From 524d298ee7174dac7e223de978fbc70025bbc2b9 Mon Sep 17 00:00:00 2001 From: d4straub Date: Mon, 5 Aug 2024 16:00:36 +0200 Subject: [PATCH 01/26] bump version to 2.12.0dev --- assets/multiqc_config.yml | 4 ++-- nextflow.config | 2 +- 2 files changed, 3 insertions(+), 3 deletions(-) diff --git a/assets/multiqc_config.yml b/assets/multiqc_config.yml index 57691707..ec828d82 100644 --- a/assets/multiqc_config.yml +++ b/assets/multiqc_config.yml @@ -1,7 +1,7 @@ report_comment: > - This report has been generated by the nf-core/ampliseq + This report has been generated by the nf-core/ampliseq analysis pipeline. For information about how to interpret these results, please see the - documentation. + documentation. report_section_order: "nf-core-ampliseq-methods-description": order: -1000 diff --git a/nextflow.config b/nextflow.config index f81c0033..5fadb327 100644 --- a/nextflow.config +++ b/nextflow.config @@ -357,7 +357,7 @@ manifest { description = """Amplicon sequencing analysis workflow using DADA2 and QIIME2""" mainScript = 'main.nf' nextflowVersion = '!>=23.04.0' - version = '2.11.0' + version = '2.12.0dev' doi = '10.5281/zenodo.1493841,10.3389/fmicb.2020.550420' } From 2f7c754373f036be553cdc11d200843a9eca1d9a Mon Sep 17 00:00:00 2001 From: d4straub Date: Mon, 5 Aug 2024 16:01:34 +0200 Subject: [PATCH 02/26] update CHANGELOG --- CHANGELOG.md | 12 ++++++++++++ 1 file changed, 12 insertions(+) diff --git a/CHANGELOG.md b/CHANGELOG.md index f888dc21..5fad48aa 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -3,6 +3,18 @@ The format is based on [Keep a Changelog](https://keepachangelog.com/en/1.0.0/) and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0.html). +## nf-core/ampliseq version 2.12.0dev + +### `Added` + +### `Changed` + +### `Fixed` + +### `Dependencies` + +### `Removed` + ## nf-core/ampliseq version 2.11.0 - 2024-08-06 ### `Added` From fa472fbbda9b79391244927591167da90c3d199e Mon Sep 17 00:00:00 2001 From: d4straub Date: Fri, 18 Oct 2024 15:51:46 +0200 Subject: [PATCH 03/26] merging template updates v3.0.2 --- .github/CONTRIBUTING.md | 12 +- .github/PULL_REQUEST_TEMPLATE.md | 2 +- .github/workflows/awsfulltest.yml | 25 +- .github/workflows/ci.yml | 78 ++-- .github/workflows/download_pipeline.yml | 53 ++- .github/workflows/linting.yml | 23 +- .github/workflows/linting_comment.yml | 2 +- .github/workflows/release-announcements.yml | 2 +- .../workflows/template_version_comment.yml | 46 +++ .gitignore | 9 +- .gitpod.yml | 7 +- .nf-core.yml | 31 +- .pre-commit-config.yaml | 2 +- CITATIONS.md | 4 +- README.md | 2 +- assets/schema_input.json | 2 +- assets/schema_multiregion.json | 2 +- conf/base.config | 43 +- conf/igenomes_ignored.config | 9 + conf/modules.config | 1 - conf/test.config | 13 +- conf/test_doubleprimers.config | 13 +- conf/test_failed.config | 13 +- conf/test_fasta.config | 13 +- conf/test_iontorrent.config | 13 +- conf/test_its_dada_taxonomy.config | 13 +- conf/test_multi.config | 13 +- conf/test_multiregion.config | 13 +- conf/test_novaseq.config | 13 +- conf/test_pacbio_its.config | 13 +- conf/test_pplace.config | 13 +- conf/test_qiimecustom.config | 15 +- conf/test_reftaxcustom.config | 13 +- conf/test_single.config | 13 +- conf/test_sintax.config | 13 +- docs/usage.md | 12 +- main.nf | 5 - modules.json | 12 +- modules/nf-core/fastqc/environment.yml | 2 - modules/nf-core/fastqc/main.nf | 5 +- modules/nf-core/fastqc/meta.yml | 57 +-- modules/nf-core/fastqc/tests/main.nf.test | 225 ++++++++--- .../nf-core/fastqc/tests/main.nf.test.snap | 370 ++++++++++++++++-- modules/nf-core/multiqc/environment.yml | 4 +- modules/nf-core/multiqc/main.nf | 16 +- modules/nf-core/multiqc/meta.yml | 78 ++-- modules/nf-core/multiqc/tests/main.nf.test | 8 + .../nf-core/multiqc/tests/main.nf.test.snap | 24 +- modules/nf-core/multiqc/tests/nextflow.config | 5 + nextflow.config | 140 ++++--- nextflow_schema.json | 96 +---- .../utils_nfcore_ampliseq_pipeline/main.nf | 57 ++- .../nf-core/utils_nextflow_pipeline/main.nf | 70 ++-- .../tests/nextflow.config | 2 +- .../nf-core/utils_nfcore_pipeline/main.nf | 306 ++++++++------- .../nf-core/utils_nfschema_plugin/main.nf | 46 +++ .../nf-core/utils_nfschema_plugin/meta.yml | 35 ++ .../utils_nfschema_plugin/tests/main.nf.test | 117 ++++++ .../tests/nextflow.config | 8 + .../tests/nextflow_schema.json | 8 +- .../nf-core/utils_nfvalidation_plugin/main.nf | 62 --- .../utils_nfvalidation_plugin/meta.yml | 44 --- .../tests/main.nf.test | 200 ---------- .../utils_nfvalidation_plugin/tests/tags.yml | 2 - workflows/ampliseq.nf | 14 +- 65 files changed, 1531 insertions(+), 1051 deletions(-) create mode 100644 .github/workflows/template_version_comment.yml create mode 100644 conf/igenomes_ignored.config create mode 100644 modules/nf-core/multiqc/tests/nextflow.config create mode 100644 subworkflows/nf-core/utils_nfschema_plugin/main.nf create mode 100644 subworkflows/nf-core/utils_nfschema_plugin/meta.yml create mode 100644 subworkflows/nf-core/utils_nfschema_plugin/tests/main.nf.test create mode 100644 subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow.config rename subworkflows/nf-core/{utils_nfvalidation_plugin => utils_nfschema_plugin}/tests/nextflow_schema.json (95%) delete mode 100644 subworkflows/nf-core/utils_nfvalidation_plugin/main.nf delete mode 100644 subworkflows/nf-core/utils_nfvalidation_plugin/meta.yml delete mode 100644 subworkflows/nf-core/utils_nfvalidation_plugin/tests/main.nf.test delete mode 100644 subworkflows/nf-core/utils_nfvalidation_plugin/tests/tags.yml diff --git a/.github/CONTRIBUTING.md b/.github/CONTRIBUTING.md index 32576667..2354d963 100644 --- a/.github/CONTRIBUTING.md +++ b/.github/CONTRIBUTING.md @@ -19,7 +19,7 @@ If you'd like to write some code for nf-core/ampliseq, the standard workflow is 1. Check that there isn't already an issue about your idea in the [nf-core/ampliseq issues](https://github.com/nf-core/ampliseq/issues) to avoid duplicating work. If there isn't one already, please create one so that others know you're working on this 2. [Fork](https://help.github.com/en/github/getting-started-with-github/fork-a-repo) the [nf-core/ampliseq repository](https://github.com/nf-core/ampliseq) to your GitHub account 3. Make the necessary changes / additions within your forked repository following [Pipeline conventions](#pipeline-contribution-conventions) -4. Use `nf-core schema build` and add any new parameters to the pipeline JSON schema (requires [nf-core tools](https://github.com/nf-core/tools) >= 1.10). +4. Use `nf-core pipelines schema build` and add any new parameters to the pipeline JSON schema (requires [nf-core tools](https://github.com/nf-core/tools) >= 1.10). 5. Submit a Pull Request against the `dev` branch and wait for the code to be reviewed and merged If you're not used to this workflow with git, you can start with some [docs from GitHub](https://help.github.com/en/github/collaborating-with-issues-and-pull-requests) or even their [excellent `git` resources](https://try.github.io/). @@ -40,7 +40,7 @@ There are typically two types of tests that run: ### Lint tests `nf-core` has a [set of guidelines](https://nf-co.re/developers/guidelines) which all pipelines must adhere to. -To enforce these and ensure that all pipelines stay in sync, we have developed a helper tool which runs checks on the pipeline code. This is in the [nf-core/tools repository](https://github.com/nf-core/tools) and once installed can be run locally with the `nf-core lint ` command. +To enforce these and ensure that all pipelines stay in sync, we have developed a helper tool which runs checks on the pipeline code. This is in the [nf-core/tools repository](https://github.com/nf-core/tools) and once installed can be run locally with the `nf-core pipelines lint ` command. If any failures or warnings are encountered, please follow the listed URL for more documentation. @@ -75,7 +75,7 @@ If you wish to contribute a new step, please use the following coding standards: 2. Write the process block (see below). 3. Define the output channel if needed (see below). 4. Add any new parameters to `nextflow.config` with a default (see below). -5. Add any new parameters to `nextflow_schema.json` with help text (via the `nf-core schema build` tool). +5. Add any new parameters to `nextflow_schema.json` with help text (via the `nf-core pipelines schema build` tool). 6. Add sanity checks and validation for all relevant parameters. 7. Perform local tests to validate that the new code works as expected. 8. If applicable, add a new test command in `.github/workflow/ci.yml`. @@ -86,11 +86,11 @@ If you wish to contribute a new step, please use the following coding standards: Parameters should be initialised / defined with default values in `nextflow.config` under the `params` scope. -Once there, use `nf-core schema build` to add to `nextflow_schema.json`. +Once there, use `nf-core pipelines schema build` to add to `nextflow_schema.json`. ### Default processes resource requirements -Sensible defaults for process resource requirements (CPUs / memory / time) for a process should be defined in `conf/base.config`. These should generally be specified generic with `withLabel:` selectors so they can be shared across multiple processes/steps of the pipeline. A nf-core standard set of labels that should be followed where possible can be seen in the [nf-core pipeline template](https://github.com/nf-core/tools/blob/master/nf_core/pipeline-template/conf/base.config), which has the default process as a single core-process, and then different levels of multi-core configurations for increasingly large memory requirements defined with standardised labels. +Sensible defaults for process resource requirements (CPUs / memory / time) for a process should be defined in `conf/base.config`. These should generally be specified generic with `withLabel:` selectors so they can be shared across multiple processes/steps of the pipeline. A nf-core standard set of labels that should be followed where possible can be seen in the [nf-core pipeline template](https://github.com/nf-core/tools/blob/main/nf_core/pipeline-template/conf/base.config), which has the default process as a single core-process, and then different levels of multi-core configurations for increasingly large memory requirements defined with standardised labels. The process resources can be passed on to the tool dynamically within the process with the `${task.cpus}` and `${task.memory}` variables in the `script:` block. @@ -103,7 +103,7 @@ Please use the following naming schemes, to make it easy to understand what is g ### Nextflow version bumping -If you are using a new feature from core Nextflow, you may bump the minimum required version of nextflow in the pipeline with: `nf-core bump-version --nextflow . [min-nf-version]` +If you are using a new feature from core Nextflow, you may bump the minimum required version of nextflow in the pipeline with: `nf-core pipelines bump-version --nextflow . [min-nf-version]` ### Images and figures diff --git a/.github/PULL_REQUEST_TEMPLATE.md b/.github/PULL_REQUEST_TEMPLATE.md index ada206f7..f67ce962 100644 --- a/.github/PULL_REQUEST_TEMPLATE.md +++ b/.github/PULL_REQUEST_TEMPLATE.md @@ -17,7 +17,7 @@ Learn more about contributing: [CONTRIBUTING.md](https://github.com/nf-core/ampl - [ ] If you've fixed a bug or added code that should be tested, add tests! - [ ] If you've added a new tool - have you followed the pipeline conventions in the [contribution docs](https://github.com/nf-core/ampliseq/tree/master/.github/CONTRIBUTING.md) - [ ] If necessary, also make a PR on the nf-core/ampliseq _branch_ on the [nf-core/test-datasets](https://github.com/nf-core/test-datasets) repository. -- [ ] Make sure your code lints (`nf-core lint`). +- [ ] Make sure your code lints (`nf-core pipelines lint`). - [ ] Ensure the test suite passes (`nextflow run . -profile test,docker --outdir `). - [ ] Check for unexpected warnings in debug mode (`nextflow run . -profile debug,test,docker --outdir `). - [ ] Usage Documentation in `docs/usage.md` is updated. diff --git a/.github/workflows/awsfulltest.yml b/.github/workflows/awsfulltest.yml index 8fa004b9..95e89f04 100644 --- a/.github/workflows/awsfulltest.yml +++ b/.github/workflows/awsfulltest.yml @@ -1,18 +1,35 @@ name: nf-core AWS full size tests -# This workflow is triggered on published releases. +# This workflow is triggered on PRs opened against the master branch. # It can be additionally triggered manually with GitHub actions workflow dispatch button. # It runs the -profile 'test_full' on AWS batch on: - release: - types: [published] + pull_request: + branches: + - master workflow_dispatch: + pull_request_review: + types: [submitted] + jobs: run-platform: name: Run AWS full tests - if: github.repository == 'nf-core/ampliseq' + # run only if the PR is approved by at least 2 reviewers and against the master branch or manually triggered + if: github.repository == 'nf-core/ampliseq' && github.event.review.state == 'approved' && github.event.pull_request.base.ref == 'master' || github.event_name == 'workflow_dispatch' runs-on: ubuntu-latest steps: + - uses: octokit/request-action@v2.x + id: check_approvals + with: + route: GET /repos/${{ github.repository }}/pulls/${{ github.event.pull_request.number }}/reviews + env: + GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }} + - id: test_variables + if: github.event_name != 'workflow_dispatch' + run: | + JSON_RESPONSE='${{ steps.check_approvals.outputs.data }}' + CURRENT_APPROVALS_COUNT=$(echo $JSON_RESPONSE | jq -c '[.[] | select(.state | contains("APPROVED")) ] | length') + test $CURRENT_APPROVALS_COUNT -ge 2 || exit 1 # At least 2 approvals are required - name: Launch workflow via Seqera Platform uses: seqeralabs/action-tower-launch@v2 with: diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml index b6cca8d1..115583af 100644 --- a/.github/workflows/ci.yml +++ b/.github/workflows/ci.yml @@ -9,41 +9,40 @@ on: - "dev" - "master" release: - types: - - "published" + types: [published] + workflow_dispatch: env: NXF_ANSI_LOG: false NFTEST_VER: "0.7.3" + NXF_SINGULARITY_CACHEDIR: ${{ github.workspace }}/.singularity + NXF_SINGULARITY_LIBRARYDIR: ${{ github.workspace }}/.singularity concurrency: group: ${{ github.workflow }}-${{ github.event.pull_request.number || github.ref }} cancel-in-progress: true jobs: - define_nxf_versions: - name: Choose nextflow versions to test against depending on target branch - runs-on: ubuntu-latest - outputs: - matrix: ${{ steps.nxf_versions.outputs.matrix }} - steps: - - id: nxf_versions - run: | - if [[ "${{ github.event_name }}" == "pull_request" && "${{ github.base_ref }}" == "dev" && "${{ matrix.NXF_VER }}" != "latest-everything" ]]; then - echo matrix='["latest-everything"]' | tee -a $GITHUB_OUTPUT - else - echo matrix='["latest-everything", "23.04.0"]' | tee -a $GITHUB_OUTPUT - fi - test: name: nf-test - needs: define_nxf_versions + # Only run on push if this is the nf-core dev branch (merged PRs) + if: "${{ github.event_name != 'push' || (github.event_name == 'push' && github.repository == 'nf-core/ampliseq') }}" runs-on: ubuntu-latest strategy: fail-fast: false matrix: - NXF_VER: ${{ fromJson(needs.define_nxf_versions.outputs.matrix) }} - tags: + NXF_VER: + - "24.04.2" + - "latest-everything" + profile: + - "conda" + - "docker" + - "singularity" + profile: + #- "conda" + - "docker" + - "singularity" + test_name: - "test" - "test_single" - "test_fasta" @@ -58,19 +57,50 @@ jobs: - "test_sintax" - "test_pplace" - "test_multiregion" - profile: - - "docker" + isMaster: + - ${{ github.base_ref == 'master' }} + # Exclude conda and singularity on dev + exclude: + #- isMaster: false + # profile: "conda" + - isMaster: false + profile: "singularity" steps: - name: Check out pipeline code uses: actions/checkout@0ad4b8fadaa221de15dcec353f45205ec38ea70b # v4 - - name: Install Nextflow + - name: Set up Nextflow uses: nf-core/setup-nextflow@v2 with: version: "${{ matrix.NXF_VER }}" - - name: Disk space cleanup + - name: Set up Apptainer + if: matrix.profile == 'singularity' + uses: eWaterCycle/setup-apptainer@main + + - name: Set up Singularity + if: matrix.profile == 'singularity' + run: | + mkdir -p $NXF_SINGULARITY_CACHEDIR + mkdir -p $NXF_SINGULARITY_LIBRARYDIR + + - name: Set up Miniconda + if: matrix.profile == 'conda' + uses: conda-incubator/setup-miniconda@a4260408e20b96e80095f42ff7f1a15b27dd94ca # v3 + with: + miniconda-version: "latest" + auto-update-conda: true + conda-solver: libmamba + channels: conda-forge,bioconda + + - name: Set up Conda + if: matrix.profile == 'conda' + run: | + echo $(realpath $CONDA)/condabin >> $GITHUB_PATH + echo $(realpath python) >> $GITHUB_PATH + + - name: Clean up Disk space uses: