": "2019-08-19", + "runMode": "HiSeq High Output", + "species": "Human", + "sampleId": "09670_D_46_1581878020", + "barcodeId": null, + "libraryId": null, + "patientId": "C-K2902H_1581878020", + "requestId": "09670_D_1581878020", + "flowCellId": "H7FKJBBXY", + "readLength": "101/8/101", + "sampleName": "C-K2902H-N001-d_1581878020", + "captureName": null, + "igocomplete": true, + "labHeadName": "John Smith", + "sampleClass": "Normal", + "barcodeIndex": null, + "labHeadEmail": "user@internet.com", + "oncoTreeCode": null, + "preservation": "EDTA-Streck", + "sampleOrigin": "Whole Blood", + "specimenType": "Blood", + "flowCellLanes": [ + 5, + 6, + 7, + 8 + ], + "libraryVolume": null, + "pooledNormals": null, + "tumorOrNormal": "Normal", + "captureInputNg": null, + "collectionYear": "", + "tissueLocation": "", + "dataAnalystName": "", + "dataAnalystEmail": "", + "externalSampleId": "P-0017035-N01-WES_1581878020", + "investigatorName": "Bob Sagat", + "investigatorEmail": "user2@internet.com", + "projectManagerName": "Franklin, Rosalind", + "investigatorSampleId": "P-0017035-N01-WES_1581878020", + "captureConcentrationNm": null, + "libraryConcentrationNgul": 32.135796910139796 + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac3bf0c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2020-02-03T22:05:10.109Z", + "modified_date": "2020-02-03T22:05:10.109Z", + "file": "dab2170c-50ea-11ea-b9c7-ac1f6b453620", + "version": 2, + "metadata": { + "R": "R2", + "sex": "M", + "runId": "PITT_0391_1581878020", + "recipe": "WholeExomeSequencing", + "baitSet": "IDT_Exome_v1_FP_BAITS", + "piEmail": "", + "runDate": "2019-08-19", + "runMode": "HiSeq High Output", + "species": "Human", + "sampleId": "09670_D_46_1581878020", + "barcodeId": null, + "libraryId": "09670_D_46_1", + "patientId": "C-K2902H_1581878020", + "requestId": "09670_D_1581878020", + "flowCellId": "H7FKJBBXY", + "readLength": "101/8/101", + "sampleName": "C-K2902H-N001-d_1581878020", + "captureName": null, + "igocomplete": true, + "labHeadName": "John Smith", + "sampleClass": "Normal", + "barcodeIndex": null, + "labHeadEmail": "user@internet.com", + "oncoTreeCode": null, + "preservation": "EDTA-Streck", + "sampleOrigin": "Whole Blood", + "specimenType": "Blood", + "flowCellLanes": [ + 5, + 6, + 7, + 8 + ], + "libraryVolume": null, + "pooledNormals": null, + "tumorOrNormal": "Normal", + "captureInputNg": null, + "collectionYear": "", + "tissueLocation": "", + "dataAnalystName": "", + "dataAnalystEmail": "", + "externalSampleId": "P-0017035-N01-WES_1581878020", + "investigatorName": "Bob Sagat", + "investigatorEmail": "user2@internet.com", + "projectManagerName": "Franklin, Rosalind", + "investigatorSampleId": "P-0017035-N01-WES_1581878020", + "captureConcentrationNm": null, + "libraryConcentrationNgul": 32.135796910139796 + }, + "user": null + } + }, + { + "model": "file_system.file", + "pk": "dab424ca-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.368Z", + "modified_date": "2019-12-14T12:08:14.368Z", + "file_name": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.annotate-variants.1581878020.vcf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.annotate-variants.1581878020.vcf", + "file_type": 11, + "size": 65612975, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dacd0954-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.539Z", + "modified_date": "2019-12-14T12:08:13.539Z", + "file_name": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.muts.1581878020.maf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.muts.1581878020.maf", + "file_type": 24, + "size": 181310718, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daba66aa-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.575Z", + "modified_date": "2019-12-14T12:08:13.575Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 22899967017, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dab07dc0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.614Z", + "modified_date": "2019-12-14T12:08:13.614Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 14961505727, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daa90ff4-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.658Z", + "modified_date": "2019-12-14T12:08:13.658Z", + "file_name": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk000_cl.1581878020.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk000_cl.1581878020.stats", + "file_type": 21, + "size": 2641, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dac27a66-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.676Z", + "modified_date": "2019-12-14T12:08:13.676Z", + "file_name": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk001_cl.1581878020.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk001_cl.1581878020.stats", + "file_type": 21, + "size": 2611, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dab05854-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.695Z", + "modified_date": "2019-12-14T12:08:13.695Z", + "file_name": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk002_cl.1581878020.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk002_cl.1581878020.stats", + "file_type": 21, + "size": 2576, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daab79ba-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.713Z", + "modified_date": "2019-12-14T12:08:13.713Z", + "file_name": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk000_cl.1581878020.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk000_cl.1581878020.stats", + "file_type": 21, + "size": 2764, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daa9905a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.731Z", + "modified_date": "2019-12-14T12:08:13.731Z", + "file_name": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk001_cl.1581878020.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk001_cl.1581878020.stats", + "file_type": 21, + "size": 2714, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dabaafca-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.754Z", + "modified_date": "2019-12-14T12:08:13.754Z", + "file_name": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk000_cl.1581878020.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk000_cl.1581878020.stats", + "file_type": 21, + "size": 2818, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dab3444c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.778Z", + "modified_date": "2019-12-14T12:08:13.778Z", + "file_name": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk001_cl.1581878020.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk001_cl.1581878020.stats", + "file_type": 21, + "size": 2815, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dacfcb44-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.803Z", + "modified_date": "2019-12-14T12:08:13.803Z", + "file_name": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk002_cl.1581878020.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk002_cl.1581878020.stats", + "file_type": 21, + "size": 2775, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dacba802-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.820Z", + "modified_date": "2019-12-14T12:08:13.820Z", + "file_name": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk000_cl.1581878020.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk000_cl.1581878020.stats", + "file_type": 21, + "size": 2873, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dabed8d4-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.836Z", + "modified_date": "2019-12-14T12:08:13.836Z", + "file_name": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk001_cl.1581878020.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk001_cl.1581878020.stats", + "file_type": 21, + "size": 2826, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dab17ef0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.858Z", + "modified_date": "2019-12-14T12:08:13.858Z", + "file_name": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.1581878020.maf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.1581878020.maf", + "file_type": 24, + "size": 59073, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "da9eab36-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.880Z", + "modified_date": "2019-12-14T12:08:13.880Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.1581878020.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.1581878020.pdf", + "file_type": 21, + "size": 8189, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dab62496-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.896Z", + "modified_date": "2019-12-14T12:08:13.896Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.1581878020.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.1581878020.pdf", + "file_type": 21, + "size": 8219, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dac1cad0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.930Z", + "modified_date": "2019-12-14T12:08:13.930Z", + "file_name": "s_C_K2902H_P001_d.rg.md.1581878020.asmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.1581878020.asmetrics", + "file_type": 21, + "size": 2171, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dab8f3f6-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.947Z", + "modified_date": "2019-12-14T12:08:13.947Z", + "file_name": "s_C_K2902H_N001_d.rg.md.1581878020.asmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.1581878020.asmetrics", + "file_type": 21, + "size": 2134, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daacadd0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.969Z", + "modified_date": "2019-12-14T12:08:13.969Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.1581878020.out", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.1581878020.out", + "file_type": 21, + "size": 603, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daaa358c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.986Z", + "modified_date": "2019-12-14T12:08:13.986Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.1581878020.out", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.1581878020.out", + "file_type": 21, + "size": 602, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daae0d88-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.009Z", + "modified_date": "2019-12-14T12:08:14.009Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.CNCF.1581878020.png", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.CNCF.1581878020.png", + "file_type": 21, + "size": 124853, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daaaaf62-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.027Z", + "modified_date": "2019-12-14T12:08:14.027Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.CNCF.1581878020.png", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.CNCF.1581878020.png", + "file_type": 21, + "size": 111084, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dac746b8-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.050Z", + "modified_date": "2019-12-14T12:08:14.050Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.1581878020.seg", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.1581878020.seg", + "file_type": 21, + "size": 4777, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daaa865e-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.068Z", + "modified_date": "2019-12-14T12:08:14.068Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.1581878020.seg", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.1581878020.seg", + "file_type": 21, + "size": 3222, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dac63ac0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.092Z", + "modified_date": "2019-12-14T12:08:14.092Z", + "file_name": "s_C_K2902H_P001_d.rg.md.gcbias.1581878020.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.gcbias.1581878020.pdf", + "file_type": 21, + "size": 6784, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daa6f9b2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.108Z", + "modified_date": "2019-12-14T12:08:14.108Z", + "file_name": "s_C_K2902H_N001_d.rg.md.gcbias.1581878020.