jlumbroso/free-disk-space@54081f138730dfa15788a46383842cd2f914a1be # v1.3.1 - name: Install nf-test @@ -80,7 +110,7 @@ jobs: - name: Run nf-test run: | - nf-test test --tag ${{ matrix.tags }} --profile ${{ matrix.tags }},${{ matrix.profile }} --junitxml=test.xml + nf-test test --tag ${{ matrix.test_name }} --profile ${{ matrix.test_name }},${{ matrix.profile }} --junitxml=test.xml - name: Output log on failure if: failure() diff --git a/.github/workflows/download_pipeline.yml b/.github/workflows/download_pipeline.yml index 2d20d644..713dc3e7 100644 --- a/.github/workflows/download_pipeline.yml +++ b/.github/workflows/download_pipeline.yml @@ -1,4 +1,4 @@ -name: Test successful pipeline download with 'nf-core download' +name: Test successful pipeline download with 'nf-core pipelines download' # Run the workflow when: # - dispatched manually @@ -8,7 +8,7 @@ on: workflow_dispatch: inputs: testbranch: - description: "The specific branch you wish to utilize for the test execution of nf-core download." + description: "The specific branch you wish to utilize for the test execution of nf-core pipelines download." required: true default: "dev" pull_request: @@ -39,9 +39,11 @@ jobs: with: python-version: "3.12" architecture: "x64" - - uses: eWaterCycle/setup-singularity@931d4e31109e875b13309ae1d07c70ca8fbc8537 # v7 + + - name: Setup Apptainer + uses: eWaterCycle/setup-apptainer@4bb22c52d4f63406c49e94c804632975787312b3 # v2.0.0 with: - singularity-version: 3.8.3 + apptainer-version: 1.3.4 - name: Install dependencies run: | @@ -54,33 +56,64 @@ jobs: echo "REPOTITLE_LOWERCASE=$(basename ${GITHUB_REPOSITORY,,})" >> ${GITHUB_ENV} echo "REPO_BRANCH=${{ github.event.inputs.testbranch || 'dev' }}" >> ${GITHUB_ENV} + - name: Make a cache directory for the container images + run: | + mkdir -p ./singularity_container_images + - name: Download the pipeline env: - NXF_SINGULARITY_CACHEDIR: ./ + NXF_SINGULARITY_CACHEDIR: ./singularity_container_images run: | - nf-core download ${{ env.REPO_LOWERCASE }} \ + nf-core pipelines download ${{ env.REPO_LOWERCASE }} \ --revision ${{ env.REPO_BRANCH }} \ --outdir ./${{ env.REPOTITLE_LOWERCASE }} \ --compress "none" \ --container-system 'singularity' \ - --container-library "quay.io" -l "docker.io" -l "ghcr.io" \ + --container-library "quay.io" -l "docker.io" -l "community.wave.seqera.io" \ --container-cache-utilisation 'amend' \ - --download-configuration + --download-configuration 'yes' - name: Inspect download run: tree ./${{ env.REPOTITLE_LOWERCASE }} + - name: Count the downloaded number of container images + id: count_initial + run: | + image_count=$(ls -1 ./singularity_container_images | wc -l | xargs) + echo "Initial container image count: $image_count" + echo "IMAGE_COUNT_INITIAL=$image_count" >> ${GITHUB_ENV} + - name: Run the downloaded pipeline (stub) id: stub_run_pipeline continue-on-error: true env: - NXF_SINGULARITY_CACHEDIR: ./ + NXF_SINGULARITY_CACHEDIR: ./singularity_container_images NXF_SINGULARITY_HOME_MOUNT: true run: nextflow run ./${{ env.REPOTITLE_LOWERCASE }}/$( sed 's/\W/_/g' <<< ${{ env.REPO_BRANCH }}) -stub -profile test,singularity --outdir ./results - name: Run the downloaded pipeline (stub run not supported) id: run_pipeline if: ${{ job.steps.stub_run_pipeline.status == failure() }} env: - NXF_SINGULARITY_CACHEDIR: ./ + NXF_SINGULARITY_CACHEDIR: ./singularity_container_images NXF_SINGULARITY_HOME_MOUNT: true run: nextflow run ./${{ env.REPOTITLE_LOWERCASE }}/$( sed 's/\W/_/g' <<< ${{ env.REPO_BRANCH }}) -profile test,singularity --outdir ./results + + - name: Count the downloaded number of container images + id: count_afterwards + run: | + image_count=$(ls -1 ./singularity_container_images | wc -l | xargs) + echo "Post-pipeline run container image count: $image_count" + echo "IMAGE_COUNT_AFTER=$image_count" >> ${GITHUB_ENV} + + - name: Compare container image counts + run: | + if [ "${{ env.IMAGE_COUNT_INITIAL }}" -ne "${{ env.IMAGE_COUNT_AFTER }}" ]; then + initial_count=${{ env.IMAGE_COUNT_INITIAL }} + final_count=${{ env.IMAGE_COUNT_AFTER }} + difference=$((final_count - initial_count)) + echo "$difference additional container images were \n downloaded at runtime . The pipeline has no support for offline runs!" + tree ./singularity_container_images + exit 1 + else + echo "The pipeline can be downloaded successfully!" + fi diff --git a/.github/workflows/linting.yml b/.github/workflows/linting.yml index 1fcafe88..a502573c 100644 --- a/.github/workflows/linting.yml +++ b/.github/workflows/linting.yml @@ -1,6 +1,6 @@ name: nf-core linting # This workflow is triggered on pushes and PRs to the repository. -# It runs the `nf-core lint` and markdown lint tests to ensure +# It runs the `nf-core pipelines lint` and markdown lint tests to ensure # that the code meets the nf-core guidelines. on: push: @@ -41,17 +41,32 @@ jobs: python-version: "3.12" architecture: "x64" + - name: read .nf-core.yml + uses: pietrobolcato/action-read-yaml@1.1.0 + id: read_yml + with: + config: ${{ github.workspace }}/.nf-core.yml + - name: Install dependencies run: | python -m pip install --upgrade pip - pip install nf-core + pip install nf-core==${{ steps.read_yml.outputs['nf_core_version'] }} + + - name: Run nf-core pipelines lint + if: ${{ github.base_ref != 'master' }} + env: + GITHUB_COMMENTS_URL: ${{ github.event.pull_request.comments_url }} + GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }} + GITHUB_PR_COMMIT: ${{ github.event.pull_request.head.sha }} + run: nf-core -l lint_log.txt pipelines lint --dir ${GITHUB_WORKSPACE} --markdown lint_results.md - - name: Run nf-core lint + - name: Run nf-core pipelines lint --release + if: ${{ github.base_ref == 'master' }} env: GITHUB_COMMENTS_URL: ${{ github.event.pull_request.comments_url }} GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }} GITHUB_PR_COMMIT: ${{ github.event.pull_request.head.sha }} - run: nf-core -l lint_log.txt lint --dir ${GITHUB_WORKSPACE} --markdown lint_results.md + run: nf-core -l lint_log.txt pipelines lint --release --dir ${GITHUB_WORKSPACE} --markdown lint_results.md - name: Save PR number if: ${{ always() }} diff --git a/.github/workflows/linting_comment.yml b/.github/workflows/linting_comment.yml index 40acc23f..42e519bf 100644 --- a/.github/workflows/linting_comment.yml +++ b/.github/workflows/linting_comment.yml @@ -11,7 +11,7 @@ jobs: runs-on: ubuntu-latest steps: - name: Download lint results - uses: dawidd6/action-download-artifact@09f2f74827fd3a8607589e5ad7f9398816f540fe # v3 + uses: dawidd6/action-download-artifact@bf251b5aa9c2f7eeb574a96ee720e24f801b7c11 # v6 with: workflow: linting.yml workflow_conclusion: completed diff --git a/.github/workflows/release-announcements.yml b/.github/workflows/release-announcements.yml index 03ecfcf7..c6ba35df 100644 --- a/.github/workflows/release-announcements.yml +++ b/.github/workflows/release-announcements.yml @@ -12,7 +12,7 @@ jobs: - name: get topics and convert to hashtags id: get_topics run: | - echo "topics=$(curl -s https://nf-co.re/pipelines.json | jq -r '.remote_workflows[] | select(.full_name == "${{ github.repository }}") | .topics[]' | awk '{print "#"$0}' | tr '\n' ' ')" >> $GITHUB_OUTPUT + echo "topics=$(curl -s https://nf-co.re/pipelines.json | jq -r '.remote_workflows[] | select(.full_name == "${{ github.repository }}") | .topics[]' | awk '{print "#"$0}' | tr '\n' ' ')" | sed 's/-//g' >> $GITHUB_OUTPUT - uses: rzr/fediverse-action@master with: diff --git a/.github/workflows/template_version_comment.yml b/.github/workflows/template_version_comment.yml new file mode 100644 index 00000000..e8aafe44 --- /dev/null +++ b/.github/workflows/template_version_comment.yml @@ -0,0 +1,46 @@ +name: nf-core template version comment +# This workflow is triggered on PRs to check if the pipeline template version matches the latest nf-core version. +# It posts a comment to the PR, even if it comes from a fork. + +on: pull_request_target + +jobs: + template_version: + runs-on: ubuntu-latest + steps: + - name: Check out pipeline code + uses: actions/checkout@0ad4b8fadaa221de15dcec353f45205ec38ea70b # v4 + with: + ref: ${{ github.event.pull_request.head.sha }} + + - name: Read template version from .nf-core.yml + uses: nichmor/minimal-read-yaml@v0.0.2 + id: read_yml + with: + config: ${{ github.workspace }}/.nf-core.yml + + - name: Install nf-core + run: | + python -m pip install --upgrade pip + pip install nf-core==${{ steps.read_yml.outputs['nf_core_version'] }} + + - name: Check nf-core outdated + id: nf_core_outdated + run: echo "OUTPUT=$(pip list --outdated | grep nf-core)" >> ${GITHUB_ENV} + + - name: Post nf-core template version comment + uses: mshick/add-pr-comment@b8f338c590a895d50bcbfa6c5859251edc8952fc # v2 + if: | + contains(env.OUTPUT, 'nf-core') + with: + repo-token: ${{ secrets.NF_CORE_BOT_AUTH_TOKEN }} + allow-repeats: false + message: | + > [!WARNING] + > Newer version of the nf-core template is available. + > + > Your pipeline is using an old version of the nf-core template: ${{ steps.read_yml.outputs['nf_core_version'] }}. + > Please update your pipeline to the latest version. + > + > For more documentation on how to update your pipeline, please see the [nf-core documentation](https://github.com/nf-core/tools?tab=readme-ov-file#sync-a-pipeline-with-the-template) and [Synchronisation documentation](https://nf-co.re/docs/contributing/sync). + # diff --git a/.gitignore b/.gitignore index 3d8181e6..a42ce016 100644 --- a/.gitignore +++ b/.gitignore @@ -6,11 +6,4 @@ results/ testing/ testing* *.pyc -.*.sw? -.Rproj.user -.Rhistory -.screenrc -ampliseq.Rproj -results_test/* -.nf-test/ -nf-test +null/ diff --git a/.gitpod.yml b/.gitpod.yml index 105a1821..46118637 100644 --- a/.gitpod.yml +++ b/.gitpod.yml @@ -4,17 +4,14 @@ tasks: command: | pre-commit install --install-hooks nextflow self-update - - name: unset JAVA_TOOL_OPTIONS - command: | - unset JAVA_TOOL_OPTIONS vscode: extensions: # based on nf-core.nf-core-extensionpack - - esbenp.prettier-vscode # Markdown/CommonMark linting and style checking for Visual Studio Code + #- esbenp.prettier-vscode # Markdown/CommonMark linting and style checking for Visual Studio Code - EditorConfig.EditorConfig # override user/workspace settings with settings found in .editorconfig files - Gruntfuggly.todo-tree # Display TODO and FIXME in a tree view in the activity bar - mechatroner.rainbow-csv # Highlight columns in csv files in different colors - # - nextflow.nextflow # Nextflow syntax highlighting + - nextflow.nextflow # Nextflow syntax highlighting - oderwat.indent-rainbow # Highlight indentation level - streetsidesoftware.code-spell-checker # Spelling checker for source code - charliermarsh.ruff # Code linter Ruff diff --git a/.nf-core.yml b/.nf-core.yml index d9f93009..e3b426a3 100644 --- a/.nf-core.yml +++ b/.nf-core.yml @@ -1,17 +1,30 @@ -repository_type: pipeline +bump_version: null lint: - files_unchanged: - - .gitattributes + actions_ci: false files_exist: - conf/igenomes.config + files_unchanged: + - .gitattributes nextflow_config: - config_defaults: - - params.report_template - - params.report_css - - params.report_logo - actions_ci: False + - params.report_template + - params.report_css + - params.report_logo +nf_core_version: 3.0.2 +org_path: null +repository_type: pipeline +template: + author: Daniel Straub, Alexander Peltzer + description: Amplicon sequencing analysis workflow using DADA2 and QIIME2 + force: false + is_nfcore: true + name: ampliseq + org: nf-core + outdir: . + skip_features: + - igenomes + version: 2.12.0dev update: https://github.com/nf-core/modules.git: nf-core: - mafft: "feb29be775d9e41750180539e9a3bdce801d0609" -nf_core_version: "2.14.1" + mafft: feb29be775d9e41750180539e9a3bdce801d0609 diff --git a/.pre-commit-config.yaml b/.pre-commit-config.yaml index 4dc0f1dc..9e9f0e1c 100644 --- a/.pre-commit-config.yaml +++ b/.pre-commit-config.yaml @@ -7,7 +7,7 @@ repos: - prettier@3.2.5 - repo: https://github.com/editorconfig-checker/editorconfig-checker.python - rev: "2.7.3" + rev: "3.0.3" hooks: - id: editorconfig-checker alias: ec diff --git a/CITATIONS.md b/CITATIONS.md index fa98ef19..09f1d7d5 100644 --- a/CITATIONS.md +++ b/CITATIONS.md @@ -18,7 +18,7 @@ - [FastQC](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) - > Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence Data [Online]. +> Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence Data [Online]. - [Cutadapt](https://journal.embnet.org/index.php/embnetjournal/article/view/200/479) @@ -187,7 +187,7 @@ - [MultiQC](https://pubmed.ncbi.nlm.nih.gov/27312411/) - > Ewels P, Magnusson M, Lundin S, Käller M. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics. 2016 Oct 1;32(19):3047-8. doi: 10.1093/bioinformatics/btw354. Epub 2016 Jun 16. PubMed PMID: 27312411; PubMed Central PMCID: PMC5039924. +> Ewels P, Magnusson M, Lundin S, Käller M. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics. 2016 Oct 1;32(19):3047-8. doi: 10.1093/bioinformatics/btw354. Epub 2016 Jun 16. PubMed PMID: 27312411; PubMed Central PMCID: PMC5039924. ## Data diff --git a/README.md b/README.md index beddf94c..bdd7c6e2 100644 --- a/README.md +++ b/README.md @@ -75,7 +75,7 @@ nextflow run nf-core/ampliseq \ > By default the taxonomic assignment will be performed with DADA2 on SILVA database, but there are various tools and databases readily available, see [taxonomic classification documentation](https://nf-co.re/ampliseq/usage#taxonomic-classification). Differential abundance testing with ([ANCOM](https://www.ncbi.nlm.nih.gov/pubmed/26028277)) or ([ANCOM-BC](https://www.ncbi.nlm.nih.gov/pubmed/32665548)) when opting in. > [!WARNING] -> Please provide pipeline parameters via the CLI or Nextflow `-params-file` option. Custom config files including those provided by the `-c` Nextflow option can be used to provide any configuration _**except for parameters**_; see [docs](https://nf-co.re/usage/configuration#custom-configuration-files). +> Please provide pipeline parameters via the CLI or Nextflow `-params-file` option. Custom config files including those provided by the `-c` Nextflow option can be used to provide any configuration _**except for parameters**_; see [docs](https://nf-co.re/docs/usage/getting_started/configuration#custom-configuration-files). For more details and further functionality, please refer to the [usage documentation](https://nf-co.re/ampliseq/usage) and the [parameter documentation](https://nf-co.re/ampliseq/parameters). diff --git a/assets/schema_input.json b/assets/schema_input.json index 269027c7..00f1922c 100644 --- a/assets/schema_input.json +++ b/assets/schema_input.json @@ -1,5 +1,5 @@ { - "$schema": "http://json-schema.org/draft-07/schema", + "$schema": "https://json-schema.org/draft/2020-12/schema", "$id": "https://raw.githubusercontent.com/nf-core/ampliseq/master/assets/schema_input.json", "title": "nf-core/ampliseq pipeline - params.input schema", "description": "Schema for the file provided with params.input", diff --git a/assets/schema_multiregion.json b/assets/schema_multiregion.json index a0ef525f..62261133 100644 --- a/assets/schema_multiregion.json +++ b/assets/schema_multiregion.json @@ -1,5 +1,5 @@ { - "$schema": "http://json-schema.org/draft-07/schema", + "$schema": "https://json-schema.org/draft/2020-12/schema", "$id": "https://raw.githubusercontent.com/nf-core/ampliseq/master/assets/schema_multiregion.json", "title": "nf-core/ampliseq pipeline - params.multiregion schema", "description": "Schema for the file provided with params.multiregion", diff --git a/conf/base.config b/conf/base.config index 32af8a73..c052a5bd 100644 --- a/conf/base.config +++ b/conf/base.config @@ -10,9 +10,10 @@ process { - cpus = { check_max( 1 * task.attempt, 'cpus' ) } - memory = { check_max( 6.GB * task.attempt, 'memory' ) } - time = { check_max( 4.h * task.attempt, 'time' ) } + // nf-core: Check the defaults for all processes + cpus = { 1 * task.attempt } + memory = { 6.GB * task.attempt } + time = { 4.h * task.attempt } errorStrategy = { task.exitStatus in ((130..145) + 104) ? 