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.gcbias.1581878020.pdf", + "file_type": 21, + "size": 6794, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daa754ac-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.131Z", + "modified_date": "2019-12-14T12:08:14.131Z", + "file_name": "s_C_K2902H_P001_d.rg.md.1581878020.hsmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.1581878020.hsmetrics", + "file_type": 21, + "size": 5016, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dab9ac60-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.147Z", + "modified_date": "2019-12-14T12:08:14.147Z", + "file_name": "s_C_K2902H_N001_d.rg.md.1581878020.hsmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.1581878020.hsmetrics", + "file_type": 21, + "size": 5029, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dac340f4-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.168Z", + "modified_date": "2019-12-14T12:08:14.168Z", + "file_name": "s_C_K2902H_P001_d.rg.md.1581878020.ismetrics.1581878020.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.1581878020.ismetrics.1581878020.pdf", + "file_type": 21, + "size": 13994, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dacf7a18-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.183Z", + "modified_date": "2019-12-14T12:08:14.183Z", + "file_name": "s_C_K2902H_N001_d.rg.md.1581878020.ismetrics.1581878020.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.1581878020.ismetrics.1581878020.pdf", + "file_type": 21, + "size": 12712, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dab36a62-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.203Z", + "modified_date": "2019-12-14T12:08:14.203Z", + "file_name": "s_C_K2902H_P001_d.rg.1581878020.md_metrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.1581878020.md_metrics", + "file_type": 21, + "size": 2900, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daafe950-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.219Z", + "modified_date": "2019-12-14T12:08:14.219Z", + "file_name": "s_C_K2902H_N001_d.rg.1581878020.md_metrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.1581878020.md_metrics", + "file_type": 21, + "size": 2866, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dac43b26-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.242Z", + "modified_date": "2019-12-14T12:08:14.242Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.1581878020.vcf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.1581878020.vcf", + "file_type": 11, + "size": 24213327, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dac9a854-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.263Z", + "modified_date": "2019-12-14T12:08:14.263Z", + "file_name": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.1581878020.gz", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.1581878020.gz", + "file_type": 21, + "size": 13440159, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dab00e76-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.302Z", + "modified_date": "2019-12-14T12:08:14.302Z", + "file_name": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.1581878020.vcf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.1581878020.vcf", + "file_type": 11, + "size": 19739, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dac8e07c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.324Z", + "modified_date": "2019-12-14T12:08:14.324Z", + "file_name": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.portal.1581878020.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.portal.1581878020.txt", + "file_type": 10, + "size": 5795, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dab0c884-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.346Z", + "modified_date": "2019-12-14T12:08:14.346Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.1581878020.vcf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.1581878020.vcf", + "file_type": 11, + "size": 403491742, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daa9bb7a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.390Z", + "modified_date": "2019-12-14T12:08:14.390Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.1581878020.Rdata", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.1581878020.Rdata", + "file_type": 21, + "size": 8622126, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dab9d2c6-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.406Z", + "modified_date": "2019-12-14T12:08:14.406Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.1581878020.Rdata", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.1581878020.Rdata", + "file_type": 21, + "size": 8618530, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dab64a3e-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.428Z", + "modified_date": "2019-12-14T12:08:14.428Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.1581878020.quality_by_cycle_metrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.1581878020.quality_by_cycle_metrics", + "file_type": 21, + "size": 5494, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dac55a88-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.445Z", + "modified_date": "2019-12-14T12:08:14.445Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.1581878020.quality_by_cycle_metrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.1581878020.quality_by_cycle_metrics", + "file_type": 21, + "size": 5508, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dabc691e-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.466Z", + "modified_date": "2019-12-14T12:08:14.466Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads.dat.1581878020.gz", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads.dat.1581878020.gz", + "file_type": 21, + "size": 32693698, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dac6da70-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.488Z", + "modified_date": "2019-12-14T12:08:14.488Z", + "file_name": "s_C_K2902H_P001_d.rg.md_FP_base_counts.1581878020.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md_FP_base_counts.1581878020.txt", + "file_type": 10, + "size": 13779990, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dac8ab7a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.504Z", + "modified_date": "2019-12-14T12:08:14.504Z", + "file_name": "s_C_K2902H_N001_d.rg.md_FP_base_counts.1581878020.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md_FP_base_counts.1581878020.txt", + "file_type": 10, + "size": 13586169, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daa80ba4-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.527Z", + "modified_date": "2019-12-14T12:08:14.527Z", + "file_name": "s_C_K2902H_P001_d.rg.md.1581878020.gcbiasmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.1581878020.gcbiasmetrics", + "file_type": 21, + "size": 6648, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dacc01e4-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.544Z", + "modified_date": "2019-12-14T12:08:14.544Z", + "file_name": "s_C_K2902H_N001_d.rg.md.1581878020.gcbiasmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.1581878020.gcbiasmetrics", + "file_type": 21, + "size": 6632, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daa012b4-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.574Z", + "modified_date": "2019-12-14T12:08:14.575Z", + "file_name": "s_C_K2902H_P001_d.rg.md.gcbias.1581878020.summary", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.gcbias.1581878020.summary", + "file_type": 21, + "size": 1201, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dabc8eb2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.593Z", + "modified_date": "2019-12-14T12:08:14.593Z", + "file_name": "s_C_K2902H_N001_d.rg.md.gcbias.1581878020.summary", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.gcbias.1581878020.summary", + "file_type": 21, + "size": 1199, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daa43358-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.616Z", + "modified_date": "2019-12-14T12:08:14.616Z", + "file_name": "s_C_K2902H_P001_d.rg.md.1581878020.ismetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.1581878020.ismetrics", + "file_type": 21, + "size": 7754, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dacaf2a4-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.635Z", + "modified_date": "2019-12-14T12:08:14.635Z", + "file_name": "s_C_K2902H_N001_d.rg.md.1581878020.ismetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.1581878020.ismetrics", + "file_type": 21, + "size": 7041, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dab693e0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.658Z", + "modified_date": "2019-12-14T12:08:14.658Z", + "file_name": "s_C_K2902H_P001_d.rg.md.1581878020.pileup", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.1581878020.pileup", + "file_type": 21, + "size": 55203868, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daaba0de-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.675Z", + "modified_date": "2019-12-14T12:08:14.675Z", + "file_name": "s_C_K2902H_N001_d.rg.md.1581878020.pileup", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.1581878020.pileup", + "file_type": 21, + "size": 33915095, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dab9f8aa-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.697Z", + "modified_date": "2019-12-14T12:08:14.697Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.1581878020.gz", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.1581878020.gz", + "file_type": 21, + "size": 129554, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dabc1d38-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.738Z", + "modified_date": "2019-12-14T12:08:14.738Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.1581878020.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.1581878020.txt", + "file_type": 10, + "size": 172715192, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daa5298e-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.762Z", + "modified_date": "2019-12-14T12:08:14.762Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.1581878020.gz", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.1581878020.gz", + "file_type": 21, + "size": 13247144, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dabe2330-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.800Z", + "modified_date": "2019-12-14T12:08:14.800Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.cncf.1581878020.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.cncf.1581878020.txt", + "file_type": 10, + "size": 11388, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dacc5c48-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.822Z", + "modified_date": "2019-12-14T12:08:14.822Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.cncf.1581878020.