'retry' : 'finish' } maxRetries = 3 @@ -25,33 +26,33 @@ process { // adding in your local modules too. // See https://www.nextflow.io/docs/latest/config.html#config-process-selectors withLabel:process_single { - cpus = { check_max( 1 , 'cpus' ) } - memory = { check_max( 6.GB * task.attempt, 'memory' ) } - time = { check_max( 4.h * task.attempt, 'time' ) } + cpus = { 1 } + memory = { 6.GB * task.attempt } + time = { 4.h * task.attempt } } withLabel:process_low { - cpus = { check_max( 2 * task.attempt, 'cpus' ) } - memory = { check_max( 12.GB * task.attempt, 'memory' ) } - time = { check_max( 6.h * task.attempt, 'time' ) } + cpus = { 2 * task.attempt } + memory = { 12.GB * task.attempt } + time = { 6.h * task.attempt } } withLabel:process_medium { - cpus = { check_max( 6 * task.attempt, 'cpus' ) } - memory = { check_max( 42.GB * task.attempt, 'memory' ) } - time = { check_max( 12.h * task.attempt, 'time' ) } + cpus = { 6 * task.attempt } + memory = { 36.GB * task.attempt } + time = { 12.h * task.attempt } } withLabel:process_high { - cpus = { check_max( 20 * task.attempt, 'cpus' ) } - memory = { check_max( 120.GB * task.attempt, 'memory' ) } - time = { check_max( 36.h * task.attempt, 'time' ) } + cpus = { 20 * task.attempt } + memory = { 120.GB* task.attempt } + time = { 36.h * task.attempt } } withLabel:process_long { - time = { check_max( 48.h * task.attempt, 'time' ) } + time = { 48.h * task.attempt } } withLabel:single_cpu { - cpus = { check_max( 1 , 'cpus' ) } + cpus = 1 } withLabel:process_high_memory { - memory = { check_max( 200.GB * task.attempt, 'memory' ) } + memory = { 200.GB * task.attempt } } withLabel:error_ignore { errorStrategy = 'ignore' @@ -62,8 +63,8 @@ process { } withName:QIIME2_EXTRACT { - cpus = { check_max( 12 * task.attempt, 'cpus' ) } - memory = { check_max( 12.GB * task.attempt, 'memory' ) } - time = { check_max( 24.h * task.attempt, 'time' ) } + cpus = { 12 * task.attempt } + memory = { 12.GB * task.attempt } + time = { 24.h * task.attempt } } } diff --git a/conf/igenomes_ignored.config b/conf/igenomes_ignored.config new file mode 100644 index 00000000..b4034d82 --- /dev/null +++ b/conf/igenomes_ignored.config @@ -0,0 +1,9 @@ +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + Nextflow config file for iGenomes paths +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + Empty genomes dictionary to use when igenomes is ignored. +---------------------------------------------------------------------------------------- +*/ + +params.genomes = [:] diff --git a/conf/modules.config b/conf/modules.config index c1930250..5f940e57 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -1057,7 +1057,6 @@ process { pattern: "*.rds" ] } - withName: 'MULTIQC' { ext.args = { params.multiqc_title ? "--title \"$params.multiqc_title\"" : '' } publishDir = [ diff --git a/conf/test.config b/conf/test.config index 6c75a9cf..13a982d6 100644 --- a/conf/test.config +++ b/conf/test.config @@ -10,15 +10,18 @@ ---------------------------------------------------------------------------------------- */ +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '2.h' + ] +} + params { config_profile_name = 'Test profile' config_profile_description = 'Minimal test dataset to check pipeline function' - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = '6.GB' - max_time = '6.h' - // Input data FW_primer = "GTGYCAGCMGCCGCGGTAA" RV_primer = "GGACTACNVGGGTWTCTAAT" diff --git a/conf/test_doubleprimers.config b/conf/test_doubleprimers.config index 8a6e1e86..2e11d29a 100644 --- a/conf/test_doubleprimers.config +++ b/conf/test_doubleprimers.config @@ -10,15 +10,18 @@ ---------------------------------------------------------------------------------------- */ +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '2.h' + ] +} + params { config_profile_name = 'Test doubleprimers profile' config_profile_description = 'Minimal test dataset to check pipeline function when removing double primers' - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = '6.GB' - max_time = '6.h' - // Input data FW_primer = "NNNNCCTAHGGGRBGCAGCAG" RV_primer = "GACTACHVGGGTATCTAATCC" diff --git a/conf/test_failed.config b/conf/test_failed.config index 157a2f2a..81cfc24c 100644 --- a/conf/test_failed.config +++ b/conf/test_failed.config @@ -10,15 +10,18 @@ ---------------------------------------------------------------------------------------- */ +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '2.h' + ] +} + params { config_profile_name = 'Test profile - failed sample' config_profile_description = 'Minimal test dataset to check pipeline function for failed samples' - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = '6.GB' - max_time = '6.h' - // Input data FW_primer = "GTGYCAGCMGCCGCGGTAA" RV_primer = "GGACTACNVGGGTWTCTAAT" diff --git a/conf/test_fasta.config b/conf/test_fasta.config index e5ffa3e2..93e97f15 100644 --- a/conf/test_fasta.config +++ b/conf/test_fasta.config @@ -10,15 +10,18 @@ ---------------------------------------------------------------------------------------- */ +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '2.h' + ] +} + params { config_profile_name = 'Test fasta input profile' config_profile_description = 'Minimal test dataset to check pipeline function with fasta input' - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = '6.GB' - max_time = '6.h' - // Input data input_fasta = params.pipelines_testdata_base_path + "ampliseq/testdata/ASV_seqs.fasta" dada_ref_taxonomy = "rdp=18" diff --git a/conf/test_iontorrent.config b/conf/test_iontorrent.config index aa53e40b..c3d39ed9 100644 --- a/conf/test_iontorrent.config +++ b/conf/test_iontorrent.config @@ -10,15 +10,18 @@ ---------------------------------------------------------------------------------------- */ +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '2.h' + ] +} + params { config_profile_name = 'Test profile single-end ionTorrent reads' config_profile_description = 'Minimal test dataset to check pipeline function with single-end ionTorrent sequences' - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = '6.GB' - max_time = '6.h' - // Input data FW_primer = "GTGARTCATCGARTCTTTG" RV_primer = "TCCTCSSCTTATTGATATGC" diff --git a/conf/test_its_dada_taxonomy.config b/conf/test_its_dada_taxonomy.config index d704320b..9b9b962c 100644 --- a/conf/test_its_dada_taxonomy.config +++ b/conf/test_its_dada_taxonomy.config @@ -10,15 +10,18 @@ ---------------------------------------------------------------------------------------- */ +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '2.h' + ] +} + params { config_profile_name = 'Test sintax profile' config_profile_description = 'Minimal test dataset to check pipeline function for ITS data with the DADA2 taxonomy classifier' - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = '12.GB' - max_time = '6.h' - // Input data FW_primer = "CTTGGTCATTTAGAGGAAGTAA" RV_primer = "TCCTGAGGGAAACTTCG" diff --git a/conf/test_multi.config b/conf/test_multi.config index aaa07a81..ea3e2e85 100644 --- a/conf/test_multi.config +++ b/conf/test_multi.config @@ -10,15 +10,18 @@ ---------------------------------------------------------------------------------------- */ +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '2.h' + ] +} + params { config_profile_name = 'Test profile for multiple sequencing runs' config_profile_description = 'Test dataset for multiple sequencing runs to check pipeline function' - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = '6.GB' - max_time = '6.h' - // Input data skip_cutadapt = true trunclenf = 200 diff --git a/conf/test_multiregion.config b/conf/test_multiregion.config index 41fa66ff..da9895f3 100644 --- a/conf/test_multiregion.config +++ b/conf/test_multiregion.config @@ -10,15 +10,18 @@ ---------------------------------------------------------------------------------------- */ +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '2.h' + ] +} + params { config_profile_name = 'Test profile for multi-region analysis' config_profile_description = 'Test dataset to check multi-region pipeline function' - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = '6.GB' - max_time = '6.h' - // Input data input = params.pipelines_testdata_base_path + "ampliseq/samplesheets/samplesheet_multiregion.tsv" metadata = params.pipelines_testdata_base_path + "ampliseq/samplesheets/metadata_multiregion.tsv" diff --git a/conf/test_novaseq.config b/conf/test_novaseq.config index 9e096335..2781ca52 100644 --- a/conf/test_novaseq.config +++ b/conf/test_novaseq.config @@ -10,15 +10,18 @@ ---------------------------------------------------------------------------------------- */ +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '2.h' + ] +} + params { config_profile_name = 'Test profile Novaseq data' config_profile_description = 'Minimal test dataset to check pipeline function with Novaseq data and codon filtering' - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = '6.GB' - max_time = '6.h' - // Input data input = params.pipelines_testdata_base_path + "ampliseq/samplesheets/Samplesheet_novaseq.tsv" illumina_novaseq = true diff --git a/conf/test_pacbio_its.config b/conf/test_pacbio_its.config index 64d89ea8..65350d17 100644 --- a/conf/test_pacbio_its.config +++ b/conf/test_pacbio_its.config @@ -10,15 +10,18 @@ ---------------------------------------------------------------------------------------- */ +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '2.h' + ] +} + params { config_profile_name = 'Test profile PacBio ITS' config_profile_description = 'Minimal test dataset to check pipeline function with PacBio ITS sequences and options --cut_its (set to "full")' - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = '6.GB' - max_time = '6.h' - // Input data FW_primer = "CTTGGTCATTTAGAGGAAGTAA" RV_primer = "TCCTGAGGGAAACTTCG" diff --git a/conf/test_pplace.config b/conf/test_pplace.config index e47861e0..702fd29e 100644 --- a/conf/test_pplace.config +++ b/conf/test_pplace.config @@ -10,15 +10,18 @@ ---------------------------------------------------------------------------------------- */ +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '2.h' + ] +} + params { config_profile_name = 'Test profile' config_profile_description = 'Minimal test dataset to check pipeline function' - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = '6.GB' - max_time = '6.h' - // Input data FW_primer = "GTGYCAGCMGCCGCGGTAA" RV_primer = "GGACTACNVGGGTWTCTAAT" diff --git a/conf/test_qiimecustom.config b/conf/test_qiimecustom.config index e3358fa0..bc2e9b65 100644 --- a/conf/test_qiimecustom.config +++ b/conf/test_qiimecustom.config @@ -10,22 +10,25 @@ ---------------------------------------------------------------------------------------- */ +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '2.h' + ] +} + params { config_profile_name = 'Test custom QIIME2 reference taxonomy database profile' config_profile_description = 'Minimal test dataset to check --qiime_ref_tax_custom' - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = '6.GB' - max_time = '6.h' - // Input data FW_primer = "GTGYCAGCMGCCGCGGTAA" RV_primer = "GGACTACNVGGGTWTCTAAT" input = params.pipelines_testdata_base_path + "ampliseq/samplesheets/Samplesheet.tsv" // Custom reference taxonomy - qiime_ref_tax_custom = params.pipelines_testdata_base_path + "ampliseq/testdata/85_greengenes.fna.gz,https://raw.githubusercontent.com/nf-core/test-datasets/ampliseq/testdata/85_greengenes.tax.gz" + qiime_ref_tax_custom = params.pipelines_testdata_base_path + "ampliseq/testdata/85_greengenes.fna.gz," + params.pipelines_testdata_base_path + "ampliseq/testdata/85_greengenes.tax.gz" // Skip downstream analysis with QIIME2 skip_qiime_downstream = true diff --git a/conf/test_reftaxcustom.config b/conf/test_reftaxcustom.config index fa779ff5..c87f1ab9 100644 --- a/conf/test_reftaxcustom.config +++ b/conf/test_reftaxcustom.config @@ -10,15 +10,18 @@ ---------------------------------------------------------------------------------------- */ +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '2.h' + ] +} + params { config_profile_name = 'Test custom DADA2 reference taxonomy database profile' config_profile_description = 'Minimal test dataset to check --dada_ref_tax_custom' - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = '6.GB' - max_time = '6.h' - // Input data FW_primer = "GTGYCAGCMGCCGCGGTAA" RV_primer = "GGACTACNVGGGTWTCTAAT" diff --git a/conf/test_single.config b/conf/test_single.config index 3470f5c5..e6cf47e4 100644 --- a/conf/test_single.config +++ b/conf/test_single.config @@ -10,15 +10,18 @@ ---------------------------------------------------------------------------------------- */ +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '2.h' + ] +} + params { config_profile_name = 'Test profile for SE reads' config_profile_description = 'Minimal test dataset to check pipeline function for single end Illumina sequences' - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = '6.GB' - max_time = '6.h' - // Input data FW_primer = "GTGYCAGCMGCCGCGGTAA" RV_primer = "GGACTACNVGGGTWTCTAAT" diff --git a/conf/test_sintax.config b/conf/test_sintax.config index 9f1c4f04..dea7c41b 100644 --- a/conf/test_sintax.config +++ b/conf/test_sintax.config @@ -10,15 +10,18 @@ ---------------------------------------------------------------------------------------- */ +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '2.h' + ] +} + params { config_profile_name = 'Test sintax profile' config_profile_description = 'Minimal test dataset to check pipeline function when using sintax for taxonomy assignment' - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = '6.GB' - max_time = '6.h' - // Input data FW_primer = "CTTGGTCATTTAGAGGAAGTAA" RV_primer = "TCCTGAGGGAAACTTCG" diff --git a/docs/usage.md b/docs/usage.md index a53a925b..0ca85af0 100644 --- a/docs/usage.md +++ b/docs/usage.md @@ -86,9 +86,9 @@ The above pipeline run specified with a params file in yaml format: nextflow run nf-core/ampliseq -profile docker -params-file params.yaml ``` -with `params.yaml` containing: +with: -```yaml +```yaml title="params.yaml" input: "samplesheet.tsv" FW_primer: "GTGYCAGCMGCCGCGGTAA" RV_primer: "GGACTACNVGGGTWTCTAAT" @@ -414,14 +414,6 @@ See the main [Nextflow documentation](https://www.nextflow.io/docs/latest/config If you have any questions or issues please send us a message on [Slack](https://nf-co.re/join/slack) on the [`#configs` channel](https://nfcore.slack.com/channels/configs). -## Azure Resource Requests - -To be used with the `azurebatch` profile by specifying the `-profile azurebatch`. -We recommend providing a compute `params.vm_type` of `Standard_D16_v3` VMs by default but these options can be changed if required. - -Note that the choice of VM size depends on your quota and the overall workload during the analysis. -For a thorough list, please refer the [Azure Sizes for virtual machines in Azure](https://docs.microsoft.com/en-us/azure/virtual-machines/sizes). - ## Running in the background Nextflow handles job submissions and supervises the running jobs. The Nextflow process must run until the pipeline is finished. diff --git a/main.nf b/main.nf index d3de3de5..001bbc94 100644 --- a/main.nf +++ b/main.nf @@ -9,8 +9,6 @@ ---------------------------------------------------------------------------------------- */ -nextflow.enable.dsl = 2 - /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ IMPORT FUNCTIONS / MODULES / SUBWORKFLOWS / WORKFLOWS @@ -41,7 +39,6 @@ workflow NFCORE_AMPLISEQ { emit: multiqc_report = AMPLISEQ.out.multiqc_report // channel: /path/to/multiqc_report.html - } /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ @@ -52,13 +49,11 @@ workflow NFCORE_AMPLISEQ { workflow { main: - // // SUBWORKFLOW: Run initialisation tasks // PIPELINE_INITIALISATION ( params.version, - params.help, params.validate_params, params.monochrome_logs, args, diff --git a/modules.json b/modules.json index 444cbe2c..69d29b25 100644 --- a/modules.json +++ b/modules.json @@ -22,7 +22,7 @@ }, "fastqc": { "branch": "master", - "git_sha": "285a50500f9e02578d90b3ce6382ea3c30216acd", + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", "installed_by": ["modules"] }, "gappa/examineassign": { @@ -73,7 +73,7 @@ }, "multiqc": { "branch": "master", - "git_sha": "b7ebe95761cd389603f9cc0e0dc384c0f663815a", + "git_sha": "cf17ca47590cc578dfb47db1c2a44ef86f89976d", "installed_by": ["modules"] }, "pigz/uncompress": { @@ -113,17 +113,17 @@ }, "utils_nextflow_pipeline": { "branch": "master", - "git_sha": "5caf7640a9ef1d18d765d55339be751bb0969dfa", + "git_sha": "3aa0aec1d52d492fe241919f0c6100ebf0074082", "installed_by": ["subworkflows"] }, "utils_nfcore_pipeline": { "branch": "master", - "git_sha": "92de218a329bfc9a9033116eb5f65fd270e72ba3", + "git_sha": "1b6b9a3338d011367137808b49b923515080e3ba", "installed_by": ["subworkflows"] }, - "utils_nfvalidation_plugin": { + "utils_nfschema_plugin": { "branch": "master", - "git_sha": "5caf7640a9ef1d18d765d55339be751bb0969dfa", + "git_sha": "bbd5a41f4535a8defafe6080e00ea74c45f4f96c", "installed_by": ["subworkflows"] } } diff --git a/modules/nf-core/fastqc/environment.yml b/modules/nf-core/fastqc/environment.yml index 1787b38a..691d4c76 100644 --- a/modules/nf-core/fastqc/environment.yml +++ b/modules/nf-core/fastqc/environment.yml @@ -1,7 +1,5 @@ -name: fastqc channels: - conda-forge - bioconda - - defaults dependencies: - bioconda::fastqc=0.12.1 diff --git a/modules/nf-core/fastqc/main.nf b/modules/nf-core/fastqc/main.nf index d79f1c86..d8989f48 100644 --- a/modules/nf-core/fastqc/main.nf +++ b/modules/nf-core/fastqc/main.nf @@ -26,7 +26,10 @@ process FASTQC { def rename_to = old_new_pairs*.join(' ').join(' ') def renamed_files = old_new_pairs.collect{ old_name, new_name -> new_name }.join(' ') - def memory_in_mb = MemoryUnit.of("${task.memory}").toUnit('MB') + // The total amount of allocated RAM by FastQC is equal to the number of threads defined (--threads) time the amount of RAM defined (--memory) + // https://github.com/s-andrews/FastQC/blob/1faeea0412093224d7f6a07f777fad60a5650795/fastqc#L211-L222 + // Dividing the task.memory by task.cpu allows to stick to requested amount of RAM in the label + def memory_in_mb = MemoryUnit.of("${task.memory}").toUnit('MB') / task.cpus // FastQC memory value allowed range (100 - 10000) def fastqc_memory = memory_in_mb > 10000 ? 10000 : (memory_in_mb < 100 ? 100 : memory_in_mb) diff --git a/modules/nf-core/fastqc/meta.yml b/modules/nf-core/fastqc/meta.yml index ee5507e0..4827da7a 100644 --- a/modules/nf-core/fastqc/meta.yml +++ b/modules/nf-core/fastqc/meta.yml @@ -16,35 +16,44 @@ tools: homepage: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ documentation: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/Help/ licence: ["GPL-2.0-only"] + identifier: biotools:fastqc input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - reads: - type: file - description: | - List of input FastQ files of size 1 and 2 for single-end and paired-end data, - respectively. + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - reads: + type: file + description: | + List of input FastQ files of size 1 and 2 for single-end and paired-end data, + respectively. output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - html: - type: file - description: FastQC report - pattern: "*_{fastqc.html}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.html": + type: file + description: FastQC report + pattern: "*_{fastqc.html}" - zip: - type: file - description: FastQC report archive - pattern: "*_{fastqc.zip}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.zip": + type: file + description: FastQC report archive + pattern: "*_{fastqc.zip}" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@drpatelh" - "@grst" diff --git a/modules/nf-core/fastqc/tests/main.nf.test b/modules/nf-core/fastqc/tests/main.nf.test index 70edae4d..e9d79a07 100644 --- a/modules/nf-core/fastqc/tests/main.nf.test +++ b/modules/nf-core/fastqc/tests/main.nf.test @@ -23,17 +23,14 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - // NOTE The report contains the date inside it, which means that the md5sum is stable per day, but not longer than that. So you can't md5sum it. - // looks like this:
Mon 2 Oct 2023
test.gz
- // https://github.com/nf-core/modules/pull/3903#issuecomment-1743620039 - - { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_single") } + { assert process.success }, + // NOTE The report contains the date inside it, which means that the md5sum is stable per day, but not longer than that. So you can't md5sum it. + // looks like this:
Mon 2 Oct 2023
test.gz
+ // https://github.com/nf-core/modules/pull/3903#issuecomment-1743620039 + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -54,16 +51,14 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, - { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, - { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, - { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, - { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_paired") } + { assert process.success }, + { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, + { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, + { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, + { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, + { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -83,13 +78,11 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_interleaved") } + { assert process.success }, + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -109,13 +102,11 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_bam") } + { assert process.success }, + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -138,22 +129,20 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, - { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, - { assert process.out.html[0][1][2] ==~ ".*/test_3_fastqc.html" }, - { assert process.out.html[0][1][3] ==~ ".*/test_4_fastqc.html" }, - { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, - { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, - { assert process.out.zip[0][1][2] ==~ ".*/test_3_fastqc.zip" }, - { assert process.out.zip[0][1][3] ==~ ".*/test_4_fastqc.zip" }, - { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][2]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][3]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_multiple") } + { assert process.success }, + { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, + { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, + { assert process.out.html[0][1][2] ==~ ".*/test_3_fastqc.html" }, + { assert process.out.html[0][1][3] ==~ ".*/test_4_fastqc.html" }, + { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, + { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, + { assert process.out.zip[0][1][2] ==~ ".*/test_3_fastqc.zip" }, + { assert process.out.zip[0][1][3] ==~ ".*/test_4_fastqc.zip" }, + { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][2]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][3]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -173,21 +162,18 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - { assert process.out.html[0][1] ==~ ".*/mysample_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/mysample_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_custom_prefix") } + { assert process.success }, + { assert process.out.html[0][1] ==~ ".*/mysample_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/mysample_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } test("sarscov2 single-end [fastq] - stub") { - options "-stub" - + options "-stub" when { process { """ @@ -201,12 +187,123 @@ nextflow_process { then { assertAll ( - { assert process.success }, - { assert snapshot(process.out.html.collect { file(it[1]).getName() } + - process.out.zip.collect { file(it[1]).getName() } + - process.out.versions ).match("fastqc_stub") } + { assert process.success }, + { assert snapshot(process.out).match() } ) } } + test("sarscov2 paired-end [fastq] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 interleaved [fastq] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 paired-end [bam] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 multiple [fastq] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 custom_prefix - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id:'mysample', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } } diff --git a/modules/nf-core/fastqc/tests/main.nf.test.snap b/modules/nf-core/fastqc/tests/main.nf.test.snap index 86f7c311..d5db3092 100644 --- a/modules/nf-core/fastqc/tests/main.nf.test.snap +++ b/modules/nf-core/fastqc/tests/main.nf.test.snap @@ -1,88 +1,392 @@ { - "fastqc_versions_interleaved": { + "sarscov2 custom_prefix": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:40:07.293713" + "timestamp": "2024-07-22T11:02:16.374038" }, - "fastqc_stub": { + "sarscov2 single-end [fastq] - stub": { "content": [ - [ - "test.html", - "test.zip", - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ] + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": true + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": true + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:02:24.993809" + }, + "sarscov2 custom_prefix - stub": { + "content": [ + { + "0": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:31:01.425198" + "timestamp": "2024-07-22T11:03:10.93942" }, - "fastqc_versions_multiple": { + "sarscov2 interleaved [fastq]": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:40:55.797907" + "timestamp": "2024-07-22T11:01:42.355718" }, - "fastqc_versions_bam": { + "sarscov2 paired-end [bam]": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:40:26.795862" + "timestamp": "2024-07-22T11:01:53.276274" }, - "fastqc_versions_single": { + "sarscov2 multiple [fastq]": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:39:27.043675" + "timestamp": "2024-07-22T11:02:05.527626" }, - "fastqc_versions_paired": { + "sarscov2 paired-end [fastq]": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:01:31.188871" + }, + "sarscov2 paired-end [fastq] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:02:34.273566" + }, + "sarscov2 multiple [fastq] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:39:47.584191" + "timestamp": "2024-07-22T11:03:02.304411" }, - "fastqc_versions_custom_prefix": { + "sarscov2 single-end [fastq]": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:01:19.095607" + }, + "sarscov2 interleaved [fastq] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:02:44.640184" + }, + "sarscov2 paired-end [bam] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:41:14.576531" + "timestamp": "2024-07-22T11:02:53.550742" } } \ No newline at end of file diff --git a/modules/nf-core/multiqc/environment.yml b/modules/nf-core/multiqc/environment.yml index ca39fb67..6f5b867b 100644 --- a/modules/nf-core/multiqc/environment.yml +++ b/modules/nf-core/multiqc/environment.yml @@ -1,7 +1,5 @@ -name: multiqc channels: - conda-forge - bioconda - - defaults dependencies: - - bioconda::multiqc=1.21 + - bioconda::multiqc=1.25.1 diff --git a/modules/nf-core/multiqc/main.nf b/modules/nf-core/multiqc/main.nf index 47ac352f..cc0643e1 100644 --- a/modules/nf-core/multiqc/main.nf +++ b/modules/nf-core/multiqc/main.nf @@ -3,14 +3,16 @@ process MULTIQC { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/multiqc:1.21--pyhdfd78af_0' : - 'biocontainers/multiqc:1.21--pyhdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/multiqc:1.25.1--pyhdfd78af_0' : + 'biocontainers/multiqc:1.25.1--pyhdfd78af_0' }" input: path multiqc_files, stageAs: "?/*" path(multiqc_config) path(extra_multiqc_config) path(multiqc_logo) + path(replace_names) + path(sample_names) output: path "*multiqc_report.html", emit: report @@ -23,16 +25,22 @@ process MULTIQC { script: def args = task.ext.args ?: '' + def prefix = task.ext.prefix ? "--filename ${task.ext.prefix}.html" : '' def config = multiqc_config ? "--config $multiqc_config" : '' def extra_config = extra_multiqc_config ? "--config $extra_multiqc_config" : '' - def logo = multiqc_logo ? /--cl-config 'custom_logo: "${multiqc_logo}"'/ : '' + def logo = multiqc_logo ? "--cl-config 'custom_logo: \"${multiqc_logo}\"'" : '' + def replace = replace_names ? "--replace-names ${replace_names}" : '' + def samples = sample_names ? "--sample-names ${sample_names}" : '' """ multiqc \\ --force \\ $args \\ $config \\ + $prefix \\ $extra_config \\ $logo \\ + $replace \\ + $samples \\ . cat <<-END_VERSIONS > versions.yml @@ -44,7 +52,7 @@ process MULTIQC { stub: """ mkdir multiqc_data - touch multiqc_plots + mkdir multiqc_plots touch multiqc_report.html cat <<-END_VERSIONS > versions.yml diff --git a/modules/nf-core/multiqc/meta.yml b/modules/nf-core/multiqc/meta.yml index 45a9bc35..b16c1879 100644 --- a/modules/nf-core/multiqc/meta.yml +++ b/modules/nf-core/multiqc/meta.yml @@ -1,5 +1,6 @@ name: multiqc -description: Aggregate results from bioinformatics analyses across many samples into a single report +description: Aggregate results from bioinformatics analyses across many samples into + a single report keywords: - QC - bioinformatics tools @@ -12,40 +13,59 @@ tools: homepage: https://multiqc.info/ documentation: https://multiqc.info/docs/ licence: ["GPL-3.0-or-later"] + identifier: biotools:multiqc input: - - multiqc_files: - type: file - description: | - List of reports / files recognised by MultiQC, for example the html and zip output of FastQC - - multiqc_config: - type: file - description: Optional config yml for MultiQC - pattern: "*.{yml,yaml}" - - extra_multiqc_config: - type: file - description: Second optional config yml for MultiQC. Will override common sections in multiqc_config. - pattern: "*.{yml,yaml}" - - multiqc_logo: - type: file - description: Optional logo file for MultiQC - pattern: "*.{png}" + - - multiqc_files: + type: file + description: | + List of reports / files recognised by MultiQC, for example the html and zip output of FastQC + - - multiqc_config: + type: file + description: Optional config yml for MultiQC + pattern: "*.{yml,yaml}" + - - extra_multiqc_config: + type: file + description: Second optional config yml for MultiQC. Will override common sections + in multiqc_config. + pattern: "*.{yml,yaml}" + - - multiqc_logo: + type: file + description: Optional logo file for MultiQC + pattern: "*.{png}" + - - replace_names: + type: file + description: | + Optional two-column sample renaming file. First column a set of + patterns, second column a set of corresponding replacements. Passed via + MultiQC's `--replace-names` option. + pattern: "*.{tsv}" + - - sample_names: + type: file + description: | + Optional TSV file with headers, passed to the MultiQC --sample_names + argument. + pattern: "*.{tsv}" output: - report: - type: file - description: MultiQC report file - pattern: "multiqc_report.html" + - "*multiqc_report.html": + type: file + description: MultiQC report file + pattern: "multiqc_report.html" - data: - type: directory - description: MultiQC data dir - pattern: "multiqc_data" + - "*_data": + type: directory + description: MultiQC data dir + pattern: "multiqc_data" - plots: - type: file - description: Plots created by MultiQC - pattern: "*_data" + - "*_plots": + type: file + description: Plots created by MultiQC + pattern: "*_data" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@abhi18av" - "@bunop" diff --git a/modules/nf-core/multiqc/tests/main.nf.test b/modules/nf-core/multiqc/tests/main.nf.test index f1c4242e..33316a7d 100644 --- a/modules/nf-core/multiqc/tests/main.nf.test +++ b/modules/nf-core/multiqc/tests/main.nf.test @@ -8,6 +8,8 @@ nextflow_process { tag "modules_nfcore" tag "multiqc" + config "./nextflow.config" + test("sarscov2 single-end [fastqc]") { when { @@ -17,6 +19,8 @@ nextflow_process { input[1] = [] input[2] = [] input[3] = [] + input[4] = [] + input[5] = [] """ } } @@ -41,6 +45,8 @@ nextflow_process { input[1] = Channel.of(file("https://github.com/nf-core/tools/raw/dev/nf_core/pipeline-template/assets/multiqc_config.yml", checkIfExists: true)) input[2] = [] input[3] = [] + input[4] = [] + input[5] = [] """ } } @@ -66,6 +72,8 @@ nextflow_process { input[1] = [] input[2] = [] input[3] = [] + input[4] = [] + input[5] = [] """ } } diff --git a/modules/nf-core/multiqc/tests/main.nf.test.snap b/modules/nf-core/multiqc/tests/main.nf.test.snap index bfebd802..2fcbb5ff 100644 --- a/modules/nf-core/multiqc/tests/main.nf.test.snap +++ b/modules/nf-core/multiqc/tests/main.nf.test.snap @@ -2,14 +2,14 @@ "multiqc_versions_single": { "content": [ [ - "versions.yml:md5,21f35ee29416b9b3073c28733efe4b7d" + "versions.yml:md5,41f391dcedce7f93ca188f3a3ffa0916" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-02-29T08:48:55.657331" + "timestamp": "2024-10-02T17:51:46.317523" }, "multiqc_stub": { "content": [ @@ -17,25 +17,25 @@ "multiqc_report.html", "multiqc_data", "multiqc_plots", - "versions.yml:md5,21f35ee29416b9b3073c28733efe4b7d" + "versions.yml:md5,41f391dcedce7f93ca188f3a3ffa0916" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-02-29T08:49:49.071937" + "timestamp": "2024-10-02T17:52:20.680978" }, "multiqc_versions_config": { "content": [ [ - "versions.yml:md5,21f35ee29416b9b3073c28733efe4b7d" + "versions.yml:md5,41f391dcedce7f93ca188f3a3ffa0916" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.4" }, - "timestamp": "2024-02-29T08:49:25.457567" + "timestamp": "2024-10-02T17:52:09.185842" } } \ No newline at end of file diff --git a/modules/nf-core/multiqc/tests/nextflow.config b/modules/nf-core/multiqc/tests/nextflow.config new file mode 100644 index 00000000..c537a6a3 --- /dev/null +++ b/modules/nf-core/multiqc/tests/nextflow.config @@ -0,0 +1,5 @@ +process { + withName: 'MULTIQC' { + ext.prefix = null + } +} diff --git a/nextflow.config b/nextflow.config index 5fadb327..2f85acd9 100644 --- a/nextflow.config +++ b/nextflow.config @@ -143,48 +143,27 @@ params { monochrome_logs = false hook_url = null help = false + help_full = false + show_hidden = false version = false pipelines_testdata_base_path = 'https://raw.githubusercontent.com/nf-core/test-datasets/' // Config