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.cncf.1581878020.txt", + "file_type": 10, + "size": 7525, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daa587c6-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.844Z", + "modified_date": "2019-12-14T12:08:14.844Z", + "file_name": "s_C_K2902H_P001_d.rg.md.1581878020.hstmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.1581878020.hstmetrics", + "file_type": 21, + "size": 19302184, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dace0714-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.860Z", + "modified_date": "2019-12-14T12:08:14.860Z", + "file_name": "s_C_K2902H_N001_d.rg.md.1581878020.hstmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.1581878020.hstmetrics", + "file_type": 21, + "size": 19114455, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dabad4d2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.883Z", + "modified_date": "2019-12-14T12:08:14.883Z", + "file_name": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.1581878020.vcf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.1581878020.vcf", + "file_type": 11, + "size": 2741838, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.filemetadata", + "pk": "daac5fe2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.373Z", + "modified_date": "2019-12-14T12:08:14.373Z", + "file": "dab424ca-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dabd8fce-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.552Z", + "modified_date": "2019-12-14T12:08:13.552Z", + "file": "dacd0954-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab0343c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.580Z", + "modified_date": "2019-12-14T12:08:13.580Z", + "file": "daba66aa-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daabc7d0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.619Z", + "modified_date": "2019-12-14T12:08:13.619Z", + "file": "dab07dc0-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa8ba86-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.663Z", + "modified_date": "2019-12-14T12:08:13.663Z", + "file": "daa90ff4-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa5e824-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.681Z", + "modified_date": "2019-12-14T12:08:13.681Z", + "file": "dac27a66-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa2e70a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.700Z", + "modified_date": "2019-12-14T12:08:13.700Z", + "file": "dab05854-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac304c2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.718Z", + "modified_date": "2019-12-14T12:08:13.718Z", + "file": "daab79ba-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab44a4a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.736Z", + "modified_date": "2019-12-14T12:08:13.736Z", + "file": "daa9905a-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dabe4950-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.759Z", + "modified_date": "2019-12-14T12:08:13.759Z", + "file": "dabaafca-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab6fe66-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.785Z", + "modified_date": "2019-12-14T12:08:13.785Z", + "file": "dab3444c-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daba1eac-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.807Z", + "modified_date": "2019-12-14T12:08:13.807Z", + "file": "dacfcb44-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac2c6e2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.824Z", + "modified_date": "2019-12-14T12:08:13.824Z", + "file": "dacba802-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daacd576-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.841Z", + "modified_date": "2019-12-14T12:08:13.841Z", + "file": "dabed8d4-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab0a3fe-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.863Z", + "modified_date": "2019-12-14T12:08:13.863Z", + "file": "dab17ef0-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daba8c5c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.884Z", + "modified_date": "2019-12-14T12:08:13.884Z", + "file": "da9eab36-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab66fd2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.900Z", + "modified_date": "2019-12-14T12:08:13.900Z", + "file": "dab62496-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa6a106-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.935Z", + "modified_date": "2019-12-14T12:08:13.935Z", + "file": "dac1cad0-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dabbb05a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.952Z", + "modified_date": "2019-12-14T12:08:13.952Z", + "file": "dab8f3f6-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa89088-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.973Z", + "modified_date": "2019-12-14T12:08:13.973Z", + "file": "daacadd0-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "da9da8a8-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.991Z", + "modified_date": "2019-12-14T12:08:13.991Z", + "file": "daaa358c-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa04d4c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.014Z", + "modified_date": "2019-12-14T12:08:14.014Z", + "file": "daae0d88-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab4fe2c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.031Z", + "modified_date": "2019-12-14T12:08:14.032Z", + "file": "daaaaf62-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daab005c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.055Z", + "modified_date": "2019-12-14T12:08:14.055Z", + "file": "dac746b8-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac6a672-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.074Z", + "modified_date": "2019-12-14T12:08:14.074Z", + "file": "daaa865e-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab136de-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.097Z", + "modified_date": "2019-12-14T12:08:14.097Z", + "file": "dac63ac0-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab24588-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.113Z", + "modified_date": "2019-12-14T12:08:14.113Z", + "file": "daa6f9b2-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "da9ee8c6-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.135Z", + "modified_date": "2019-12-14T12:08:14.135Z", + "file": "daa754ac-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab2b338-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.152Z", + "modified_date": "2019-12-14T12:08:14.152Z", + "file": "dab9ac60-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa32972-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.172Z", + "modified_date": "2019-12-14T12:08:14.172Z", + "file": "dac340f4-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daae584c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.187Z", + "modified_date": "2019-12-14T12:08:14.187Z", + "file": "dacf7a18-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa616d2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.208Z", + "modified_date": "2019-12-14T12:08:14.208Z", + "file": "dab36a62-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dabcfdc0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.223Z", + "modified_date": "2019-12-14T12:08:14.223Z", + "file": "daafe950-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac4b132-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.246Z", + "modified_date": "2019-12-14T12:08:14.246Z", + "file": "dac43b26-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daabee4a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.268Z", + "modified_date": "2019-12-14T12:08:14.268Z", + "file": "dac9a854-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dabe9108-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.307Z", + "modified_date": "2019-12-14T12:08:14.307Z", + "file": "dab00e76-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa088c0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.329Z", + "modified_date": "2019-12-14T12:08:14.329Z", + "file": "dac8e07c-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab5906c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.351Z", + "modified_date": "2019-12-14T12:08:14.351Z", + "file": "dab0c884-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daca3a3a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.394Z", + "modified_date": "2019-12-14T12:08:14.394Z", + "file": "daa9bb7a-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daca6992-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.411Z", + "modified_date": "2019-12-14T12:08:14.411Z", + "file": "dab9d2c6-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac052c2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.432Z", + "modified_date": "2019-12-14T12:08:14.432Z", + "file": "dab64a3e-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daac1398-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.449Z", + "modified_date": "2019-12-14T12:08:14.449Z", + "file": "dac55a88-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa93aec-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.470Z", + "modified_date": "2019-12-14T12:08:14.470Z", + "file": "dabc691e-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac3fcec-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.492Z", + "modified_date": "2019-12-14T12:08:14.492Z", + "file": "dac6da70-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dacc3114-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.509Z", + "modified_date": "2019-12-14T12:08:14.509Z", + "file": "dac8ab7a-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dacf27ac-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.532Z", + "modified_date": "2019-12-14T12:08:14.532Z", + "file": "daa80ba4-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab52226-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.548Z", + "modified_date": "2019-12-14T12:08:14.548Z", + "file": "dacc01e4-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daae3434-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.580Z", + "modified_date": "2019-12-14T12:08:14.580Z", + "file": "daa012b4-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa72784-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.598Z", + "modified_date": "2019-12-14T12:08:14.598Z", + "file": "dabc8eb2-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dacac6bc-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.621Z", + "modified_date": "2019-12-14T12:08:14.621Z", + "file": "daa43358-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa64530-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.640Z", + "modified_date": "2019-12-14T12:08:14.640Z", + "file": "dacaf2a4-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "da9d0dd0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.663Z", + "modified_date": "2019-12-14T12:08:14.663Z", + "file": "dab693e0-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dabcda48-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.679Z", + "modified_date": "2019-12-14T12:08:14.679Z", + "file": "daaba0de-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab84190-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.702Z", + "modified_date": "2019-12-14T12:08:14.702Z", + "file": "dab9f8aa-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dabfba56-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.743Z", + "modified_date": "2019-12-14T12:08:14.743Z", + "file": "dabc1d38-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab40148-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.766Z", + "modified_date": "2019-12-14T12:08:14.766Z", + "file": "daa5298e-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dacb5046-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.805Z", + "modified_date": "2019-12-14T12:08:14.805Z", + "file": "dabe2330-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac6067c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.827Z", + "modified_date": "2019-12-14T12:08:14.827Z", + "file": "dacc5c48-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dacb7c06-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.848Z", + "modified_date": "2019-12-14T12:08:14.848Z", + "file": "daa587c6-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac77fca-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.865Z", + "modified_date": "2019-12-14T12:08:14.865Z", + "file": "dace0714-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac00dd0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.887Z", + "modified_date": "2019-12-14T12:08:14.887Z", + "file": "dabad4d2-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + } +] diff --git a/fixtures/tests/juno_roslin_demo2.pipeline_input.json b/fixtures/tests/juno_roslin_demo2.pipeline_input.json index bec1a85bd..6c61f7e56 100644 --- a/fixtures/tests/juno_roslin_demo2.pipeline_input.json +++ b/fixtures/tests/juno_roslin_demo2.pipeline_input.json @@ -310,10 +310,16 @@ "PU": [ ], "R1": [ - "/juno/work/ci/roslin-pipelines/variant/2.6.0/workspace/test_data/examples/data/fastq/DU874145-T/DU874145-T_IGO_00000_TEST_L001_R1_001.fastq.gz" + { + "class": "File", + "location": "juno:///juno/work/ci/roslin-pipelines/variant/2.6.0/workspace/test_data/examples/data/fastq/DU874145-T/DU874145-T_IGO_00000_TEST_L001_R1_001.fastq.gz" + } ], "R2": [ - "/juno/work/ci/roslin-pipelines/variant/2.6.0/workspace/test_data/examples/data/fastq/DU874145-T/DU874145-T_IGO_00000_TEST_L001_R2_001.fastq.gz" + { + "class": "File", + "location": "juno:///juno/work/ci/roslin-pipelines/variant/2.6.0/workspace/test_data/examples/data/fastq/DU874145-T/DU874145-T_IGO_00000_TEST_L001_R2_001.fastq.gz" + } ], "bam": [], "zR1": [], @@ -332,10 +338,16 @@ "PU": [ ], "R1": [ - "/juno/work/ci/roslin-pipelines/variant/2.6.0/workspace/test_data/examples/data/fastq/DU874145-N/DU874145-N_IGO_00000_TEST_L001_R1_001.fastq.gz" + { + "class": "File", + "location": "juno:///juno/work/ci/roslin-pipelines/variant/2.6.0/workspace/test_data/examples/data/fastq/DU874145-N/DU874145-N_IGO_00000_TEST_L001_R1_001.fastq.gz" + } ], "R2": [ - "/juno/work/ci/roslin-pipelines/variant/2.6.0/workspace/test_data/examples/data/fastq/DU874145-N/DU874145-N_IGO_00000_TEST_L001_R2_001.fastq.gz" + { + "class": "File", + "location": "juno:///juno/work/ci/roslin-pipelines/variant/2.6.0/workspace/test_data/examples/data/fastq/DU874145-N/DU874145-N_IGO_00000_TEST_L001_R2_001.fastq.gz" + } ], "bam": [], "zR1": [], diff --git a/runner/fixtures/runner.pipeline.json b/runner/fixtures/runner.pipeline.json index 636085329..f19db9933 100644 --- a/runner/fixtures/runner.pipeline.json +++ b/runner/fixtures/runner.pipeline.json @@ -55,5 +55,19 @@ "output_file_group": "a66f03b4-ce43-40d0-9134-d5a3575cabae", "output_directory": "/juno/work/pi/beagle/output/flatbush" } + }, + { + "model": "runner.pipeline", + "pk": "9b7f2ac8-03a5-4c44-ae87-1d9f6500d19a", + "fields": { + "created_date": "2019-11-18T17:46:45.118Z", + "modified_date": "2019-12-05T01:12:39.854Z", + "name": "roslin-qc", + "github": "https://github.com/mskcc/roslin-cwl", + "version": "1.0.0-rc5", + "entrypoint": "modules/project/generate-qc.cwl", + "output_file_group": "a975f490-1b02-4575-abae-a4f8e3667733", + "output_directory": "/juno/work/pi/beagle/output/roslin-qc" + } } ] diff --git a/runner/operator/operator_factory.py b/runner/operator/operator_factory.py index 9bfe697bd..10f71f3b5 100644 --- a/runner/operator/operator_factory.py +++ b/runner/operator/operator_factory.py @@ -1,7 +1,7 @@ from .tempo_operator import TempoOperator from .roslin_operator import RoslinOperator from .access_operator import AccessOperator - +from .roslin_qc_operator import RoslinQcOperator class OperatorFactory(object): @@ -9,6 +9,7 @@ class OperatorFactory(object): "TempoOperator": TempoOperator, "RoslinOperator": RoslinOperator, "AccessOperator": AccessOperator, + "RoslinQcOperator": RoslinQcOperator } def get_by_model(model, **kwargs): diff --git a/runner/operator/roslin_operator/roslin_operator.py b/runner/operator/roslin_operator/roslin_operator.py index 470685733..ae433e8a4 100644 --- a/runner/operator/roslin_operator/roslin_operator.py +++ b/runner/operator/roslin_operator/roslin_operator.py @@ -6,7 +6,6 @@ from .bin.pair_request import compile_pairs from .bin.make_sample import build_sample - class RoslinOperator(Operator): def get_jobs(self): files = self.files.filter(filemetadata__metadata__requestId=self.request_id, filemetadata__metadata__igocomplete=True).all() @@ -43,11 +42,18 @@ def get_jobs(self): assay = job['assay'] pi = job['pi'] pi_email = job['pi_email'] - roslin_jobs.append((APIRunCreateSerializer( - data={'app': self.get_pipeline_id(), 'inputs': roslin_inputs, 'name': name, - 'tags': {'requestId': self.request_id, - 'sampleNameTumor': tumor_sample_name, - 'sampleNameNormal': normal_sample_name, - 'labHeadName': pi, - 'labHeadEmail': pi_email}}), job)) + data = { + 'app': self.get_pipeline_id(), + 'inputs': roslin_inputs, + 'name': name, + 'tags': { + 'requestId': self.request_id, + 'sampleNameTumor': tumor_sample_name, + 'sampleNameNormal': normal_sample_name, + 'labHeadName': pi, + 'labHeadEmail': pi_email + } + } + run = APIRunCreateSerializer(data = data) + roslin_jobs.append((run, job)) return roslin_jobs diff --git a/runner/operator/roslin_qc_operator/__init__.py b/runner/operator/roslin_qc_operator/__init__.py new file mode 100644 index 000000000..0941c50e5 --- /dev/null +++ b/runner/operator/roslin_qc_operator/__init__.py @@ -0,0 +1 @@ +from .roslin_qc_operator import RoslinQcOperator diff --git a/runner/operator/roslin_qc_operator/bin/__init__.py b/runner/operator/roslin_qc_operator/bin/__init__.py new file mode 100644 index 000000000..e69de29bb diff --git a/runner/operator/roslin_qc_operator/bin/input.py b/runner/operator/roslin_qc_operator/bin/input.py new file mode 100644 index 000000000..e50f4c44e --- /dev/null +++ b/runner/operator/roslin_qc_operator/bin/input.py @@ -0,0 +1,395 @@ +""" +Module for generating input dataset for use with Roslin QC operator + +Example input datastructure format: + +db_files: + fp_genotypes: db_files['value']['fp_genotypes'] + hotspot_list_maf: db_files['value']['hotspot_list_maf'] + conpair_markers: db_files['value']['conpair_markers'] +runparams: + project_prefix: runparams['value']['project_prefix'] + genome: runparams['value']['genome'] + scripts_bin: runparams['value']['scripts_bin'] + assay: ---MISSING--- + pi: ---MISSING--- + pi_email: ---MISSING--- +ref_fasta: ref_fasta +clstats1: [clstats1] +clstats2: [clstats2] +md_metrics: [md_metrics] +hs_metrics: [hs_metrics] +insert_metrics: [insert_metrics] +per_target_coverage: [per_target_coverage] +qual_metrics: [qual_metrics] +doc_basecounts: [doc_basecounts] +conpair_pileups: [conpair_pileups] +pairs: [pair] +""" +import json +import urllib +from file_system.models import FileMetadata, File +from runner.models import Port +import urllib.parse + +def build_sample(filemetadata_instance, company_name = "MSKCC", platform = "Illumina"): + """ + Create base Roslin CWL sample datastructure from the FileMetadata + """ + sample = {} + sample['CN'] = company_name + sample['PL'] = platform + sample['PU'] = filemetadata_instance.metadata['flowCellId'] + sample['LB'] = filemetadata_instance.metadata['libraryId'] + sample['tumor_type'] = filemetadata_instance.metadata['tumorOrNormal'] + sample['ID'] = '_'.join([filemetadata_instance.metadata['sampleName'], filemetadata_instance.metadata['flowCellId']]) + sample['SM'] = filemetadata_instance.metadata['sampleName'] + sample['species'] = filemetadata_instance.metadata['species'] + sample['patient_id'] = filemetadata_instance.metadata['patientId'] + sample['bait_set'] = filemetadata_instance.metadata['baitSet'] + sample['igo_id'] = filemetadata_instance.metadata['sampleId'] + sample['run_date'] = filemetadata_instance.metadata['runDate'] + sample['specimen_type'] = filemetadata_instance.metadata['specimenType'] + sample['request_id'] = filemetadata_instance.metadata['requestId'] + return(sample) + +def file_to_cwl(file_instance): + """ + Convert a Beagle File instance into a dict in CWL File format dict + + example: + {'class': 'File', 'path': '/path/to/foo.txt'} + """ + d = { + 'class': 'File', + 'path': file_instance.path + } + return(d) + +def file_to_job_data(file_instance): + """ + Convert a Beagle File instance into a dict that will be used in the Job submitted to Beagle + NOTE: this is not the same as the CWL output format + + example: + {'class': 'File', 'location': 'juno://path/to/foo.txt'} + """ + d = { + 'class': 'File', + 'location': 'juno://%s' % file_instance.path + } + return(d) + +def path_to_cwl(filepath): + """ + Convert a filepath string into a CWL File format dict + """ + d = { + 'class': 'File', + 'path': filepath + } + return(d) + +def path_to_job_data(filepath): + """ + Convert a filepath to a string representation for Job submission data` + NOTE: not the same format as CWL representation + """ + d = { + 'class': 'File', + 'location': 'juno://%s' % filepath + } + return(d) + +def get_assay_from_run(run_instance): + """ + Return the assay from a Run instance + This is a hold-over method until Run instance db model gets updated; update this later + """ + return(run_instance.output_metadata['assay']) + +def create_files_data_from_ports_with_names(ports): + """ + Retrieve the File entries for each Port entry, while keeping the associated Port.name attribute + """ + # list of dicts for File and 'name' + # TODO: use a Django query instead of iteration + files = [] + for port in ports: + # arbitrary ordering to force a test-able output + for file in port.files.all().order_by('path'): + file_cwl = file_to_job_data(file) + d = { 'name': port.name, 'file': file_cwl } + files.append(d) + return(files) + +def parse_pairs_from_ports(ports_queryset): + """ + Search the set of Ports for "pair" entries and format them into a list of tumor normal pair entries + """ + pair_ports = ports_queryset.filter(name = "pair") + pairs = [] + + # get the tumor and normal R1 and R2 items from FileMetadata assocaited with File's associated with each Port + all_pair_items = [] + for port in pair_ports: + pair_items = [] + # all the Files assocaited with a Port + files = port.files.all() + for file in files: + # get the highest 'version' number FileMetadata instance for the File + filemetata_instance = FileMetadata.objects.filter(file = file).order_by('-version').first() + R1_or_R2 = filemetata_instance.metadata['R'] + tumor_or_normal = filemetata_instance.metadata['tumorOrNormal'] + pair_items.append( {'filemetadata': filemetata_instance, 'R1_or_R2': R1_or_R2, 'tumor_or_normal': tumor_or_normal } ) + all_pair_items.append(pair_items) + + # parse the entries into a sensible mapping of tumor and normal R1 and R2 + for pair_items in all_pair_items: + pair_set = {} + pair_set['tumor'] = {} + pair_set['normal'] = {} + # TODO: how to handle case where wrong number of items are associated? Should be 1 of each tumor/normal + R1/R2 + for item in pair_items: + if item['tumor_or_normal'] == 'Tumor' and item['R1_or_R2'] == 'R1': + pair_set['tumor']['R1'] = item['filemetadata'] + elif item['tumor_or_normal'] == 'Tumor' and item['R1_or_R2'] == 'R2': + pair_set['tumor']['R2'] = item['filemetadata'] + elif item['tumor_or_normal'] == 'Normal' and item['R1_or_R2'] == 'R1': + pair_set['normal']['R1'] = item['filemetadata'] + elif item['tumor_or_normal'] == 'Normal' and item['R1_or_R2'] == 'R2': + pair_set['normal']['R2'] = item['filemetadata'] + pairs.append(pair_set) + return(pairs) + +def parse_bams_from_ports(ports_queryset): + """ + Search a set of Ports for the 'bams' entries and format them into a list of tumor normal pair entries + """ + bam_ports = ports_queryset.filter(name = "bams") + bams = [] + for bam in bam_ports: + # get the Beagle database id for each bam file out of the `db_value` field` + # TODO: need to refactor this to get it from the Port.files association; right now that association lacks the tumor/normal information needed to know which bam is which + files_data = bam.db_value + tumor_bam_data = files_data[0] + tumor_bam_bid = urllib.parse.urlsplit(tumor_bam_data['location']).netloc + tumor_bam_file_instance = File.objects.get(id = tumor_bam_bid) + normal_bam_data = files_data[1] + normal_bam_bid = urllib.parse.urlsplit(normal_bam_data['location']).netloc + normal_bam_file_instance = File.objects.get(id = normal_bam_bid) + bams.append([tumor_bam_file_instance, normal_bam_file_instance]) + return(bams) + +def pair_to_cwl(pair): + """ + Convert a single tumor normal pair dict to CWL format datastructure + + pair = { + 'normal': { + 'R1': FileMetadata, + 'R2': FileMetadata + }, + 'tumor': { + 'R1': FileMetadata, + 'R2': FileMetadata + } + """ + # get the base datastructure dict for each R1 and