options config_profile_name = null config_profile_description = null + custom_config_version = 'master' custom_config_base = "https://raw.githubusercontent.com/nf-core/configs/${params.custom_config_version}" config_profile_contact = null config_profile_url = null - // Max resource options - // Defaults only, expecting to be overwritten - max_memory = '128.GB' - max_cpus = 16 - max_time = '240.h' - // Schema validation default options - validationFailUnrecognisedParams = false - validationLenientMode = false - validationSchemaIgnoreParams = 'dada_ref_databases,qiime_ref_databases,sintax_ref_databases,kraken2_ref_databases,sidle_ref_databases,genomes,igenomes_base' - validationShowHiddenParams = false - validate_params = true - + validate_params = true } // Load base.config by default for all pipelines includeConfig 'conf/base.config' -// Load nf-core custom profiles from different Institutions -try { - includeConfig "${params.custom_config_base}/nfcore_custom.config" -} catch (Exception e) { - System.err.println("WARNING: Could not load nf-core/config profiles: ${params.custom_config_base}/nfcore_custom.config") -} - -// Load nf-core/ampliseq custom profiles from different institutions. -try { - includeConfig "${params.custom_config_base}/pipeline/ampliseq.config" -} catch (Exception e) { - System.err.println("WARNING: Could not load nf-core/config/ampliseq profiles: ${params.custom_config_base}/pipeline/ampliseq.config") -} profiles { debug { dumpHashes = true @@ -199,7 +178,7 @@ profiles { podman.enabled = false shifter.enabled = false charliecloud.enabled = false - conda.channels = ['conda-forge', 'bioconda', 'defaults'] + conda.channels = ['conda-forge', 'bioconda'] apptainer.enabled = false } mamba { @@ -302,18 +281,21 @@ profiles { test_multiregion { includeConfig 'conf/test_multiregion.config' } } -// Set default registry for Apptainer, Docker, Podman and Singularity independent of -profile -// Will not be used unless Apptainer / Docker / Podman / Singularity are enabled -// Set to your registry if you have a mirror of containers -apptainer.registry = 'quay.io' -docker.registry = 'quay.io' -podman.registry = 'quay.io' -singularity.registry = 'quay.io' +// Load nf-core custom profiles from different Institutions +includeConfig !System.getenv('NXF_OFFLINE') && params.custom_config_base ? "${params.custom_config_base}/nfcore_custom.config" : "/dev/null" -// Nextflow plugins -plugins { - id 'nf-validation@1.1.3' // Validation of pipeline parameters and creation of an input channel from a sample sheet -} +// Load nf-core/ampliseq custom profiles from different institutions. +// nf-core: Optionally, you can add a pipeline-specific nf-core config at https://github.com/nf-core/configs +// includeConfig !System.getenv('NXF_OFFLINE') && params.custom_config_base ? "${params.custom_config_base}/pipeline/ampliseq.config" : "/dev/null" + +// Set default registry for Apptainer, Docker, Podman, Charliecloud and Singularity independent of -profile +// Will not be used unless Apptainer / Docker / Podman / Charliecloud / Singularity are enabled +// Set to your registry if you have a mirror of containers +apptainer.registry = 'quay.io' +docker.registry = 'quay.io' +podman.registry = 'quay.io' +singularity.registry = 'quay.io' +charliecloud.registry = 'quay.io' // Export these variables to prevent local Python/R libraries from conflicting with those in the container // The JULIA depot path has been adjusted to a fixed path `/usr/local/share/julia` that needs to be used for packages in the container. @@ -326,8 +308,15 @@ env { JULIA_DEPOT_PATH = "/usr/local/share/julia" } -// Capture exit codes from upstream processes when piping -process.shell = ['/bin/bash', '-euo', 'pipefail'] +// Set bash options +process.shell = """\ +bash + +set -e # Exit if a tool returns a non-zero status/exit code +set -u # Treat unset variables and parameters as an error +set -o pipefail # Returns the status of the last command to exit with a non-zero status or zero if all successfully execute +set -C # No clobber - prevent output redirection from overwriting files. +""" // Disable process selector warnings by default. Use debug profile to enable warnings. nextflow.enable.configProcessNamesValidation = false @@ -356,46 +345,49 @@ manifest { homePage = 'https://github.com/nf-core/ampliseq' description = """Amplicon sequencing analysis workflow using DADA2 and QIIME2""" mainScript = 'main.nf' - nextflowVersion = '!>=23.04.0' + nextflowVersion = '!>=24.04.2' version = '2.12.0dev' doi = '10.5281/zenodo.1493841,10.3389/fmicb.2020.550420' } -// Load modules.config for DSL2 module specific options -includeConfig 'conf/modules.config' +// Nextflow plugins +plugins { + id 'nf-schema@2.1.1' // Validation of pipeline parameters and creation of an input channel from a sample sheet +} -// Load ref_databases.config for reference taxonomy -includeConfig 'conf/ref_databases.config' +validation { + defaultIgnoreParams = ["genomes","igenomes_base","dada_ref_databases","qiime_ref_databases","sintax_ref_databases","kraken2_ref_databases","sidle_ref_databases"] + help { + enabled = true + command = "nextflow run $manifest.name -profile --input samplesheet.csv --outdir " + fullParameter = "help_full" + showHiddenParameter = "show_hidden" + beforeText = """ +-\033[2m----------------------------------------------------\033[0m- + \033[0;32m,--.\033[0;30m/\033[0;32m,-.\033[0m +\033[0;34m ___ __ __ __ ___ \033[0;32m/,-._.--~\'\033[0m +\033[0;34m |\\ | |__ __ / ` / \\ |__) |__ \033[0;33m} {\033[0m +\033[0;34m | \\| | \\__, \\__/ | \\ |___ \033[0;32m\\`-._,-`-,\033[0m + \033[0;32m`._,._,\'\033[0m +\033[0;35m ${manifest.name} ${manifest.version}\033[0m +-\033[2m----------------------------------------------------\033[0m- +""" + afterText = """${manifest.doi ? "* The pipeline\n" : ""}${manifest.doi.tokenize(",").collect { " https://doi.org/${it.trim().replace('https://doi.org/','')}"}.join("\n")}${manifest.doi ? "\n" : ""} +* The nf-core framework + https://doi.org/10.1038/s41587-020-0439-x -// Function to ensure that resource requirements don't go beyond -// a maximum limit -def check_max(obj, type) { - if (type == 'memory') { - try { - if (obj.compareTo(params.max_memory as nextflow.util.MemoryUnit) == 1) - return params.max_memory as nextflow.util.MemoryUnit - else - return obj - } catch (all) { - println " ### ERROR ### Max memory '${params.max_memory}' is not valid! Using default value: $obj" - return obj - } - } else if (type == 'time') { - try { - if (obj.compareTo(params.max_time as nextflow.util.Duration) == 1) - return params.max_time as nextflow.util.Duration - else - return obj - } catch (all) { - println " ### ERROR ### Max time '${params.max_time}' is not valid! Using default value: $obj" - return obj - } - } else if (type == 'cpus') { - try { - return Math.min( obj, params.max_cpus as int ) - } catch (all) { - println " ### ERROR ### Max cpus '${params.max_cpus}' is not valid! Using default value: $obj" - return obj - } +* Software dependencies + https://github.com/${manifest.name}/blob/master/CITATIONS.md +""" + } + summary { + beforeText = validation.help.beforeText + afterText = validation.help.afterText } } + +// Load ref_databases.config for reference taxonomy +includeConfig 'conf/ref_databases.config' + +// Load modules.config for DSL2 module specific options +includeConfig 'conf/modules.config' diff --git a/nextflow_schema.json b/nextflow_schema.json index ccef5f95..8ceba7b9 100644 --- a/nextflow_schema.json +++ b/nextflow_schema.json @@ -1,10 +1,10 @@ { - "$schema": "http://json-schema.org/draft-07/schema", + "$schema": "https://json-schema.org/draft/2020-12/schema", "$id": "https://raw.githubusercontent.com/nf-core/ampliseq/master/nextflow_schema.json", "title": "nf-core/ampliseq pipeline parameters", "description": "Amplicon sequencing analysis workflow using DADA2 and QIIME2", "type": "object", - "definitions": { + "$defs": { "input_output_options": { "title": "Main arguments", "type": "object", @@ -809,12 +809,6 @@ "default": 100, "description": "Specifies the random seed." }, - "help": { - "type": "boolean", - "description": "Display help text.", - "fa_icon": "fas fa-question-circle", - "hidden": true - }, "version": { "type": "boolean", "description": "Display version and exit.", @@ -890,27 +884,6 @@ "fa_icon": "fas fa-check-square", "hidden": true }, - "validationShowHiddenParams": { - "type": "boolean", - "fa_icon": "far fa-eye-slash", - "description": "Show all params when using `--help`", - "hidden": true, - "help_text": "By default, parameters set as _hidden_ in the schema are not shown on the command line when a user runs with `--help`. Specifying this option will tell the pipeline to show all parameters." - }, - "validationFailUnrecognisedParams": { - "type": "boolean", - "fa_icon": "far fa-check-circle", - "description": "Validation of parameters fails when an unrecognised parameter is found.", - "hidden": true, - "help_text": "By default, when an unrecognised parameter is found, it returns a warning." - }, - "validationLenientMode": { - "type": "boolean", - "fa_icon": "far fa-check-circle", - "description": "Validation of parameters in lenient more.", - "hidden": true, - "help_text": "Allows string values that are parseable as numbers or booleans. For further information see [JSONSchema docs](https://github.com/everit-org/json-schema#lenient-mode)." - }, "pipelines_testdata_base_path": { "type": "string", "fa_icon": "far fa-check-circle", @@ -920,38 +893,6 @@ } } }, - "max_job_request_options": { - "title": "Max job request options", - "type": "object", - "fa_icon": "fab fa-acquisitions-incorporated", - "description": "Set the top limit for requested resources for any single job.", - "help_text": "If you are running on a smaller system, a pipeline step requesting more resources than are available may cause the Nextflow to stop the run with an error. These options allow you to cap the maximum resources requested by any single job so that the pipeline will run on your system.\n\nNote that you can not _increase_ the resources requested by any job using these options. For that you will need your own configuration file. See [the nf-core website](https://nf-co.re/usage/configuration) for details.", - "properties": { - "max_cpus": { - "type": "integer", - "description": "Maximum number of CPUs that can be requested for any single job.", - "default": 16, - "fa_icon": "fas fa-microchip", - "help_text": "Use to set an upper-limit for the CPU requirement for each process. Should be an integer e.g. `--max_cpus 1`" - }, - "max_memory": { - "type": "string", - "description": "Maximum amount of memory that can be requested for any single job.", - "default": "128.GB", - "fa_icon": "fas fa-memory", - "pattern": "^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$", - "help_text": "Use to set an upper-limit for the memory requirement for each process. Should be a string in the format integer-unit e.g. `--max_memory '8.GB'`" - }, - "max_time": { - "type": "string", - "description": "Maximum amount of time that can be requested for any single job.", - "default": "240.h", - "fa_icon": "far fa-clock", - "pattern": "^(\\d+\\.?\\s*(s|m|h|d|day)\\s*)+$", - "help_text": "Use to set an upper-limit for the time requirement for each process. Should be a string in the format integer-unit e.g. `--max_time '2.h'`" - } - } - }, "institutional_config_options": { "title": "Institutional config options", "type": "object", @@ -1009,52 +950,49 @@ }, "allOf": [ { - "$ref": "#/definitions/input_output_options" - }, - { - "$ref": "#/definitions/sequencing_input" + "$ref": "#/$defs/input_output_options" }, { - "$ref": "#/definitions/primer_removal" + "$ref": "#/$defs/sequencing_input" }, { - "$ref": "#/definitions/read_trimming_and_quality_filtering" + "$ref": "#/$defs/primer_removal" }, { - "$ref": "#/definitions/amplicon_sequence_variants_asv_calculation" + "$ref": "#/$defs/read_trimming_and_quality_filtering" }, { - "$ref": "#/definitions/asv_post_processing" + "$ref": "#/$defs/amplicon_sequence_variants_asv_calculation" }, { - "$ref": "#/definitions/taxonomic_database" + "$ref": "#/$defs/asv_post_processing" }, { - "$ref": "#/definitions/multiregion_taxonomic_database" + "$ref": "#/$defs/taxonomic_database" }, { - "$ref": "#/definitions/asv_filtering" + "$ref": "#/$defs/multiregion_taxonomic_database" }, { - "$ref": "#/definitions/downstream_analysis" + "$ref": "#/$defs/asv_filtering" }, { - "$ref": "#/definitions/differential_abundance_analysis" + "$ref": "#/$defs/downstream_analysis" }, { - "$ref": "#/definitions/pipeline_report" + "$ref": "#/$defs/differential_abundance_analysis" }, { - "$ref": "#/definitions/skipping_specific_steps" + "$ref": "#/$defs/pipeline_report" }, { - "$ref": "#/definitions/generic_options" + "$ref": "#/$defs/skipping_specific_steps" }, { - "$ref": "#/definitions/max_job_request_options" + "$ref": "#/$defs/generic_options" }, { - "$ref": "#/definitions/institutional_config_options" + "$ref": "#/$defs/institutional_config_options" } ] } diff --git a/subworkflows/local/utils_nfcore_ampliseq_pipeline/main.nf b/subworkflows/local/utils_nfcore_ampliseq_pipeline/main.nf index 6180ebd2..52da55d4 100644 --- a/subworkflows/local/utils_nfcore_ampliseq_pipeline/main.nf +++ b/subworkflows/local/utils_nfcore_ampliseq_pipeline/main.nf @@ -8,29 +8,25 @@ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ -include { UTILS_NFVALIDATION_PLUGIN } from '../../nf-core/utils_nfvalidation_plugin' -include { paramsSummaryMap } from 'plugin/nf-validation' -include { fromSamplesheet } from 'plugin/nf-validation' -include { UTILS_NEXTFLOW_PIPELINE } from '../../nf-core/utils_nextflow_pipeline' +include { UTILS_NFSCHEMA_PLUGIN } from '../../nf-core/utils_nfschema_plugin' +include { paramsSummaryMap } from 'plugin/nf-schema' +include { samplesheetToList } from 'plugin/nf-schema' include { completionEmail } from '../../nf-core/utils_nfcore_pipeline' include { completionSummary } from '../../nf-core/utils_nfcore_pipeline' -include { dashedLine } from '../../nf-core/utils_nfcore_pipeline' -include { nfCoreLogo } from '../../nf-core/utils_nfcore_pipeline' include { imNotification } from '../../nf-core/utils_nfcore_pipeline' include { UTILS_NFCORE_PIPELINE } from '../../nf-core/utils_nfcore_pipeline' -include { workflowCitation } from '../../nf-core/utils_nfcore_pipeline' +include { UTILS_NEXTFLOW_PIPELINE } from '../../nf-core/utils_nextflow_pipeline' /* -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ SUBWORKFLOW TO INITIALISE PIPELINE -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ workflow PIPELINE_INITIALISATION { take: version // boolean: Display version and exit - help // boolean: Display help text validate_params // boolean: Boolean whether to validate parameters against the schema at runtime monochrome_logs // boolean: Do not use coloured log outputs nextflow_cli_args // array: List of positional nextflow CLI args @@ -53,16 +49,10 @@ workflow PIPELINE_INITIALISATION { // // Validate parameters and generate parameter summary to stdout // - pre_help_text = nfCoreLogo(monochrome_logs) - post_help_text = '\n' + workflowCitation() + '\n' + dashedLine(monochrome_logs) - def String workflow_command = "nextflow run ${workflow.manifest.name} -profile --input samplesheet.csv --outdir " - UTILS_NFVALIDATION_PLUGIN ( - help, - workflow_command, - pre_help_text, - post_help_text, + UTILS_NFSCHEMA_PLUGIN ( + workflow, validate_params, - "nextflow_schema.json" + null ) // @@ -71,6 +61,7 @@ workflow PIPELINE_INITIALISATION { UTILS_NFCORE_PIPELINE ( nextflow_cli_args ) + // // Custom validation for pipeline parameters // @@ -97,9 +88,9 @@ workflow PIPELINE_INITIALISATION { } /* -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ SUBWORKFLOW FOR PIPELINE COMPLETION -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ workflow PIPELINE_COMPLETION { @@ -114,7 +105,6 @@ workflow PIPELINE_COMPLETION { multiqc_report // string: Path to MultiQC report main: - summary_params = paramsSummaryMap(workflow, parameters_schema: "nextflow_schema.json") // @@ -122,11 +112,18 @@ workflow PIPELINE_COMPLETION { // workflow.onComplete { if (email || email_on_fail) { - completionEmail(summary_params, email, email_on_fail, plaintext_email, outdir, monochrome_logs, multiqc_report.toList()) + completionEmail( + summary_params, + email, + email_on_fail, + plaintext_email, + outdir, + monochrome_logs, + multiqc_report.toList() + ) } completionSummary(monochrome_logs) - if (hook_url) { imNotification(summary_params, hook_url) } @@ -138,9 +135,9 @@ workflow PIPELINE_COMPLETION { } /* -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ FUNCTIONS -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ // // Check and validate pipeline parameters @@ -364,7 +361,6 @@ def sidlereftaxonomyExistsError() { error(error_string) } } - // // Validate channels from input samplesheet // @@ -421,8 +417,10 @@ def methodsDescriptionText(mqc_methods_yaml) { // Removing `https://doi.org/` to handle pipelines using DOIs vs DOI resolvers // Removing ` ` since the manifest.doi is a string and not a proper list def temp_doi_ref = "" - String[] manifest_doi = meta.manifest_map.doi.tokenize(",") - for (String doi_ref: manifest_doi) temp_doi_ref += "(doi: ${doi_ref.replace("https://doi.org/", "").replace(" ", "")}), " + def manifest_doi = meta.manifest_map.doi.tokenize(",") + manifest_doi.each { doi_ref -> + temp_doi_ref += "(doi: ${doi_ref.replace("https://doi.org/", "").replace(" ", "")}), " + } meta["doi_text"] = temp_doi_ref.substring(0, temp_doi_ref.length() - 2) } else meta["doi_text"] = "" meta["nodoi_text"] = meta.manifest_map.doi ? "" : "
  • If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
  • " @@ -443,3 +441,4 @@ def methodsDescriptionText(mqc_methods_yaml) { return description_html.toString() } + diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/main.nf b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf index ac31f28f..0fcbf7b3 100644 --- a/subworkflows/nf-core/utils_nextflow_pipeline/main.nf +++ b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf @@ -2,18 +2,13 @@ // Subworkflow with functionality that may be useful for any Nextflow pipeline // -import org.yaml.snakeyaml.Yaml -import groovy.json.JsonOutput -import nextflow.extension.FilesEx - /* -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ SUBWORKFLOW DEFINITION -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ workflow UTILS_NEXTFLOW_PIPELINE { - take: print_version // boolean: print version dump_parameters // boolean: dump parameters @@ -26,7 +21,7 @@ workflow UTILS_NEXTFLOW_PIPELINE { // Print workflow version and exit on --version // if (print_version) { - log.info "${workflow.manifest.name} ${getWorkflowVersion()}" + log.info("${workflow.manifest.name} ${getWorkflowVersion()}") System.exit(0) } @@ -49,16 +44,16 @@ workflow UTILS_NEXTFLOW_PIPELINE { } /* -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ FUNCTIONS -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ // // Generate version string // def getWorkflowVersion() { - String version_string = "" + def version_string = "" as String if (workflow.manifest.version) { def prefix_v = workflow.manifest.version[0] != 'v' ? 'v' : '' version_string += "${prefix_v}${workflow.manifest.version}" @@ -76,13 +71,13 @@ def getWorkflowVersion() { // Dump pipeline parameters to a JSON file // def dumpParametersToJSON(outdir) { - def timestamp = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-ss') - def filename = "params_${timestamp}.json" - def temp_pf = new File(workflow.launchDir.toString(), ".${filename}") - def jsonStr = JsonOutput.toJson(params) - temp_pf.text = JsonOutput.prettyPrint(jsonStr) + def timestamp = new java.util.Date().format('yyyy-MM-dd_HH-mm-ss') + def filename = "params_${timestamp}.json" + def temp_pf = new File(workflow.launchDir.toString(), ".${filename}") + def jsonStr = groovy.json.JsonOutput.toJson(params) + temp_pf.text = groovy.json.JsonOutput.prettyPrint(jsonStr) - FilesEx.copyTo(temp_pf.toPath(), "${outdir}/pipeline_info/params_${timestamp}.json") + nextflow.extension.FilesEx.copyTo(temp_pf.toPath(), "${outdir}/pipeline_info/params_${timestamp}.json") temp_pf.delete() } @@ -90,37 +85,40 @@ def dumpParametersToJSON(outdir) { // When running with -profile conda, warn if channels have not been set-up appropriately // def checkCondaChannels() { - Yaml parser = new Yaml() + def parser = new org.yaml.snakeyaml.Yaml() def channels = [] try { def config = parser.load("conda config --show channels".execute().text) channels = config.channels - } catch(NullPointerException | IOException e) { - log.warn "Could not verify conda channel configuration." - return + } + catch (NullPointerException e) { + log.warn("Could not verify conda channel configuration.") + return null + } + catch (IOException e) { + log.warn("Could not verify conda channel configuration.") + return null } // Check that all channels are present // This channel list is ordered by required channel priority. - def required_channels_in_order = ['conda-forge', 'bioconda', 'defaults'] + def required_channels_in_order = ['conda-forge', 'bioconda'] def channels_missing = ((required_channels_in_order as Set) - (channels as Set)) as Boolean // Check that they are in the right order - def channel_priority_violation = false - def n = required_channels_in_order.size() - for (int i = 0; i < n - 1; i++) { - channel_priority_violation |= !(channels.indexOf(required_channels_in_order[i]) < channels.indexOf(required_channels_in_order[i+1])) - } + def channel_priority_violation = required_channels_in_order != channels.findAll { ch -> ch in required_channels_in_order } if (channels_missing | channel_priority_violation) { - log.warn "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\n" + - " There is a problem with your Conda configuration!\n\n" + - " You will need to set-up the conda-forge and bioconda channels correctly.\n" + - " Please refer to https://bioconda.github.io/\n" + - " The observed channel order is \n" + - " ${channels}\n" + - " but the following channel order is required:\n" + - " ${required_channels_in_order}\n" + - "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~" + log.warn """\ + ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + There is a problem with your Conda configuration! + You will need to set-up the conda-forge and bioconda channels correctly. + Please refer to https://bioconda.github.io/ + The observed channel order is + ${channels} + but the following channel order is required: + ${required_channels_in_order} + ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~" + """.stripIndent(true) } } diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config b/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config index d0a926bf..a09572e5 100644 --- a/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config +++ b/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config @@ -3,7 +3,7 @@ manifest { author = """nf-core""" homePage = 'https://127.0.0.1' description = """Dummy pipeline""" - nextflowVersion = '!>=23.04.0' + nextflowVersion = '!>=23.04.0' version = '9.9.9' doi = 'https://doi.org/10.5281/zenodo.5070524' } diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/main.nf b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf index 14558c39..5cb7bafe 100644 --- a/subworkflows/nf-core/utils_nfcore_pipeline/main.nf +++ b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf @@ -2,17 +2,13 @@ // Subworkflow with utility functions specific to the nf-core pipeline template // -import org.yaml.snakeyaml.Yaml -import nextflow.extension.FilesEx - /* -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ SUBWORKFLOW DEFINITION -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ workflow UTILS_NFCORE_PIPELINE { - take: nextflow_cli_args @@ -25,23 +21,20 @@ workflow UTILS_NFCORE_PIPELINE { } /* -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ FUNCTIONS -======================================================================================== +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ // // Warn if a -profile or Nextflow config has not been provided to run the pipeline // def checkConfigProvided() { - valid_config = true + def valid_config = true as Boolean if (workflow.profile == 'standard' && workflow.configFiles.size() <= 1) { - log.warn "[$workflow.manifest.name] You are attempting to run the pipeline without any custom configuration!\n\n" + - "This will be dependent on your local compute environment but can be achieved via one or more of the following:\n" + - " (1) Using an existing pipeline profile e.g. `-profile docker` or `-profile singularity`\n" + - " (2) Using an existing nf-core/configs for your Institution e.g. `-profile crick` or `-profile uppmax`\n" + - " (3) Using your own local custom config e.g. `-c /path/to/your/custom.config`\n\n" + - "Please refer to the quick start section and usage docs for the pipeline.\n " + log.warn( + "[${workflow.manifest.name}] You are attempting to run the pipeline without any custom configuration!\n\n" + "This will be dependent on your local compute environment but can be achieved via one or more of the following:\n" + " (1) Using an existing pipeline profile e.g. `-profile docker` or `-profile singularity`\n" + " (2) Using an existing nf-core/configs for your Institution e.g. `-profile crick` or `-profile uppmax`\n" + " (3) Using your own local custom config e.g. `-c /path/to/your/custom.config`\n\n" + "Please refer to the quick start section and usage docs for the pipeline.\n " + ) valid_config = false } return valid_config @@ -52,12 +45,14 @@ def checkConfigProvided() { // def checkProfileProvided(nextflow_cli_args) { if (workflow.profile.endsWith(',')) { - error "The `-profile` option cannot end with a trailing comma, please remove it and re-run the pipeline!\n" + - "HINT: A common mistake is to provide multiple values separated by spaces e.g. `-profile test, docker`.\n" + error( + "The `-profile` option cannot end with a trailing comma, please remove it and re-run the pipeline!\n" + "HINT: A common mistake is to provide multiple values separated by spaces e.g. `-profile test, docker`.\n" + ) } if (nextflow_cli_args[0]) { - log.warn "nf-core pipelines do not accept positional arguments. The positional argument `${nextflow_cli_args[0]}` has been detected.\n" + - "HINT: A common mistake is to provide multiple values separated by spaces e.g. `-profile test, docker`.\n" + log.warn( + "nf-core pipelines do not accept positional arguments. The positional argument `${nextflow_cli_args[0]}` has been detected.\n" + "HINT: A common mistake is to provide multiple values separated by spaces e.g. `-profile test, docker`.\n" + ) } } @@ -66,25 +61,21 @@ def checkProfileProvided(nextflow_cli_args) { // def workflowCitation() { def temp_doi_ref = "" - String[] manifest_doi = workflow.manifest.doi.tokenize(",") - // Using a loop to handle multiple DOIs + def manifest_doi = workflow.manifest.doi.tokenize(",") + // Handling multiple DOIs // Removing `https://doi.org/` to handle pipelines using DOIs vs DOI resolvers // Removing ` ` since the manifest.doi is a string and not a proper list - for (String doi_ref: manifest_doi) temp_doi_ref += " https://doi.org/${doi_ref.replace('https://doi.org/', '').replace(' ', '')}\n" - return "If you use ${workflow.manifest.name} for your analysis please cite:\n\n" + - "* The pipeline\n" + - temp_doi_ref + "\n" + - "* The nf-core framework\n" + - " https://doi.org/10.1038/s41587-020-0439-x\n\n" + - "* Software dependencies\n" + - " https://github.com/${workflow.manifest.name}/blob/master/CITATIONS.md" + manifest_doi.each { doi_ref -> + temp_doi_ref += " https://doi.org/${doi_ref.replace('https://doi.org/', '').replace(' ', '')}\n" + } + return "If you use ${workflow.manifest.name} for your analysis please cite:\n\n" + "* The pipeline\n" + temp_doi_ref + "\n" + "* The nf-core framework\n" + " https://doi.org/10.1038/s41587-020-0439-x\n\n" + "* Software dependencies\n" + " https://github.com/${workflow.manifest.name}/blob/master/CITATIONS.md" } // // Generate workflow version string // def getWorkflowVersion() { - String version_string = "" + def version_string = "" as String if (workflow.manifest.version) { def prefix_v = workflow.manifest.version[0] != 'v' ? 'v' : '' version_string += "${prefix_v}${workflow.manifest.version}" @@ -102,8 +93,8 @@ def getWorkflowVersion() { // Get software versions for pipeline // def processVersionsFromYAML(yaml_file) { - Yaml yaml = new Yaml() - versions = yaml.load(yaml_file).collectEntries { k, v -> [ k.tokenize(':')[-1], v ] } + def yaml = new org.yaml.snakeyaml.Yaml() + def versions = yaml.load(yaml_file).collectEntries { k, v -> [k.tokenize(':')[-1], v] } return yaml.dumpAsMap(versions).trim() } @@ -113,8 +104,8 @@ def processVersionsFromYAML(yaml_file) { def workflowVersionToYAML() { return """ Workflow: - $workflow.manifest.name: ${getWorkflowVersion()} - Nextflow: $workflow.nextflow.version + ${workflow.manifest.name}: ${getWorkflowVersion()} + Nextflow: ${workflow.nextflow.version} """.stripIndent().trim() } @@ -122,11 +113,7 @@ def workflowVersionToYAML() { // Get channel of software versions used in pipeline in YAML format // def softwareVersionsToYAML(ch_versions) { - return ch_versions - .unique() - .map { processVersionsFromYAML(it) } - .unique() - .mix(Channel.of(workflowVersionToYAML())) + return ch_versions.unique().map { version -> processVersionsFromYAML(version) }.unique().mix(Channel.of(workflowVersionToYAML())) } // @@ -134,25 +121,31 @@ def softwareVersionsToYAML(ch_versions) { // def paramsSummaryMultiqc(summary_params) { def summary_section = '' - for (group in summary_params.keySet()) { - def group_params = summary_params.get(group) // This gets the parameters of that particular group - if (group_params) { - summary_section += "

    $group

    \n" - summary_section += "
    \n" - for (param in group_params.keySet()) { - summary_section += "
    $param
    ${group_params.get(param) ?: 'N/A'}
    \n" + summary_params + .keySet() + .each { group -> + def group_params = summary_params.get(group) + // This gets the parameters of that particular group + if (group_params) { + summary_section += "

    ${group}

    \n" + summary_section += "
    \n" + group_params + .keySet() + .sort() + .each { param -> + summary_section += "
    ${param}
    ${group_params.get(param) ?: 'N/A'}
    \n" + } + summary_section += "
    \n" } - summary_section += "
    \n" } - } - String yaml_file_text = "id: '${workflow.manifest.name.replace('/','-')}-summary'\n" - yaml_file_text += "description: ' - this information is collected when the pipeline is started.'\n" - yaml_file_text += "section_name: '${workflow.manifest.name} Workflow Summary'\n" - yaml_file_text += "section_href: 'https://github.com/${workflow.manifest.name}'\n" - yaml_file_text += "plot_type: 'html'\n" - yaml_file_text += "data: |\n" - yaml_file_text += "${summary_section}" + def yaml_file_text = "id: '${workflow.manifest.name.replace('/', '-')}-summary'\n" as String + yaml_file_text += "description: ' - this information is collected when the pipeline is started.'