R2 + normal_r1 = build_sample(pair['normal']['R1']) + normal_r2 = build_sample(pair['normal']['R2']) + tumor_r1 = build_sample(pair['tumor']['R1']) + tumor_r2 = build_sample(pair['tumor']['R2']) + + # merge the dict's; the second dict will overwrite args from the first + normal = {**normal_r1, **normal_r2} + normal['R1'] = file_to_cwl(pair['normal']['R1'].file) + normal['R2'] = file_to_cwl(pair['normal']['R2'].file) + + tumor = {**tumor_r1, **tumor_r2} + tumor['R1'] = file_to_cwl(pair['tumor']['R1'].file) + tumor['R2'] = file_to_cwl(pair['tumor']['R2'].file) + + output = (tumor, normal) + return(output) + +def pair_to_job_data(pair): + """ + Convert a single tumor normal pair dict to Job submission data format + NOTE: not the same as CWL format + + pair = { + 'normal': { + 'R1': FileMetadata, + 'R2': FileMetadata + }, + 'tumor': { + 'R1': FileMetadata, + 'R2': FileMetadata + } + """ + # get the base datastructure dict for each R1 and R2 + normal_r1 = build_sample(pair['normal']['R1']) + normal_r2 = build_sample(pair['normal']['R2']) + tumor_r1 = build_sample(pair['tumor']['R1']) + tumor_r2 = build_sample(pair['tumor']['R2']) + + # merge the dict's; the second dict will overwrite args from the first + normal = {**normal_r1, **normal_r2} + normal['R1'] = file_to_job_data(pair['normal']['R1'].file) + normal['R2'] = file_to_job_data(pair['normal']['R2'].file) + + tumor = {**tumor_r1, **tumor_r2} + tumor['R1'] = file_to_job_data(pair['tumor']['R1'].file) + tumor['R2'] = file_to_job_data(pair['tumor']['R2'].file) + + output = (tumor, normal) + return(output) + +def bams_to_cwl(bams): + """ + Convert the items in the bams list to CWL format + + bams = [ [File.objects.get(file_name = 's_C_K2902H_P001_d.rg.md.abra.printreads.bam'), File.objects.get(file_name = 's_C_K2902H_N001_d.rg.md.abra.printreads.bam')], ... ] + """ + bam_cwls = [] + for item in bams: + tumor_bam = item[0] + normal_bam = item[1] + tumor_bam_cwl = file_to_job_data(tumor_bam) + normal_bam_cwl = file_to_job_data(normal_bam) + bam_cwls.append([tumor_bam_cwl, normal_bam_cwl]) + return(bam_cwls) + +def parse_runparams_from_ports(ports_queryset): + """ + Get the runparams from a Port queryset + """ + # TODO: how to ensure the correct number of Port items? Should be 1 + param_port = ports_queryset.filter(name = "runparams").first() + runparams = {} + runparams['project_prefix'] = param_port.value['project_prefix'][0] # NOTE: comes in as array but need single string + runparams['genome'] = param_port.value['genome'] + runparams['scripts_bin'] = param_port.value['scripts_bin'] + + # TODO: find a way to handle + runparams['pi'] = "NA" + runparams['pi_email'] = "NA" + return(runparams) + +def get_db_files(assay, references_json = "runner/operator/roslin_operator/reference_jsons/roslin_resources.json"): + """ + Return a dict with the required reference file paths + """ + references = json.load(open(references_json)) + db_files = {} + db_files['fp_genotypes'] = references["targets"][assay]['FP_genotypes'] + db_files['hotspot_list_maf'] = references["request_files"]['hotspot_list_maf'] + db_files['conpair_markers'] = references["request_files"]['conpair_markers'] + db_files['ref_fasta'] = references["request_files"]['ref_fasta'] + + # need to resolve some items to URI's + for key in ['fp_genotypes', 'hotspot_list_maf', 'ref_fasta']: + value = db_files[key] + if value.startswith('juno:///'): + parts = urllib.parse.urlsplit(value) + db_files[key] = path_to_job_data(parts.path) + elif value.startswith('/'): + db_files[key] = path_to_job_data(db_files[key]) + # TODO: do these need to be changed?? + + # check for URI ref_fasta; 'juno:///juno/work/ci/resources/genomes/GRCh37/fasta/b37.fasta' + # for key, value in db_files.items(): + # if value.startswith('juno:///'): + # pass + # # parts = urllib.parse.urlsplit(value) + # # db_files[key] = path_to_cwl(parts.path) + # elif value.startswith('/'): + # db_files[key] = path_to_job_data(value) + # TODO: what to do if its not either of these cases? + + return(db_files) + +def parse_outputs_files_data(files_data): + """ + Generate an input dataset from a list of dicts of File objects and their associated Port.name value + Uses items that came from a pipeline output + + files_data = [{ 'name': Port.name, 'file': {'class': 'File', 'path': '/path/to/foo.txt'} }, ... ] + """ + # initialize the output data to use for starting QC pipeline + qc_input = {} + qc_input['clstats1'] = [] + qc_input['clstats2'] = [] + qc_input['md_metrics'] = [] + qc_input['hs_metrics'] = [] + qc_input['insert_metrics'] = [] + qc_input['per_target_coverage'] = [] + qc_input['qual_metrics'] = [] + qc_input['doc_basecounts'] = [] + qc_input['conpair_pileups'] = [] + + for item in files_data: + item_type = item['name'] + file_data = item['file'] + + # append values for known keys + # TODO: do we need to enforce unique-ness here? Do we need to enfore unique on file basename as well? + if item_type in qc_input: + if file_data not in qc_input[item_type]: + qc_input[item_type].append(file_data) + return(qc_input) + +def build_inputs_from_runs(run_queryset, _assay = None): + """ + Build the Roslin QC pipeline inputs data structure from a set of Roslin Voyager pipeline Run instances + """ + # get the input and output Ports of the run + ports = Port.objects.filter(run__in = run_queryset).order_by('created_date') # arbitrary ordering to force a test-able output + + # get the list of tumor normal pairs out of the Ports + pairs = parse_pairs_from_ports(ports) + + # convert the pairs to CWL format datastructure + pairs_cwl = [] + for pair_set in pairs: + pair_cwl = pair_to_cwl(pair_set) + pairs_cwl.append(pair_cwl) + + # get the File entries while keeping Port.name; needed for later parsing + files_data = create_files_data_from_ports_with_names(ports) + input_files = parse_outputs_files_data(files_data) + + # need to get the assay type so that we can get the correct reference files later + # TODO: how to handle multiple runs? just use the first one for now... + if _assay == None: + assay = get_assay_from_run(run_queryset.first()) + else: + assay = str(_assay) + + # find the Port with 'runparams' needed for QC input + runparams = parse_runparams_from_ports(ports) + runparams['assay'] = assay + + # get the correct reference files based on assay type + db_files = get_db_files(assay) + ref_fasta = db_files.pop('ref_fasta') + + # get the .bam files needed for QC input + bams = parse_bams_from_ports(ports) + + # convert to CWL output format + bams_cwl = bams_to_cwl(bams) + + # build the final data dict for QC input + qc_input = {} + qc_input['db_files'] = db_files + qc_input['runparams'] = runparams + qc_input['pairs'] = pairs_cwl + qc_input['ref_fasta'] = ref_fasta + qc_input['bams'] = bams_cwl + qc_input['directories'] = [] + qc_input['files'] = [] + qc_input = {**qc_input, **input_files} + + return(qc_input) diff --git a/runner/operator/roslin_qc_operator/roslin_qc_operator.py b/runner/operator/roslin_qc_operator/roslin_qc_operator.py new file mode 100644 index 000000000..32ee2fbf8 --- /dev/null +++ b/runner/operator/roslin_qc_operator/roslin_qc_operator.py @@ -0,0 +1,81 @@ +from runner.operator.operator import Operator +from runner.models import Run, Pipeline, Run, RunStatus +from runner.serializers import APIRunCreateSerializer +from .bin import input +import datetime + +class InvalidPipelineError(Exception): + pass + +class RoslinQcOperator(Operator): + """ + Operator for Roslin QC pipeline + """ + + def __init__(self, model, request_id = None, run_ids = None): + self.run_ids = run_ids + self.runs = None + if self.run_ids != None: + self.runs = Run.objects.filter(id__in = self.run_ids) + # TODO: add support for things like FileMetadata's + # TODO: add support for multiple request ids + + Operator.__init__(self, model, request_id = request_id, run_ids = run_ids) + + def get_pipeline_id(self): + return "9b7f2ac8-03a5-4c44-ae87-1d9f6500d19a" + + def get_input_data(self): + """ + Build up the data to use for input to QC pipeline + Needs to match the datastructure expected by the CWL pipeline input + + TODO: fill this in with handling of more types of input criteria; runs, requests, FileMetadata's, etc + """ + input_data = {} + if self.runs != None: + input_data = input.build_inputs_from_runs(self.runs) + # TODO: add methods here to add data from other items like requests, FileMetadata, etc + return(input_data) + + def get_output_metadata(self): + """ + Implement methods here to generate output metadata values that might need to be passed + """ + return({}) + + def get_data_for_serializer(self, input_data, output_metadata, create_date = None, name = None, tags = None, pipeline_id = None): + """ + Put together the data that will be sent to the serializer for run creation + """ + if create_date == None: + create_date = datetime.datetime.now().strftime("%m/%d/%Y, %H:%M:%S") + + if name == None: + name = "Roslin QC {create_date}".format(create_date = create_date) + + if tags == None: + tags = {} + if self.request_id: + tags['request_id'] = self.request_id + if self.run_ids: + tags['run_ids'] = self.run_ids + + if pipeline_id == None: + pipeline_id = self.get_pipeline_id() + + serializer_data = { + 'app': pipeline_id, + 'inputs': input_data, + 'name': name, + 'tags': tags, + 'output_metadata': output_metadata + } + return(serializer_data) + + def get_jobs(self): + input_data = self.get_input_data() + output_metadata = self.get_output_metadata() + serializer_data = self.get_data_for_serializer(input_data, output_metadata) + run = APIRunCreateSerializer(data = serializer_data) + return([(run, input_data)]) diff --git a/runner/tests/operator/roslin_qc_operator/__init__.py b/runner/tests/operator/roslin_qc_operator/__init__.py new file mode 100644 index 000000000..e69de29bb diff --git a/runner/tests/operator/roslin_qc_operator/test_input.py b/runner/tests/operator/roslin_qc_operator/test_input.py new file mode 100644 index 000000000..b5ac3f0ec --- /dev/null +++ b/runner/tests/operator/roslin_qc_operator/test_input.py @@ -0,0 +1,401 @@ +""" +Tests for Roslin QC input parsing methods +""" +import os +import json +from uuid import UUID +from django.test import TestCase +from django.conf import settings +from django.core.management import call_command +from file_system.models import File, FileMetadata, FileGroup +from runner.models import Run, Port, PortType +from runner.operator.roslin_qc_operator.bin.input import parse_outputs_files_data +from runner.operator.roslin_qc_operator.bin.input import parse_pairs_from_ports +from runner.operator.roslin_qc_operator.bin.input import parse_runparams_from_ports +from runner.operator.roslin_qc_operator.bin.input import get_db_files +from runner.operator.roslin_qc_operator.bin.input import get_assay_from_run +from runner.operator.roslin_qc_operator.bin.input import build_inputs_from_runs +from runner.operator.roslin_qc_operator.bin.input import file_to_cwl +from runner.operator.roslin_qc_operator.bin.input import path_to_cwl +from runner.operator.roslin_qc_operator.bin.input import path_to_job_data +from runner.operator.roslin_qc_operator.bin.input import build_sample +from runner.operator.roslin_qc_operator.bin.input import pair_to_cwl +from runner.operator.roslin_qc_operator.bin.input import parse_bams_from_ports +from runner.operator.roslin_qc_operator.bin.input import file_to_job_data +from runner.operator.roslin_qc_operator.bin.input import pair_to_job_data + +class TestInput(TestCase): + fixtures = [ + "file_system.filegroup.json", + "file_system.filetype.json", + "file_system.storage.json", + "runner.pipeline.json", + "beagle_etl.operator.json" + ] + + def test_true(self): + self.assertTrue(True) + + def test_validate_fixtures1(self): + """ + Check the validity of the fixtures for use with testing for this module to make sure it matches expected criteria + Using saved Roslin pipeline output dataset + """ + # start with empty db + self.assertTrue(len(Run.objects.all()) == 