\n" + yaml_file_text += "section_name: '${workflow.manifest.name} Workflow Summary'\n" + yaml_file_text += "section_href: 'https://github.com/${workflow.manifest.name}'\n" + yaml_file_text += "plot_type: 'html'\n" + yaml_file_text += "data: |\n" + yaml_file_text += "${summary_section}" return yaml_file_text } @@ -161,7 +154,7 @@ def paramsSummaryMultiqc(summary_params) { // nf-core logo // def nfCoreLogo(monochrome_logs=true) { - Map colors = logColours(monochrome_logs) + def colors = logColours(monochrome_logs) as Map String.format( """\n ${dashedLine(monochrome_logs)} @@ -180,7 +173,7 @@ def nfCoreLogo(monochrome_logs=true) { // Return dashed line // def dashedLine(monochrome_logs=true) { - Map colors = logColours(monochrome_logs) + def colors = logColours(monochrome_logs) as Map return "-${colors.dim}----------------------------------------------------${colors.reset}-" } @@ -188,7 +181,7 @@ def dashedLine(monochrome_logs=true) { // ANSII colours used for terminal logging // def logColours(monochrome_logs=true) { - Map colorcodes = [:] + def colorcodes = [:] as Map // Reset / Meta colorcodes['reset'] = monochrome_logs ? '' : "\033[0m" @@ -200,54 +193,54 @@ def logColours(monochrome_logs=true) { colorcodes['hidden'] = monochrome_logs ? '' : "\033[8m" // Regular Colors - colorcodes['black'] = monochrome_logs ? '' : "\033[0;30m" - colorcodes['red'] = monochrome_logs ? '' : "\033[0;31m" - colorcodes['green'] = monochrome_logs ? '' : "\033[0;32m" - colorcodes['yellow'] = monochrome_logs ? '' : "\033[0;33m" - colorcodes['blue'] = monochrome_logs ? '' : "\033[0;34m" - colorcodes['purple'] = monochrome_logs ? '' : "\033[0;35m" - colorcodes['cyan'] = monochrome_logs ? '' : "\033[0;36m" - colorcodes['white'] = monochrome_logs ? '' : "\033[0;37m" + colorcodes['black'] = monochrome_logs ? '' : "\033[0;30m" + colorcodes['red'] = monochrome_logs ? '' : "\033[0;31m" + colorcodes['green'] = monochrome_logs ? '' : "\033[0;32m" + colorcodes['yellow'] = monochrome_logs ? '' : "\033[0;33m" + colorcodes['blue'] = monochrome_logs ? '' : "\033[0;34m" + colorcodes['purple'] = monochrome_logs ? '' : "\033[0;35m" + colorcodes['cyan'] = monochrome_logs ? '' : "\033[0;36m" + colorcodes['white'] = monochrome_logs ? '' : "\033[0;37m" // Bold - colorcodes['bblack'] = monochrome_logs ? '' : "\033[1;30m" - colorcodes['bred'] = monochrome_logs ? '' : "\033[1;31m" - colorcodes['bgreen'] = monochrome_logs ? '' : "\033[1;32m" - colorcodes['byellow'] = monochrome_logs ? '' : "\033[1;33m" - colorcodes['bblue'] = monochrome_logs ? '' : "\033[1;34m" - colorcodes['bpurple'] = monochrome_logs ? '' : "\033[1;35m" - colorcodes['bcyan'] = monochrome_logs ? '' : "\033[1;36m" - colorcodes['bwhite'] = monochrome_logs ? '' : "\033[1;37m" + colorcodes['bblack'] = monochrome_logs ? '' : "\033[1;30m" + colorcodes['bred'] = monochrome_logs ? '' : "\033[1;31m" + colorcodes['bgreen'] = monochrome_logs ? '' : "\033[1;32m" + colorcodes['byellow'] = monochrome_logs ? '' : "\033[1;33m" + colorcodes['bblue'] = monochrome_logs ? '' : "\033[1;34m" + colorcodes['bpurple'] = monochrome_logs ? '' : "\033[1;35m" + colorcodes['bcyan'] = monochrome_logs ? '' : "\033[1;36m" + colorcodes['bwhite'] = monochrome_logs ? '' : "\033[1;37m" // Underline - colorcodes['ublack'] = monochrome_logs ? '' : "\033[4;30m" - colorcodes['ured'] = monochrome_logs ? '' : "\033[4;31m" - colorcodes['ugreen'] = monochrome_logs ? '' : "\033[4;32m" - colorcodes['uyellow'] = monochrome_logs ? '' : "\033[4;33m" - colorcodes['ublue'] = monochrome_logs ? '' : "\033[4;34m" - colorcodes['upurple'] = monochrome_logs ? '' : "\033[4;35m" - colorcodes['ucyan'] = monochrome_logs ? '' : "\033[4;36m" - colorcodes['uwhite'] = monochrome_logs ? '' : "\033[4;37m" + colorcodes['ublack'] = monochrome_logs ? '' : "\033[4;30m" + colorcodes['ured'] = monochrome_logs ? '' : "\033[4;31m" + colorcodes['ugreen'] = monochrome_logs ? '' : "\033[4;32m" + colorcodes['uyellow'] = monochrome_logs ? '' : "\033[4;33m" + colorcodes['ublue'] = monochrome_logs ? '' : "\033[4;34m" + colorcodes['upurple'] = monochrome_logs ? '' : "\033[4;35m" + colorcodes['ucyan'] = monochrome_logs ? '' : "\033[4;36m" + colorcodes['uwhite'] = monochrome_logs ? '' : "\033[4;37m" // High Intensity - colorcodes['iblack'] = monochrome_logs ? '' : "\033[0;90m" - colorcodes['ired'] = monochrome_logs ? '' : "\033[0;91m" - colorcodes['igreen'] = monochrome_logs ? '' : "\033[0;92m" - colorcodes['iyellow'] = monochrome_logs ? '' : "\033[0;93m" - colorcodes['iblue'] = monochrome_logs ? '' : "\033[0;94m" - colorcodes['ipurple'] = monochrome_logs ? '' : "\033[0;95m" - colorcodes['icyan'] = monochrome_logs ? '' : "\033[0;96m" - colorcodes['iwhite'] = monochrome_logs ? '' : "\033[0;97m" + colorcodes['iblack'] = monochrome_logs ? '' : "\033[0;90m" + colorcodes['ired'] = monochrome_logs ? '' : "\033[0;91m" + colorcodes['igreen'] = monochrome_logs ? '' : "\033[0;92m" + colorcodes['iyellow'] = monochrome_logs ? '' : "\033[0;93m" + colorcodes['iblue'] = monochrome_logs ? '' : "\033[0;94m" + colorcodes['ipurple'] = monochrome_logs ? '' : "\033[0;95m" + colorcodes['icyan'] = monochrome_logs ? '' : "\033[0;96m" + colorcodes['iwhite'] = monochrome_logs ? '' : "\033[0;97m" // Bold High Intensity - colorcodes['biblack'] = monochrome_logs ? '' : "\033[1;90m" - colorcodes['bired'] = monochrome_logs ? '' : "\033[1;91m" - colorcodes['bigreen'] = monochrome_logs ? '' : "\033[1;92m" - colorcodes['biyellow'] = monochrome_logs ? '' : "\033[1;93m" - colorcodes['biblue'] = monochrome_logs ? '' : "\033[1;94m" - colorcodes['bipurple'] = monochrome_logs ? '' : "\033[1;95m" - colorcodes['bicyan'] = monochrome_logs ? '' : "\033[1;96m" - colorcodes['biwhite'] = monochrome_logs ? '' : "\033[1;97m" + colorcodes['biblack'] = monochrome_logs ? '' : "\033[1;90m" + colorcodes['bired'] = monochrome_logs ? '' : "\033[1;91m" + colorcodes['bigreen'] = monochrome_logs ? '' : "\033[1;92m" + colorcodes['biyellow'] = monochrome_logs ? '' : "\033[1;93m" + colorcodes['biblue'] = monochrome_logs ? '' : "\033[1;94m" + colorcodes['bipurple'] = monochrome_logs ? '' : "\033[1;95m" + colorcodes['bicyan'] = monochrome_logs ? '' : "\033[1;96m" + colorcodes['biwhite'] = monochrome_logs ? '' : "\033[1;97m" return colorcodes } @@ -262,14 +255,15 @@ def attachMultiqcReport(multiqc_report) { mqc_report = multiqc_report.getVal() if (mqc_report.getClass() == ArrayList && mqc_report.size() >= 1) { if (mqc_report.size() > 1) { - log.warn "[$workflow.manifest.name] Found multiple reports from process 'MULTIQC', will use only one" + log.warn("[${workflow.manifest.name}] Found multiple reports from process 'MULTIQC', will use only one") } mqc_report = mqc_report[0] } } - } catch (all) { + } + catch (Exception all) { if (multiqc_report) { - log.warn "[$workflow.manifest.name] Could not attach MultiQC report to summary email" + log.warn("[${workflow.manifest.name}] Could not attach MultiQC report to summary email") } } return mqc_report @@ -281,26 +275,35 @@ def attachMultiqcReport(multiqc_report) { def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdir, monochrome_logs=true, multiqc_report=null) { // Set up the e-mail variables - def subject = "[$workflow.manifest.name] Successful: $workflow.runName" + def subject = "[${workflow.manifest.name}] Successful: ${workflow.runName}" if (!workflow.success) { - subject = "[$workflow.manifest.name] FAILED: $workflow.runName" + subject = "[${workflow.manifest.name}] FAILED: ${workflow.runName}" } def summary = [:] - for (group in summary_params.keySet()) { - summary << summary_params[group] - } + summary_params + .keySet() + .sort() + .each { group -> + summary << summary_params[group] + } def misc_fields = [:] misc_fields['Date Started'] = workflow.start misc_fields['Date Completed'] = workflow.complete misc_fields['Pipeline script file path'] = workflow.scriptFile misc_fields['Pipeline script hash ID'] = workflow.scriptId - if (workflow.repository) misc_fields['Pipeline repository Git URL'] = workflow.repository - if (workflow.commitId) misc_fields['Pipeline repository Git Commit'] = workflow.commitId - if (workflow.revision) misc_fields['Pipeline Git branch/tag'] = workflow.revision - misc_fields['Nextflow Version'] = workflow.nextflow.version - misc_fields['Nextflow Build'] = workflow.nextflow.build + if (workflow.repository) { + misc_fields['Pipeline repository Git URL'] = workflow.repository + } + if (workflow.commitId) { + misc_fields['Pipeline repository Git Commit'] = workflow.commitId + } + if (workflow.revision) { + misc_fields['Pipeline Git branch/tag'] = workflow.revision + } + misc_fields['Nextflow Version'] = workflow.nextflow.version + misc_fields['Nextflow Build'] = workflow.nextflow.build misc_fields['Nextflow Compile Timestamp'] = workflow.nextflow.timestamp def email_fields = [:] @@ -338,39 +341,41 @@ def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdi // Render the sendmail template def max_multiqc_email_size = (params.containsKey('max_multiqc_email_size') ? params.max_multiqc_email_size : 0) as nextflow.util.MemoryUnit - def smail_fields = [ email: email_address, subject: subject, email_txt: email_txt, email_html: email_html, projectDir: "${workflow.projectDir}", mqcFile: mqc_report, mqcMaxSize: max_multiqc_email_size.toBytes() ] + def smail_fields = [email: email_address, subject: subject, email_txt: email_txt, email_html: email_html, projectDir: "${workflow.projectDir}", mqcFile: mqc_report, mqcMaxSize: max_multiqc_email_size.toBytes()] def sf = new File("${workflow.projectDir}/assets/sendmail_template.txt") def sendmail_template = engine.createTemplate(sf).make(smail_fields) def sendmail_html = sendmail_template.toString() // Send the HTML e-mail - Map colors = logColours(monochrome_logs) + def colors = logColours(monochrome_logs) as Map if (email_address) { try { - if (plaintext_email) { throw GroovyException('Send plaintext e-mail, not HTML') } + if (plaintext_email) { +new org.codehaus.groovy.GroovyException('Send plaintext e-mail, not HTML') } // Try to send HTML e-mail using sendmail def sendmail_tf = new File(workflow.launchDir.toString(), ".sendmail_tmp.html") sendmail_tf.withWriter { w -> w << sendmail_html } - [ 'sendmail', '-t' ].execute() << sendmail_html - log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Sent summary e-mail to $email_address (sendmail)-" - } catch (all) { + ['sendmail', '-t'].execute() << sendmail_html + log.info("-${colors.purple}[${workflow.manifest.name}]${colors.green} Sent summary e-mail to ${email_address} (sendmail)-") + } + catch (Exception all) { // Catch failures and try with plaintext - def mail_cmd = [ 'mail', '-s', subject, '--content-type=text/html', email_address ] + def mail_cmd = ['mail', '-s', subject, '--content-type=text/html', email_address] mail_cmd.execute() << email_html - log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Sent summary e-mail to $email_address (mail)-" + log.info("-${colors.purple}[${workflow.manifest.name}]${colors.green} Sent summary e-mail to ${email_address} (mail)-") } } // Write summary e-mail HTML to a file def output_hf = new File(workflow.launchDir.toString(), ".pipeline_report.html") output_hf.withWriter { w -> w << email_html } - FilesEx.copyTo(output_hf.toPath(), "${outdir}/pipeline_info/pipeline_report.html"); + nextflow.extension.FilesEx.copyTo(output_hf.toPath(), "${outdir}/pipeline_info/pipeline_report.html") output_hf.delete() // Write summary e-mail TXT to a file def output_tf = new File(workflow.launchDir.toString(), ".pipeline_report.txt") output_tf.withWriter { w -> w << email_txt } - FilesEx.copyTo(output_tf.toPath(), "${outdir}/pipeline_info/pipeline_report.txt"); + nextflow.extension.FilesEx.copyTo(output_tf.toPath(), "${outdir}/pipeline_info/pipeline_report.txt") output_tf.delete() } @@ -378,15 +383,17 @@ def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdi // Print pipeline summary on completion // def completionSummary(monochrome_logs=true) { - Map colors = logColours(monochrome_logs) + def colors = logColours(monochrome_logs) as Map if (workflow.success) { if (workflow.stats.ignoredCount == 0) { - log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Pipeline completed successfully${colors.reset}-" - } else { - log.info "-${colors.purple}[$workflow.manifest.name]${colors.yellow} Pipeline completed successfully, but with errored process(es) ${colors.reset}-" + log.info("-${colors.purple}[${workflow.manifest.name}]${colors.green} Pipeline completed successfully${colors.reset}-") + } + else { + log.info("-${colors.purple}[${workflow.manifest.name}]${colors.yellow} Pipeline completed successfully, but with errored process(es) ${colors.reset}-") } - } else { - log.info "-${colors.purple}[$workflow.manifest.name]${colors.red} Pipeline completed with errors${colors.reset}-" + } + else { + log.info("-${colors.purple}[${workflow.manifest.name}]${colors.red} Pipeline completed with errors${colors.reset}-") } } @@ -395,21 +402,30 @@ def completionSummary(monochrome_logs=true) { // def imNotification(summary_params, hook_url) { def summary = [:] - for (group in summary_params.keySet()) { - summary << summary_params[group] - } + summary_params + .keySet() + .sort() + .each { group -> + summary << summary_params[group] + } def misc_fields = [:] - misc_fields['start'] = workflow.start - misc_fields['complete'] = workflow.complete - misc_fields['scriptfile'] = workflow.scriptFile - misc_fields['scriptid'] = workflow.scriptId - if (workflow.repository) misc_fields['repository'] = workflow.repository - if (workflow.commitId) misc_fields['commitid'] = workflow.commitId - if (workflow.revision) misc_fields['revision'] = workflow.revision - misc_fields['nxf_version'] = workflow.nextflow.version - misc_fields['nxf_build'] = workflow.nextflow.build - misc_fields['nxf_timestamp'] = workflow.nextflow.timestamp + misc_fields['start'] = workflow.start + misc_fields['complete'] = workflow.complete + misc_fields['scriptfile'] = workflow.scriptFile + misc_fields['scriptid'] = workflow.scriptId + if (workflow.repository) { + misc_fields['repository'] = workflow.repository + } + if (workflow.commitId) { + misc_fields['commitid'] = workflow.commitId + } + if (workflow.revision) { + misc_fields['revision'] = workflow.revision + } + misc_fields['nxf_version'] = workflow.nextflow.version + misc_fields['nxf_build'] = workflow.nextflow.build + misc_fields['nxf_timestamp'] = workflow.nextflow.timestamp def msg_fields = [:] msg_fields['version'] = getWorkflowVersion() @@ -434,13 +450,13 @@ def imNotification(summary_params, hook_url) { def json_message = json_template.toString() // POST - def post = new URL(hook_url).openConnection(); + def post = new URL(hook_url).openConnection() post.setRequestMethod("POST") post.setDoOutput(true) post.setRequestProperty("Content-Type", "application/json") - post.getOutputStream().write(json_message.getBytes("UTF-8")); - def postRC = post.getResponseCode(); - if (! postRC.equals(200)) { - log.warn(post.getErrorStream().getText()); + post.getOutputStream().write(json_message.getBytes("UTF-8")) + def postRC = post.getResponseCode() + if (!postRC.equals(200)) { + log.warn(post.getErrorStream().getText()) } } diff --git a/subworkflows/nf-core/utils_nfschema_plugin/main.nf b/subworkflows/nf-core/utils_nfschema_plugin/main.nf new file mode 100644 index 00000000..4994303e --- /dev/null +++ b/subworkflows/nf-core/utils_nfschema_plugin/main.nf @@ -0,0 +1,46 @@ +// +// Subworkflow that uses the nf-schema plugin to validate parameters and render the parameter summary +// + +include { paramsSummaryLog } from 'plugin/nf-schema' +include { validateParameters } from 'plugin/nf-schema' + +workflow UTILS_NFSCHEMA_PLUGIN { + + take: + input_workflow // workflow: the workflow object used by nf-schema to get metadata from the workflow + validate_params // boolean: validate the parameters + parameters_schema // string: path to the parameters JSON schema. + // this has to be the same as the schema given to `validation.parametersSchema` + // when this input is empty it will automatically use the configured schema or + // "${projectDir}/nextflow_schema.json" as default. This input should not be empty + // for meta pipelines + + main: + + // + // Print parameter summary to stdout. This will display the parameters + // that differ from the default given in the JSON schema + // + if(parameters_schema) { + log.info paramsSummaryLog(input_workflow, parameters_schema:parameters_schema) + } else { + log.info paramsSummaryLog(input_workflow) + } + + // + // Validate the parameters using nextflow_schema.json or the schema + // given via the validation.parametersSchema configuration option + // + if(validate_params) { + if(parameters_schema) { + validateParameters(parameters_schema:parameters_schema) + } else { + validateParameters() + } + } + + emit: + dummy_emit = true +} + diff --git a/subworkflows/nf-core/utils_nfschema_plugin/meta.yml b/subworkflows/nf-core/utils_nfschema_plugin/meta.yml new file mode 100644 index 00000000..f7d9f028 --- /dev/null +++ b/subworkflows/nf-core/utils_nfschema_plugin/meta.yml @@ -0,0 +1,35 @@ +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json +name: "utils_nfschema_plugin" +description: Run nf-schema to validate parameters and create a summary of changed parameters +keywords: + - validation + - JSON schema + - plugin + - parameters + - summary +components: [] +input: + - input_workflow: + type: object + description: | + The workflow object of the used pipeline. + This object contains meta data used to create the params summary log + - validate_params: + type: boolean + description: Validate the parameters and error if invalid. + - parameters_schema: + type: string + description: | + Path to the parameters JSON schema. + This has to be the same as the schema given to the `validation.parametersSchema` config + option. When this input is empty it will automatically use the configured schema or + "${projectDir}/nextflow_schema.json" as default. The schema should not be given in this way + for meta pipelines. +output: + - dummy_emit: + type: boolean + description: Dummy emit to make nf-core subworkflows lint happy +authors: + - "@nvnieuwk" +maintainers: + - "@nvnieuwk" diff --git a/subworkflows/nf-core/utils_nfschema_plugin/tests/main.nf.test b/subworkflows/nf-core/utils_nfschema_plugin/tests/main.nf.test new file mode 100644 index 00000000..842dc432 --- /dev/null +++ b/subworkflows/nf-core/utils_nfschema_plugin/tests/main.nf.test @@ -0,0 +1,117 @@ +nextflow_workflow { + + name "Test Subworkflow UTILS_NFSCHEMA_PLUGIN" + script "../main.nf" + workflow "UTILS_NFSCHEMA_PLUGIN" + + tag "subworkflows" + tag "subworkflows_nfcore" + tag "subworkflows/utils_nfschema_plugin" + tag "plugin/nf-schema" + + config "./nextflow.config" + + test("Should run nothing") { + + when { + + params { + test_data = '' + } + + workflow { + """ + validate_params = false + input[0] = workflow + input[1] = validate_params + input[2] = "" + """ + } + } + + then { + assertAll( + { assert workflow.success } + ) + } + } + + test("Should