0) + self.assertTrue(len(Port.objects.all()) == 0) + self.assertTrue(len(File.objects.all()) == 0) + self.assertTrue(len(FileMetadata.objects.all()) == 0) + + # load test pipeline Run output fixtures + test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") + call_command('loaddata', test_files_fixture, verbosity=0) + + # make sure fixtures match expected criteria + self.assertTrue(len(Run.objects.all()) == 1) + self.assertTrue(len(Port.objects.all()) == 47) + self.assertTrue(len(File.objects.all()) == 121) + self.assertTrue(len(FileMetadata.objects.all()) == 121) + + # make sure expected number of inputs and outputs exist + run_instance = Run.objects.first() + self.assertEqual(len(run_instance.port_set.filter(port_type=PortType.INPUT)), 12) + self.assertEqual(len(run_instance.port_set.filter(port_type=PortType.OUTPUT)), 35) + + def test_file_to_cwl1(self): + """ + Test conversion of a File instance to an equivalent CWL entry + + """ + file_instance = File.objects.create( + file_group = FileGroup.objects.first(), + path = "/path/to/foo.txt") + file_cwl = file_to_cwl(file_instance) + expected_file_cwl = {'class': 'File', 'path': '/path/to/foo.txt'} + self.assertEqual(file_cwl, expected_file_cwl) + + job_data = file_to_job_data(file_instance) + expected_job_data = {'class': 'File', 'location': 'juno:///path/to/foo.txt'} + self.assertEqual(job_data, expected_job_data) + + def test_path_to_cwl1(self): + """ + Test conversion of a string based file path into CWL File format dict + """ + file_cwl = path_to_cwl('/path/to/foo.txt') + expected_file_cwl = {'class': 'File', 'path': '/path/to/foo.txt'} + self.assertEqual(file_cwl, expected_file_cwl) + + job_data = path_to_job_data('/path/to/foo.txt') + expected_job_data = {'class': 'File', 'location': 'juno:///path/to/foo.txt'} + self.assertEqual(job_data, expected_job_data) + + def test_get_assay_from_run1(self): + """ + Test that correct assay is returned from fixture + This behavior is likely to change in the future + """ + # load test pipeline Run output fixtures + test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") + call_command('loaddata', test_files_fixture, verbosity=0) + run_instance = Run.objects.first() + assay = get_assay_from_run(run_instance) + self.assertEqual(assay, 'IDT_Exome_v1_FP_b37') + + def test_build_sample1(self): + """ + Test building of the base dict datastructure to be used later in Roslin CWL output + """ + test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") + call_command('loaddata', test_files_fixture, verbosity=0) + file_instance = File.objects.get(file_name = 'P-0017035-N01-WES_IGO_09670_D_46_S12_R2_001.fastq.gz') + filemetadata_instance = FileMetadata.objects.filter(file = file_instance).order_by('-version').first() + sample = build_sample(filemetadata_instance = filemetadata_instance) + expected_sample = {'CN': 'MSKCC', + 'ID': 'C-K2902H-N001-d_H7FKJBBXY', + 'LB': '09670_D_46_1', + 'PL': 'Illumina', + 'PU': 'H7FKJBBXY', + 'SM': 'C-K2902H-N001-d', + 'bait_set': 'IDT_Exome_v1_FP_BAITS', + 'igo_id': '09670_D_46', + 'patient_id': 'C-K2902H', + 'request_id': '09670_D', + 'run_date': '2019-08-19', + 'species': 'Human', + 'specimen_type': 'Blood', + 'tumor_type': 'Normal'} + self.assertEqual(sample, expected_sample) + + def test_parse_pairs_from_ports1(self): + """ + Test that pairs are properly constructed from Port objects + """ + test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") + call_command('loaddata', test_files_fixture, verbosity=0) + run_instance = Run.objects.first() + ports = run_instance.port_set.all() + pairs = parse_pairs_from_ports(ports) + + tumor_R2 = FileMetadata.objects.get(file = File.objects.get(file_name = "S16-68609_IGO_09670_D_1_S11_R2_001.fastq.gz")) + turmor_R1 = FileMetadata.objects.get(file = File.objects.get(file_name = "S16-68609_IGO_09670_D_1_S11_R1_001.fastq.gz")) + normal_R2 = FileMetadata.objects.get(file = File.objects.get(file_name = "P-0017035-N01-WES_IGO_09670_D_46_S12_R2_001.fastq.gz")) + normal_R1 = FileMetadata.objects.get(file = File.objects.get(file_name = "P-0017035-N01-WES_IGO_09670_D_46_S12_R1_001.fastq.gz")) + + expected_pairs = [{ + 'normal': { + 'R1': normal_R1, + 'R2': normal_R2 + }, + 'tumor': { + 'R1': turmor_R1, + 'R2': tumor_R2 + } + }] + self.assertEqual(pairs, expected_pairs) + + def test_parse_bams_from_ports1(self): + """ + Test that the 'bams' entries are constructed correctly from the Port objects + """ + test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") + call_command('loaddata', test_files_fixture, verbosity=0) + run_instance = Run.objects.first() + ports = run_instance.port_set.all() + bams = parse_bams_from_ports(ports) + expected_bams = [[ + File.objects.get(file_name = 's_C_K2902H_P001_d.rg.md.abra.printreads.bam'), + File.objects.get(file_name = 's_C_K2902H_N001_d.rg.md.abra.printreads.bam') + ]] + self.assertEqual(bams, expected_bams) # TODO: need to figure out how this will be handled; need the sample metadata associated with .bam files + + def test_pair_to_cwl1(self): + """ + Test conversion of single pair to base CWL datastructure format + """ + test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") + call_command('loaddata', test_files_fixture, verbosity=0) + pair = { + 'normal': { + 'R1': FileMetadata.objects.get(file = File.objects.get(file_name = "P-0017035-N01-WES_IGO_09670_D_46_S12_R1_001.fastq.gz")), + 'R2': FileMetadata.objects.get(file = File.objects.get(file_name = "P-0017035-N01-WES_IGO_09670_D_46_S12_R2_001.fastq.gz")) + }, + 'tumor': { + 'R1': FileMetadata.objects.get(file = File.objects.get(file_name = "S16-68609_IGO_09670_D_1_S11_R1_001.fastq.gz")), + 'R2': FileMetadata.objects.get(file = File.objects.get(file_name = "S16-68609_IGO_09670_D_1_S11_R2_001.fastq.gz")) + } + } + + pair_cwl = pair_to_cwl(pair) + + expected_pair_cwl = ({'CN': 'MSKCC', + 'ID': 'C-K2902H-P001-d_H7HCTBBXY', + 'LB': '09670_D_1_1_1_1_1', + 'PL': 'Illumina', + 'PU': 'H7HCTBBXY', + 'R1': {'class': 'File', + 'path': '/ifs/archive/GCL/hiseq/FASTQ/PITT_0390_BH7HCTBBXY/Project_09670_D/Sample_S16-68609_IGO_09670_D_1/S16-68609_IGO_09670_D_1_S11_R1_001.fastq.gz'}, + 'R2': {'class': 'File', + 'path': '/ifs/archive/GCL/hiseq/FASTQ/PITT_0390_BH7HCTBBXY/Project_09670_D/Sample_S16-68609_IGO_09670_D_1/S16-68609_IGO_09670_D_1_S11_R2_001.fastq.gz'}, + 'SM': 'C-K2902H-P001-d', + 'bait_set': 'IDT_Exome_v1_FP_BAITS', + 'igo_id': '09670_D_1', + 'patient_id': 'C-K2902H', + 'request_id': '09670_D', + 'run_date': '2019-08-15', + 'species': 'Human', + 'specimen_type': 'Biopsy', + 'tumor_type': 'Tumor'}, + {'CN': 'MSKCC', + 'ID': 'C-K2902H-N001-d_H7FKJBBXY', + 'LB': '09670_D_46_1', + 'PL': 'Illumina', + 'PU': 'H7FKJBBXY', + 'R1': {'class': 'File', + 'path': '/ifs/archive/GCL/hiseq/FASTQ/PITT_0391_AH7FKJBBXY/Project_09670_D/Sample_P-0017035-N01-WES_IGO_09670_D_46/P-0017035-N01-WES_IGO_09670_D_46_S12_R1_001.fastq.gz'}, + 'R2': {'class': 'File', + 'path': '/ifs/archive/GCL/hiseq/FASTQ/PITT_0391_AH7FKJBBXY/Project_09670_D/Sample_P-0017035-N01-WES_IGO_09670_D_46/P-0017035-N01-WES_IGO_09670_D_46_S12_R2_001.fastq.gz'}, + 'SM': 'C-K2902H-N001-d', + 'bait_set': 'IDT_Exome_v1_FP_BAITS', + 'igo_id': '09670_D_46', + 'patient_id': 'C-K2902H', + 'request_id': '09670_D', + 'run_date': '2019-08-19', + 'species': 'Human', + 'specimen_type': 'Blood', + 'tumor_type': 'Normal'}) + self.assertEqual(pair_cwl, expected_pair_cwl) + + def test_pair_to_job_data(self): + """ + Test that a pair dict is correctly converted to Job data for submission + """ + test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") + call_command('loaddata', test_files_fixture, verbosity=0) + pair = { + 'normal': { + 'R1': FileMetadata.objects.get(file = File.objects.get(file_name = "P-0017035-N01-WES_IGO_09670_D_46_S12_R1_001.fastq.gz")), + 'R2': FileMetadata.objects.get(file = File.objects.get(file_name = "P-0017035-N01-WES_IGO_09670_D_46_S12_R2_001.fastq.gz")) + }, + 'tumor': { + 'R1': FileMetadata.objects.get(file = File.objects.get(file_name = "S16-68609_IGO_09670_D_1_S11_R1_001.fastq.gz")), + 'R2': FileMetadata.objects.get(file = File.objects.get(file_name = "S16-68609_IGO_09670_D_1_S11_R2_001.fastq.gz")) + } + } + + job_data = pair_to_job_data(pair) + + expected_job_data = ({'CN': 'MSKCC', + 'ID': 'C-K2902H-P001-d_H7HCTBBXY', + 'LB': '09670_D_1_1_1_1_1', + 'PL': 'Illumina', + 'PU': 'H7HCTBBXY', + 'R1': {'class': 'File', + 'location': 'juno:///ifs/archive/GCL/hiseq/FASTQ/PITT_0390_BH7HCTBBXY/Project_09670_D/Sample_S16-68609_IGO_09670_D_1/S16-68609_IGO_09670_D_1_S11_R1_001.fastq.gz'}, + 'R2': {'class': 'File', + 'location': 'juno:///ifs/archive/GCL/hiseq/FASTQ/PITT_0390_BH7HCTBBXY/Project_09670_D/Sample_S16-68609_IGO_09670_D_1/S16-68609_IGO_09670_D_1_S11_R2_001.fastq.gz'}, + 'SM': 'C-K2902H-P001-d', + 'bait_set': 'IDT_Exome_v1_FP_BAITS', + 'igo_id': '09670_D_1', + 'patient_id': 'C-K2902H', + 'request_id': '09670_D', + 'run_date': '2019-08-15', + 'species': 'Human', + 'specimen_type': 'Biopsy', + 'tumor_type': 'Tumor'}, + {'CN': 'MSKCC', + 'ID': 'C-K2902H-N001-d_H7FKJBBXY', + 'LB': '09670_D_46_1', + 'PL': 'Illumina', + 'PU': 'H7FKJBBXY', + 'R1': {'class': 'File', + 'location': 'juno:///ifs/archive/GCL/hiseq/FASTQ/PITT_0391_AH7FKJBBXY/Project_09670_D/Sample_P-0017035-N01-WES_IGO_09670_D_46/P-0017035-N01-WES_IGO_09670_D_46_S12_R1_001.fastq.gz'}, + 'R2': {'class': 'File', + 'location': 'juno:///ifs/archive/GCL/hiseq/FASTQ/PITT_0391_AH7FKJBBXY/Project_09670_D/Sample_P-0017035-N01-WES_IGO_09670_D_46/P-0017035-N01-WES_IGO_09670_D_46_S12_R2_001.fastq.gz'}, + 'SM': 'C-K2902H-N001-d', + 'bait_set': 'IDT_Exome_v1_FP_BAITS', + 'igo_id': '09670_D_46', + 'patient_id': 'C-K2902H', + 'request_id': '09670_D', + 'run_date': '2019-08-19', + 'species': 'Human', + 'specimen_type': 'Blood', + 'tumor_type': 'Normal'}) + + self.assertEqual(job_data, expected_job_data) + + def test_parse_runparams_from_ports1(self): + """ + Test that runparams are correctly parsed from Port queryset + """ + test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") + call_command('loaddata', test_files_fixture, verbosity=0) + run_instance = Run.objects.first() + ports = run_instance.port_set.all() + runparams = parse_runparams_from_ports(ports) + expected_runparams = {'genome': 'GRCh37', + 'pi': 'NA', + 'pi_email': 'NA', + 'project_prefix': '09670_D', + 'scripts_bin': '/usr/bin'} + self.assertEqual(runparams, expected_runparams) + + def test_get_db_files(self): + """ + Test that db_files are returned correctly + """ + assay = "IDT_Exome_v1_FP_b37" + db_files = get_db_files(assay) + expected_db_files = { + 'conpair_markers': '/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.txt', + 'fp_genotypes': { + 'class': 'File', + 'location': 'juno:///juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/FP_tiling_genotypes.txt' + }, + 'hotspot_list_maf': { + 'class': 'File', + 'location': 'juno:///juno/work/ci/resources/roslin-qc/hotspot-list-union-v1-v2.maf' + }, + 'ref_fasta': { + 'class': 'File', + 'location': 'juno:///juno/work/ci/resources/genomes/GRCh37/fasta/b37.fasta' + } + } + self.assertEqual(db_files, expected_db_files) + + def test_parse_outputs_files_data1(self): + """ + Test that a series of files are correctly organized into dict for QC input + """ + files_data = [ + {'name': 'clstats1', 'file': {'class': 'File', 'path': '/path/to/clstats1.txt'} }, + {'name': 'clstats2', 'file': {'class': 'File', 'path': '/path/to/clstats2.txt'} }, + {'name': 'md_metrics', 'file': {'class': 'File', 'path': '/path/to/md_metrics.txt'} }, + {'name': 'hs_metrics', 'file': {'class': 'File', 'path': '/path/to/hs_metrics.txt'} }, + {'name': 'insert_metrics', 'file': {'class': 'File', 'path': '/path/to/insert_metrics.txt'} }, + {'name': 'per_target_coverage', 'file': {'class': 'File', 'path': '/path/to/per_target_coverage.txt'} }, + {'name': 'qual_metrics', 'file': {'class': 'File', 'path': '/path/to/qual_metrics.txt'} }, + {'name': 'doc_basecounts', 'file': {'class': 'File', 'path': '/path/to/doc_basecounts.txt'} }, + {'name': 'conpair_pileups', 'file': {'class': 'File', 'path': '/path/to/conpair_pileups.txt'} } + ] + qc_input = parse_outputs_files_data(files_data) + expected_qc_input = { + 'clstats1': [{'class': 'File', 'path': '/path/to/clstats1.txt'}], + 'clstats2': [{'class': 'File', 'path': '/path/to/clstats2.txt'}], + 'md_metrics': [{'class': 'File', 'path': '/path/to/md_metrics.txt'}], + 'hs_metrics': [{'class': 'File', 'path': '/path/to/hs_metrics.txt'}], + 'insert_metrics': [{'class': 'File', 'path': '/path/to/insert_metrics.txt'}], + 'per_target_coverage': [{'class': 'File', 'path': '/path/to/per_target_coverage.txt'}], + 'qual_metrics': [{'class': 'File', 'path': '/path/to/qual_metrics.txt'}], + 'doc_basecounts': [{'class': 'File', 'path': '/path/to/doc_basecounts.txt'}], + 'conpair_pileups': [{'class': 'File', 'path': '/path/to/conpair_pileups.txt'}], + } + self.assertEqual(qc_input, expected_qc_input) + + + def test_build_inputs_from_run_and_ports1(self): + """ + Test generation of Roslin QC input from Roslin pipeline output Run and Port instances + """ + # load test pipeline Run output fixtures + test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") + call_command('loaddata', test_files_fixture, verbosity=0) + test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "daa13d24-50ea-11ea-b9c7-ac1f6b453620.run.full.json") + call_command('loaddata', test_files_fixture, verbosity=0) + + run_queryset = Run.objects.all() + + qc_input = build_inputs_from_runs(run_queryset) + # print(">>> printing qc_input to file") + # print(json.dumps(qc_input, indent = 4), file = open("qc_input.json", 'w')) + # self.assertTrue(False) + # TODO: how to output format? + self.assertEqual(len(qc_input['pairs']), 2) + self.assertEqual(len(qc_input['pairs'][0]), 2) + self.assertEqual(len(qc_input['bams']), 2) + self.assertEqual(len(qc_input['bams'][0]), 2) + + def test_load_extra_fixtures(self): + """ + Sanity test to ensure that our fixtures have not changed + """ + self.assertEqual(len(Run.objects.all()), 0) + self.assertEqual(len(Port.objects.all()), 0) + self.assertEqual(len(File.objects.all()), 0) + self.assertEqual(len(FileMetadata.objects.all()), 0) + + test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") + call_command('loaddata', test_files_fixture, verbosity=0) + + self.assertEqual(len(Run.objects.all()), 1) + self.assertEqual(len(Port.objects.all()), 47) + self.assertEqual(len(File.objects.all()), 121) + self.assertEqual(len(FileMetadata.objects.all()), 121) + + test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "daa13d24-50ea-11ea-b9c7-ac1f6b453620.run.full.json") + call_command('loaddata', test_files_fixture, verbosity=0) + + self.assertEqual(len(Run.objects.all()), 2) + self.assertEqual(len(Port.objects.all()), 94) + self.assertEqual(len(File.objects.all()), 242) + self.assertEqual(len(FileMetadata.objects.all()), 242) diff --git a/runner/tests/operator/roslin_qc_operator/test_roslin_qc_operator.py b/runner/tests/operator/roslin_qc_operator/test_roslin_qc_operator.py new file mode 100644 index 000000000..b33440083 --- /dev/null +++ b/runner/tests/operator/roslin_qc_operator/test_roslin_qc_operator.py @@ -0,0 +1,95 @@ +""" +Tests for Roslin QC Operator class +""" +import os +import json +from mock import patch +from django.test import TestCase +from runner.operator.operator_factory import OperatorFactory +from runner.operator.roslin_qc_operator.roslin_qc_operator import RoslinQcOperator +from beagle_etl.models import Operator +from django.conf import settings +from django.core.management import call_command +from runner.models import Pipeline, Run +from runner.tasks import create_run_task +from pprint import pprint + +class TestRoslinQcOperator(TestCase): + fixtures = [ + "file_system.filegroup.json", + "file_system.filetype.json", + "file_system.storage.json", + "runner.pipeline.json", + "beagle_etl.operator.json" + ] + + def test_create_operator1(self): + """ + Test that a Roslin QC operator instance can be created + """ + pipeline_type = "roslin-qc" + request_id = "foo" + roslin_qc_model = Operator.objects.get(slug="roslin-qc") + operator = RoslinQcOperator(roslin_qc_model, request_id = request_id) + self.assertTrue(isinstance(operator, RoslinQcOperator)) + self.assertTrue( operator.request_id == "foo") + self.assertTrue( operator._jobs == []) + self.assertTrue( len(operator.files) == 0) + + # disable job submission to Ridgeback + @patch('runner.tasks.submit_job') + def test_direct_operator_creation(self, submit_job): + """ + Test direct Operator instantiation without Operator Factory and try to create valid jobs + """ + # self.maxDiff = None + test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") + call_command('loaddata', test_files_fixture, verbosity=0) + test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "roslin_reference_files.json") + call_command('loaddata', test_files_fixture, verbosity=0) + + # create the operator instance + roslin_qc_model = Operator.objects.get(slug="roslin-qc") + operator = RoslinQcOperator(roslin_qc_model, run_ids = ['ca18b090-03ad-4bef-acd3-52600f8e62eb']) + + # check its attributes + self.assertEqual(operator.run_ids, ['ca18b090-03ad-4bef-acd3-52600f8e62eb']) + self.assertEqual(operator.get_pipeline_id(), "9b7f2ac8-03a5-4c44-ae87-1d9f6500d19a") + + # create the data for the operator run + input_data = operator.get_input_data() + # TODO: need way to recreate this for testing + # expected_input_data = json.load(open(os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.roslin-qc.input.json"))) + + output_metadata = operator.get_output_metadata() + serializer_data = operator.get_data_for_serializer(input_data, output_metadata, name = "foo name") + # pprint(serializer_data, indent = 4, stream = open('roslin-qc-job.json', "w")) + # print(json.dumps(serializer_data, indent = 4), file = open('roslin-qc-job.json', "w")) + + # check qualities of the data generated + # need to pass data through JSON because loaded JSON fixtures do not represent Python tuples embedded in data + # self.assertEqual(json.loads(json.dumps(input_data)), expected_input_data) + # self.assertEqual(output_metadata, {}) + + expected_serializer_data = { + 'app': "9b7f2ac8-03a5-4c44-ae87-1d9f6500d19a", + 'inputs': input_data, + 'name': "foo name", + 'tags': {'run_ids':['ca18b090-03ad-4bef-acd3-52600f8e62eb']}, + 'output_metadata': output_metadata + } + self.assertEqual(serializer_data, expected_serializer_data) + + # create a run with the data + # make sure only 1 run exists before starting + self.assertEqual(len(Run.objects.all()), 1) + + # create and validate the jobs then use them to create Runs + jobs = operator.get_jobs() + for job in jobs: + if job[0].is_valid(): + run = job[0].save() + create_run_task(str(run.id), job[1], None) + + # make sure that a Run was made + self.assertEqual(len(Run.objects.all()), 2) diff --git a/runner/tests/operator/test_operator_factory.py b/runner/tests/operator/test_operator_factory.py index 24faa9f20..a50dff8e9 100755 --- a/runner/tests/operator/test_operator_factory.py +++ b/runner/tests/operator/test_operator_factory.py @@ -12,4 +12,4 @@ def test_operator_factory_invalid_pipeline1(self): """ pipeline_type = "foo" request_id = "bar" - self.assertRaises(Exception, OperatorFactory.get_by_model, pipeline_type, request_id=request_id) + self.assertRaises(Exception, OperatorFactory.get_by_model, pipeline_type, request_id = request_id) diff --git a/runner/tests/serializers/__init__.py b/runner/tests/serializers/__init__.py new file mode 100644 index 000000000..e69de29bb diff --git a/runner/tests/serializers/test_serializers.py b/runner/tests/serializers/test_serializers.py new file mode 100644 index 000000000..b9fb9238f --- /dev/null +++ b/runner/tests/serializers/test_serializers.py @@ -0,0 +1,64 @@ +""" +Tests for serialzers +""" +from django.test import TestCase +from uuid import UUID +from runner.serializers import APIRunCreateSerializer +from runner.models import Run + +class TestSerializers(TestCase): + fixtures = [ + "file_system.filegroup.json", + "file_system.filetype.json", + "file_system.storage.json", + "runner.pipeline.json", + "beagle_etl.operator.json" + ] + + def test_create_run_serializer1(self): + """ + Test that the API Run Create Serializer works and creates a Run + """ + # start with 0 runs in the database + self.assertEqual(len(Run.objects.all()), 0) + + # data to pass to serializer + data = { + 'app': 'cb5d793b-e650-4b7d-bfcd-882858e29cc5', + 'inputs': [], + 'name': 'ROSLIN 10075_D, 1 of 1', + 'tags': {'requestId': '10075_D'} + } + + # run the serialzer + serializer = APIRunCreateSerializer(data = data) + serializer.is_valid() + run = serializer.save() + + # should be a Run in the database now + self.assertEqual(len(Run.objects.all()), 1) + + run_instance = Run.objects.all()[0] + self.assertEqual(run_instance.app_id, UUID('cb5d793b-e650-4b7d-bfcd-882858e29cc5')) + self.assertTrue(run_instance.name.startswith(data['name'])) + self.assertEqual(run_instance.tags, {'requestId': '10075_D'}) + self.assertEqual(run_instance.status, 0) + + def test_create_run_with_output_metadata1(self): + """ + Test that output_metadata propagates to the Run instance created + """ + data = { + 'app': 'cb5d793b-e650-4b7d-bfcd-882858e29cc5', + 'inputs': [], + 'name': 'foo Run', + 'output_metadata': {'assay':'IMPACT486'} + } + serializer = APIRunCreateSerializer(data = data) + serializer.is_valid() + run = serializer.save() + run_instance = Run.objects.all()[0] + self.assertEqual(run_instance.app_id, UUID('cb5d793b-e650-4b7d-bfcd-882858e29cc5')) + self.assertTrue(run_instance.name.startswith(data['name'])) + self.assertEqual(run_instance.status, 0) + self.assertEqual(run_instance.output_metadata, data['output_metadata']) diff --git a/runner/tests/views/test_run_api_view.py b/runner/tests/views/test_run_api_view.py index b91a6bb82..f5a56f6e7 100644 --- a/runner/tests/views/test_run_api_view.py +++ b/runner/tests/views/test_run_api_view.py @@ -3,7 +3,6 @@ """ import os from mock import patch -from unittest.mock import Mock from django.test import TestCase from runner.views.run_api_view import OperatorViewSet from runner.models import Run diff --git a/scripts/dump_db_fixtures.py b/scripts/dump_db_fixtures.py index daffab62a..0884b9ccc 100755 --- a/scripts/dump_db_fixtures.py +++ b/scripts/dump_db_fixtures.py @@ -17,6 +17,8 @@ $ dump_db_fixtures.py port_files fd41534c-71eb-4b1b-b3af-e3b1ec3aecde +$ dump_db_fixtures.py run --onefile ca18b090-03ad-4bef-acd3-52600f8e62eb + Output ------ @@ -34,7 +36,7 @@ import json import argparse import django -from django.db.models import Prefetch +from django.db.models import Prefetch, Max from django.core import serializers from pprint import pprint @@ -47,6 +49,17 @@ from runner.models import Run, RunStatus, Port, PortType, Pipeline sys.path.pop(0) +def get_file_filemetadata_from_port(port_instance): + """ + Get the queryset of all File and FileMetadata entries for a given Port entry + returns a tuple of type (files_queryset, filemetadata_queryset) + """ + files_queryset = port_instance.files.all() + # filemetadata_queryset = FileMetadata.objects.filter(file__in = [i for i in files_queryset]) + filemetata_instances = [] + for file in files_queryset: + filemetata_instances.append(FileMetadata.objects.filter(file = file).order_by('-version').first()) + return(files_queryset, filemetata_instances) def dump_request(**kwargs): """ @@ -73,22 +86,70 @@ def dump_run(**kwargs): Dump re-loadable Django database fixtures for a Run entry and its associated input and output Port entries """ runID = kwargs.pop('runID') + onefile = kwargs.pop('onefile') output_run_file = "{}.run.json".format(runID) - output_port_input_file = "{}.port.input.json".format(runID) - output_port_output_file = "{}.port.output.json".format(runID) + output_port_input_file = "{}.run.port.input.json".format(runID) + output_port_output_file = "{}.run.port.output.json".format(runID) + output_port_file_input_file = "{}.run.port_file.input.json".format(runID) + output_port_filemetadata_input_file = "{}.run.port_filemetadata.input.json".format(runID) + output_port_file_output_file = "{}.run.port_file.output.json".format(runID) + output_port_filemetadata_output_file = "{}.run.port_filemetadata.output.json".format(runID) + + all_data = [] + input_files = [] + input_filemetadatas = [] + output_files = [] + output_filemetadatas = [] # get the parent Run instance run_instance = Run.objects.get(id = runID) - print(json.dumps(json.loads(serializers.serialize('json', [run_instance])), indent=4), file = open(output_run_file, "w")) # get the Run input and output Port instances - input_queryset = run_instance.port_set.filter(port_type=PortType.INPUT) - print(json.dumps(json.loads(serializers.serialize('json', input_queryset.all())), indent=4), file = open(output_port_input_file, "w")) - - output_queryset = run_instance.port_set.filter(port_type=PortType.OUTPUT) - print(json.dumps(json.loads(serializers.serialize('json', output_queryset.all())), indent=4), file = open(output_port_output_file, "w")) - for item in output_queryset: - pprint((item, item.files.all())) + input_port_queryset = run_instance.port_set.filter(port_type=PortType.INPUT) + output_port_queryset = run_instance.port_set.filter(port_type=PortType.OUTPUT) + + for item in input_port_queryset: + files_queryset, filemetata_instances = get_file_filemetadata_from_port(item) + for file in files_queryset: + input_files.append(file) + for filemetadata in filemetata_instances: + input_filemetadatas.append(filemetadata) + + for item in output_port_queryset: + files_queryset, filemetata_instances = get_file_filemetadata_from_port(item) + for file in files_queryset: + output_files.append(file) + for filemetadata in filemetata_instances: + output_filemetadatas.append(filemetadata) + + # save each set of items to individual files by default + if onefile == False: + print(json.dumps(json.loads(serializers.serialize('json', [run_instance])), indent=4), file = open(output_run_file, "w")) + print(json.dumps(json.loads(serializers.serialize('json', input_port_queryset.all())), indent=4), file = open(output_port_input_file, "w")) + print(json.dumps(json.loads(serializers.serialize('json', output_port_queryset.all())), indent=4), file = open(output_port_output_file, "w")) + + print(json.dumps(json.loads(serializers.serialize('json', input_files)), indent=4), file = open(output_port_file_input_file, "w")) + print(json.dumps(json.loads(serializers.serialize('json', input_filemetadatas)), indent=4), file = open(output_port_filemetadata_input_file, "w")) + + print(json.dumps(json.loads(serializers.serialize('json', output_files)), indent=4), file = open(output_port_file_output_file, "w")) + print(json.dumps(json.loads(serializers.serialize('json', output_filemetadatas)), indent=4), file = open(output_port_filemetadata_output_file, "w")) + + # save all items to a single file + if onefile == True: + all_data.append(run_instance) + for item in input_port_queryset: + all_data.append(item) + for item in output_port_queryset: + all_data.append(item) + for item in input_files: + all_data.append(item) + for item in input_filemetadatas: + all_data.append(item) + for item in output_files: + all_data.append(item) + for item in output_filemetadatas: + all_data.append(item) + print(json.dumps(json.loads(serializers.serialize('json', all_data)), indent=4), file = open(output_run_file, "w")) def dump_port_files(**kwargs): @@ -178,6 +239,14 @@ def dump_file(**kwargs): output_file = "all.file_filemetadata.json" print(json.dumps(all_data, indent=4), file = open(output_file, "w")) +def dump_file_group(**kwargs): + """ + Dump the FileGroup fixtures + """ + fileGroupId = kwargs.pop('fileGroupID') + output_file_group_file = "{}.file_group.json".format(fileGroupId) + filegroup_instance = FileGroup.objects.get(id = fileGroupId) + print(json.dumps(json.loads(serializers.serialize('json', [filegroup_instance])), indent=4), file = open(output_file_group_file, "w")) def parse(): """ @@ -193,6 +262,7 @@ def parse(): run = subparsers.add_parser('run', help = 'Dump output data for pipeline run') run.add_argument('runID', help = 'Run ID to dump items for') + run.add_argument('--onefile', action = "store_true", help = 'Put all the outputs into a single file ') run.set_defaults(func = dump_run) pipeline = subparsers.add_parser('pipeline', help = 'Dump pipeline fixture') @@ -210,6 +280,10 @@ def parse(): port_files.add_argument('portID', help = 'Port ID to dump files for') port_files.set_defaults(func = dump_port_files) + file_group = subparsers.add_parser('filegroup', help = 'Dump filegroup fixture') + file_group.add_argument('fileGroupID', help = 'FileGroup ID ID to dump items for') + file_group.set_defaults(func = dump_file_group) + args = parser.parse_args() args.func(**vars(args)) diff --git a/scripts/duplicate_fixtures.py b/scripts/duplicate_fixtures.py new file mode 100755 index 000000000..152098619 --- /dev/null +++ b/scripts/duplicate_fixtures.py @@ -0,0 +1,198 @@ +#!/usr/bin/env python +# -*- coding: utf-8 -*- +""" +Script to use for creating a modified, non-conflicting duplicate of an existing database fixture +Use this after you have dumped some fixtures to a .json file using `dump_db_fixtures.py`, and now you +want another fixture set that has different UUIDs and identifiers so you can load both at once in a dev database +in order to get work done with them. + +Input: .json file produced by dump_db_fixtures.py + +Output: a new .json file with updated key values + +Usage +----- + ./duplicate_fixtures.py ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json + +Notes +----- +The input .json file must have been produced with 'indent = 4' or have equivalent indenting, or this script will probably not work +""" +import os +import sys +import json +import uuid +import copy +import re +import time +import argparse + +def get_unique_id(): + """ + Get a unique ID + maybe replace with with uuid4? + uuid1 has a lower chance of duplicate id's being generated + + TODO: see what Sinisa thinks about this later + """ + return(uuid.uuid1()) + +def replace_primary_keys(input_file, no_change_files): + """ + Replaces all primary keys in the file with new values + """ + # get all primary keys that need to be changed + all_pk = [] + with open(input_file) as f: + for item in json.load(f): + # do not change the pk's on 'File' objects because that causes unique constraint issues on file path + if item['model'] != 'file_system.file': + all_pk.append(item['pk']) + elif item['model'] == 'file_system.file': + if no_change_files == True: + pass + elif no_change_files == False: + all_pk.append(item['pk']) + + # sort unique based on descending length + # this makes sure we replace the longer pattern first in the next steps + all_pk = sorted(list(set(all_pk)), key = len, reverse=True) + + # load all lines of text from the file + lines = open(input_file).readlines() + + # make a copy for editing + output_lines = copy.deepcopy(lines) + + editted_lines = [] + + # search for every primary key in every line of text ... !! Yes, we are doing this + for old_pk in all_pk: + new_pk = str(get_unique_id()) + for i, old_line in enumerate(lines): + if old_pk in old_line: + # I think this only replaces first intance of the pattern? shouldnt matter for this if you printed JSON with indent = 4 + new_line = re.sub(old_pk, new_pk, output_lines[i]) + output_lines[i] = new_line + + # each line should only get editted one time doing this otherwise something is wrong + if i not in editted_lines: + editted_lines.append(i) + else: + print("ERROR: line {} is about to get editted twice; that is not supposed to happen something is wrong".format(i)) + raise + return(output_lines) + +def get_field_values(input_lines, field_name): + """ + Finds a list of all unique values for a given field in the file lines + + examples: + + "runId": "PITT_0390", + >>> ["PITT_0390"] + + "requestId": "09670_D_1581808018", + "sampleId": "09670_D_1", + "patientId": "C-K2902H", + "sampleName": "C-K2902H-P001-d", + "externalSampleId": "S16-68609", + "investigatorSampleId": "S16-68609", + """ + all_values = set() + search_pattern = '.*"{field_name}": "(.*)"'.format(field_name = field_name) + for line in input_lines: + match = re.search(search_pattern, line) + if match != None: + value = match.group(1) + all_values.add(value) + + # return reverse sorted on length to ensure sub-patterns do not get replaced first later + all_values = sorted(list(set(all_values)), key = len, reverse=True) + return(all_values) + +def replace_field_value(input_lines, field_name, old_value, new_value): + """ + Replace the old value for a field with the new value in all file lines + """ + # make a copy for editing + output_lines = copy.deepcopy(input_lines) + + fieldname_search_pattern = '"{field_name}":'.format(field_name = field_name) + + # search for the field label in all lines and replace the value if found + for i, line in enumerate(input_lines): + # check that its a line with the desired field name in it + line_match = re.search(fieldname_search_pattern, line) + if line_match != None: + # check that the desired value to be changed is present + id_match = re.search(old_value, line) + if id_match != None: + # replace the old value with the new value + new_line = re.sub(old_value, new_value, output_lines[i]) + output_lines[i] = new_line + return(output_lines) + +def main(**kwargs): + """ + Main function for editing a fixtures file to replace all old primary keys with new keys + So that both old and new fixtures sets can be loaded into the database at the same time + """ + input_file = kwargs.pop('input_file') + output_file = kwargs.pop('output_file', None) + no_change_files = kwargs.pop('output_file', False) + + if output_file == None: + output_file_name = "{}.duplicated.json".format(input_file) + else: + output_file_name = output_file + + # generate a timestamp string to use for new unique identifiers + timestamp_str = str(int(time.time())) + + # replace all the primary keys with new values; need special handling for pk's because they do not always have a field label in the file + output_lines = replace_primary_keys(input_file, no_change_files) + + # replace the values for all of these other desired fields; these fields are always clearly labeled in the file so they are easy to find + fields_to_change = [ + 'runId', + 'requestId', + 'sampleId', + 'patientId', + 'sampleName', + 'externalSampleId', + 'investigatorSampleId', + 'file_name', + 'path' + ] + for field_name in fields_to_change: + all_values = get_field_values(input_lines = output_lines, field_name = field_name) + for old_value in all_values: + # make a new value by appending the timestamp + if field_name in ['file_name', 'path']: + # special handling for adding timestamp to file paths + name, ext = os.path.splitext(old_value) + new_value = name + '.' + timestamp_str + ext + else: + new_value = old_value + '_' + timestamp_str + output_lines = replace_field_value(input_lines = output_lines, field_name = field_name, old_value = old_value, new_value = new_value) + + # save the output files + with open(output_file_name, "w") as fout: + fout.writelines(output_lines) + +def parse(): + """ + Parses script args + Script arg parsing will go here as this script grows + """ + parser = argparse.ArgumentParser(description = 'Duplicate database fixtures that were previously dumped in json format with indentation') + parser.add_argument('input_file', help = "Input file containing fixtures") + parser.add_argument('--output-file', dest = "output_file", default = None, help = "Name of output file to write to") + parser.add_argument('--no-change-files', dest = "no_change_files", action = 'store_true', help = "Dont change the File items' primary keys and paths") + + args = parser.parse_args() + main(**vars(args)) + +if __name__ == '__main__': + parse()