validate params") { + + when { + + params { + test_data = '' + outdir = 1 + } + + workflow { + """ + validate_params = true + input[0] = workflow + input[1] = validate_params + input[2] = "" + """ + } + } + + then { + assertAll( + { assert workflow.failed }, + { assert workflow.stdout.any { it.contains('ERROR ~ Validation of pipeline parameters failed!') } } + ) + } + } + + test("Should run nothing - custom schema") { + + when { + + params { + test_data = '' + } + + workflow { + """ + validate_params = false + input[0] = workflow + input[1] = validate_params + input[2] = "${projectDir}/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json" + """ + } + } + + then { + assertAll( + { assert workflow.success } + ) + } + } + + test("Should validate params - custom schema") { + + when { + + params { + test_data = '' + outdir = 1 + } + + workflow { + """ + validate_params = true + input[0] = workflow + input[1] = validate_params + input[2] = "${projectDir}/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json" + """ + } + } + + then { + assertAll( + { assert workflow.failed }, + { assert workflow.stdout.any { it.contains('ERROR ~ Validation of pipeline parameters failed!') } } + ) + } + } +} diff --git a/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow.config b/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow.config new file mode 100644 index 00000000..0907ac58 --- /dev/null +++ b/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow.config @@ -0,0 +1,8 @@ +plugins { + id "nf-schema@2.1.0" +} + +validation { + parametersSchema = "${projectDir}/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json" + monochromeLogs = true +} \ No newline at end of file diff --git a/subworkflows/nf-core/utils_nfvalidation_plugin/tests/nextflow_schema.json b/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json similarity index 95% rename from subworkflows/nf-core/utils_nfvalidation_plugin/tests/nextflow_schema.json rename to subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json index 7626c1c9..331e0d2f 100644 --- a/subworkflows/nf-core/utils_nfvalidation_plugin/tests/nextflow_schema.json +++ b/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json @@ -1,10 +1,10 @@ { - "$schema": "http://json-schema.org/draft-07/schema", + "$schema": "https://json-schema.org/draft/2020-12/schema", "$id": "https://raw.githubusercontent.com/./master/nextflow_schema.json", "title": ". pipeline parameters", "description": "", "type": "object", - "definitions": { + "$defs": { "input_output_options": { "title": "Input/output options", "type": "object", @@ -87,10 +87,10 @@ }, "allOf": [ { - "$ref": "#/definitions/input_output_options" + "$ref": "#/$defs/input_output_options" }, { - "$ref": "#/definitions/generic_options" + "$ref": "#/$defs/generic_options" } ] } diff --git a/subworkflows/nf-core/utils_nfvalidation_plugin/main.nf b/subworkflows/nf-core/utils_nfvalidation_plugin/main.nf deleted file mode 100644 index 2585b65d..00000000 --- a/subworkflows/nf-core/utils_nfvalidation_plugin/main.nf +++ /dev/null @@ -1,62 +0,0 @@ -// -// Subworkflow that uses the nf-validation plugin to render help text and parameter summary -// - -/* -======================================================================================== - IMPORT NF-VALIDATION PLUGIN -======================================================================================== -*/ - -include { paramsHelp } from 'plugin/nf-validation' -include { paramsSummaryLog } from 'plugin/nf-validation' -include { validateParameters } from 'plugin/nf-validation' - -/* -======================================================================================== - SUBWORKFLOW DEFINITION -======================================================================================== -*/ - -workflow UTILS_NFVALIDATION_PLUGIN { - - take: - print_help // boolean: print help - workflow_command // string: default commmand used to run pipeline - pre_help_text // string: string to be printed before help text and summary log - post_help_text // string: string to be printed after help text and summary log - validate_params // boolean: validate parameters - schema_filename // path: JSON schema file, null to use default value - - main: - - log.debug "Using schema file: ${schema_filename}" - - // Default values for strings - pre_help_text = pre_help_text ?: '' - post_help_text = post_help_text ?: '' - workflow_command = workflow_command ?: '' - - // - // Print help message if needed - // - if (print_help) { - log.info pre_help_text + paramsHelp(workflow_command, parameters_schema: schema_filename) + post_help_text - System.exit(0) - } - - // - // Print parameter summary to stdout - // - log.info pre_help_text + paramsSummaryLog(workflow, parameters_schema: schema_filename) + post_help_text - - // - // Validate parameters relative to the parameter JSON schema - // - if (validate_params){ - validateParameters(parameters_schema: schema_filename) - } - - emit: - dummy_emit = true -} diff --git a/subworkflows/nf-core/utils_nfvalidation_plugin/meta.yml b/subworkflows/nf-core/utils_nfvalidation_plugin/meta.yml deleted file mode 100644 index 3d4a6b04..00000000 --- a/subworkflows/nf-core/utils_nfvalidation_plugin/meta.yml +++ /dev/null @@ -1,44 +0,0 @@ -# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json -name: "UTILS_NFVALIDATION_PLUGIN" -description: Use nf-validation to initiate and validate a pipeline -keywords: - - utility - - pipeline - - initialise - - validation -components: [] -input: - - print_help: - type: boolean - description: | - Print help message and exit - - workflow_command: - type: string - description: | - The command to run the workflow e.g. "nextflow run main.nf" - - pre_help_text: - type: string - description: | - Text to print before the help message - - post_help_text: - type: string - description: | - Text to print after the help message - - validate_params: - type: boolean - description: | - Validate the parameters and error if invalid. - - schema_filename: - type: string - description: | - The filename of the schema to validate against. -output: - - dummy_emit: - type: boolean - description: | - Dummy emit to make nf-core subworkflows lint happy -authors: - - "@adamrtalbot" -maintainers: - - "@adamrtalbot" - - "@maxulysse" diff --git a/subworkflows/nf-core/utils_nfvalidation_plugin/tests/main.nf.test b/subworkflows/nf-core/utils_nfvalidation_plugin/tests/main.nf.test deleted file mode 100644 index 5784a33f..00000000 --- a/subworkflows/nf-core/utils_nfvalidation_plugin/tests/main.nf.test +++ /dev/null @@ -1,200 +0,0 @@ -nextflow_workflow { - - name "Test Workflow UTILS_NFVALIDATION_PLUGIN" - script "../main.nf" - workflow "UTILS_NFVALIDATION_PLUGIN" - tag "subworkflows" - tag "subworkflows_nfcore" - tag "plugin/nf-validation" - tag "'plugin/nf-validation'" - tag "utils_nfvalidation_plugin" - tag "subworkflows/utils_nfvalidation_plugin" - - test("Should run nothing") { - - when { - - params { - monochrome_logs = true - test_data = '' - } - - workflow { - """ - help = false - workflow_command = null - pre_help_text = null - post_help_text = null - validate_params = false - schema_filename = "$moduleTestDir/nextflow_schema.json" - - input[0] = help - input[1] = workflow_command - input[2] = pre_help_text - input[3] = post_help_text - input[4] = validate_params - input[5] = schema_filename - """ - } - } - - then { - assertAll( - { assert workflow.success } - ) - } - } - - test("Should run help") { - - - when { - - params { - monochrome_logs = true - test_data = '' - } - workflow { - """ - help = true - workflow_command = null - pre_help_text = null - post_help_text = null - validate_params = false - schema_filename = "$moduleTestDir/nextflow_schema.json" - - input[0] = help - input[1] = workflow_command - input[2] = pre_help_text - input[3] = post_help_text - input[4] = validate_params - input[5] = schema_filename - """ - } - } - - then { - assertAll( - { assert workflow.success }, - { assert workflow.exitStatus == 0 }, - { assert workflow.stdout.any { it.contains('Input/output options') } }, - { assert workflow.stdout.any { it.contains('--outdir') } } - ) - } - } - - test("Should run help with command") { - - when { - - params { - monochrome_logs = true - test_data = '' - } - workflow { - """ - help = true - workflow_command = "nextflow run noorg/doesntexist" - pre_help_text = null - post_help_text = null - validate_params = false - schema_filename = "$moduleTestDir/nextflow_schema.json" - - input[0] = help - input[1] = workflow_command - input[2] = pre_help_text - input[3] = post_help_text - input[4] = validate_params - input[5] = schema_filename - """ - } - } - - then { - assertAll( - { assert workflow.success }, - { assert workflow.exitStatus == 0 }, - { assert workflow.stdout.any { it.contains('nextflow run noorg/doesntexist') } }, - { assert workflow.stdout.any { it.contains('Input/output options') } }, - { assert workflow.stdout.any { it.contains('--outdir') } } - ) - } - } - - test("Should run help with extra text") { - - - when { - - params { - monochrome_logs = true - test_data = '' - } - workflow { - """ - help = true - workflow_command = "nextflow run noorg/doesntexist" - pre_help_text = "pre-help-text" - post_help_text = "post-help-text" - validate_params = false - schema_filename = "$moduleTestDir/nextflow_schema.json" - - input[0] = help - input[1] = workflow_command - input[2] = pre_help_text - input[3] = post_help_text - input[4] = validate_params - input[5] = schema_filename - """ - } - } - - then { - assertAll( - { assert workflow.success }, - { assert workflow.exitStatus == 0 }, - { assert workflow.stdout.any { it.contains('pre-help-text') } }, - { assert workflow.stdout.any { it.contains('nextflow run noorg/doesntexist') } }, - { assert workflow.stdout.any { it.contains('Input/output options') } }, - { assert workflow.stdout.any { it.contains('--outdir') } }, - { assert workflow.stdout.any { it.contains('post-help-text') } } - ) - } - } - - test("Should validate params") { - - when { - - params { - monochrome_logs = true - test_data = '' - outdir = 1 - } - workflow { - """ - help = false - workflow_command = null - pre_help_text = null - post_help_text = null - validate_params = true - schema_filename = "$moduleTestDir/nextflow_schema.json" - - input[0] = help - input[1] = workflow_command - input[2] = pre_help_text - input[3] = post_help_text - input[4] = validate_params - input[5] = schema_filename - """ - } - } - - then { - assertAll( - { assert workflow.failed }, - { assert workflow.stdout.any { it.contains('ERROR ~ ERROR: Validation of pipeline parameters failed!') } } - ) - } - } -} diff --git a/subworkflows/nf-core/utils_nfvalidation_plugin/tests/tags.yml b/subworkflows/nf-core/utils_nfvalidation_plugin/tests/tags.yml deleted file mode 100644 index 60b1cfff..00000000 --- a/subworkflows/nf-core/utils_nfvalidation_plugin/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -subworkflows/utils_nfvalidation_plugin: - - subworkflows/nf-core/utils_nfvalidation_plugin/** diff --git a/workflows/ampliseq.nf b/workflows/ampliseq.nf index 8d5afed3..e23b9ef4 100644 --- a/workflows/ampliseq.nf +++ b/workflows/ampliseq.nf @@ -242,7 +242,8 @@ include { PHYLOSEQ_WORKFLOW } from '../subworkflows/local/phyloseq_w // // FUNCTIONS // -include { paramsSummaryMap } from 'plugin/nf-validation' +include { samplesheetToList } from 'plugin/nf-schema' +include { paramsSummaryMap } from 'plugin/nf-schema' include { paramsSummaryMultiqc } from '../subworkflows/nf-core/utils_nfcore_pipeline' include { softwareVersionsToYAML } from '../subworkflows/nf-core/utils_nfcore_pipeline' include { methodsDescriptionText } from '../subworkflows/local/utils_nfcore_ampliseq_pipeline' @@ -260,7 +261,6 @@ workflow AMPLISEQ { ch_versions = Channel.empty() ch_multiqc_files = Channel.empty() - // // Create input channels // @@ -268,7 +268,7 @@ workflow AMPLISEQ { ch_input_reads = Channel.empty() if ( params.input ) { // See the documentation https://nextflow-io.github.io/nf-validation/samplesheets/fromSamplesheet/ - ch_input_reads = Channel.fromSamplesheet("input") // meta: meta.sample, meta.run + ch_input_reads = Channel.fromList(samplesheetToList(params.input, "${projectDir}/assets/schema_input.json")) // meta: meta.sample, meta.run .map{ meta, readfw, readrv -> meta.single_end = single_end.toBoolean() def reads = single_end ? readfw : [readfw,readrv] @@ -291,7 +291,7 @@ workflow AMPLISEQ { if ( params.multiregion ) { // is multiple region analysis ch_input_reads - .combine( Channel.fromSamplesheet("multiregion") ) + .combine( Channel..fromList(samplesheetToList(params.multiregion, "${projectDir}/assets/schema_multiregion.json")) ) .map{ info, reads, multi -> def meta = info + multi return [ meta, reads ] } @@ -896,6 +896,7 @@ workflow AMPLISEQ { newLine: true ).set { ch_collated_versions } + // // MODULE: MultiQC // @@ -933,7 +934,9 @@ workflow AMPLISEQ { ch_multiqc_files.collect(), ch_multiqc_config.toList(), ch_multiqc_custom_config.toList(), - ch_multiqc_logo.toList() + ch_multiqc_logo.toList(), + [], + [] ) ch_multiqc_report_list = MULTIQC.out.report.toList() @@ -1037,6 +1040,7 @@ workflow AMPLISEQ { emit: multiqc_report = ch_multiqc_report_list // MULTIQC.out.report.toList() // channel: /path/to/multiqc_report.html versions = ch_versions // channel: [ path(versions.yml) ] + } /* From 47efc2f12d308703e4c38c2c974dc1c51f03e765 Mon Sep 17 00:00:00 2001 From: d4straub Date: Mon, 21 Oct 2024 09:14:22 +0200 Subject: [PATCH 04/26] fix typo --- .github/workflows/ci.yml | 5 +---- 1 file changed, 1 insertion(+), 4 deletions(-) diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml index 115583af..a420e92e 100644 --- a/.github/workflows/ci.yml +++ b/.github/workflows/ci.yml @@ -34,10 +34,7 @@ jobs: NXF_VER: - "24.04.2" - "latest-everything" - profile: - - "conda" - - "docker" - - "singularity" + # Do not run conda because QIIME2 doesnt run with conda profile: #- "conda" - "docker" From 754d92dcdeaf7af5baefb89e4e98ce3b0c9b7972 Mon Sep 17 00:00:00 2001 From: nf-core-bot Date: Mon, 21 Oct 2024 07:24:51 +0000 Subject: [PATCH 05/26] [automated] Fix code linting --- .nf-core.yml | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/.nf-core.yml b/.nf-core.yml index e3b426a3..db3cd2f0 100644 --- a/.nf-core.yml +++ b/.nf-core.yml @@ -7,9 +7,9 @@ lint: - .gitattributes nextflow_config: - config_defaults: - - params.report_template - - params.report_css - - params.report_logo + - params.report_template + - params.report_css + - params.report_logo nf_core_version: 3.0.2 org_path: null repository_type: pipeline From 68b8731ff07a4dd598926bca22bb7d66c8a9fc47 Mon Sep 17 00:00:00 2001 From: d4straub Date: Mon, 21 Oct 2024 10:07:35 +0200 Subject: [PATCH 06/26] update nf-schema and json schemata --- assets/schema_input.json | 4 ++-- assets/schema_multiregion.json | 4 ++-- nextflow.config | 2 +- 3 files changed, 5 insertions(+), 5 deletions(-) diff --git a/assets/schema_input.json b/assets/schema_input.json index 00f1922c..38c76739 100644 --- a/assets/schema_input.json +++ b/assets/schema_input.json @@ -10,7 +10,6 @@ "sampleID": { "type": "string", "pattern": "^[a-zA-Z][a-zA-Z0-9_]+$", - "unique": true, "errorMessage": "Unique sample ID must be provided: Must start with a letter, and can only contain letters, numbers or underscores; Regex: '^[a-zA-Z][a-zA-Z0-9_]+$'", "meta": ["sample"] }, @@ -37,5 +36,6 @@ } }, "required": ["sampleID", "forwardReads"] - } + }, + "uniqueEntries": ["sampleID"] } diff --git a/assets/schema_multiregion.json b/assets/schema_multiregion.json index 62261133..7e69f642 100644 --- a/assets/schema_multiregion.json +++ b/assets/schema_multiregion.json @@ -10,7 +10,6 @@ "region": { "type": "string", "pattern": "^\\S+$", - "unique": true, "errorMessage": "Region name is mandatory, cannot contain spaces, and must be unique", "meta": ["region"] }, @@ -33,5 +32,6 @@ } }, "required": ["region", "region_length", "FW_primer", "RV_primer"] - } + }, + "uniqueEntries": ["region"] } diff --git a/nextflow.config b/nextflow.config index 2f85acd9..f6608f2e 100644 --- a/nextflow.config +++ b/nextflow.config @@ -352,7 +352,7 @@ manifest { // Nextflow plugins plugins { - id 'nf-schema@2.1.1' // Validation of pipeline parameters and creation of an input channel from a sample sheet + id 'nf-schema@2.1.2' // Validation of pipeline parameters and creation of an input channel from a sample sheet } validation { From c9ee1e7a3400860b04d6cf0d3f739b23eddbd225 Mon Sep 17 00:00:00 2001 From: d4straub Date: Mon, 21 Oct 2024 10:20:20 +0200 Subject: [PATCH 07/26] update md5sums for multiqc files --- tests/pipeline/doubleprimers.nf.test.snap | 2 +- tests/pipeline/iontorrent.nf.test.snap | 4 ++-- tests/pipeline/multi.nf.test.snap | 2 +- tests/pipeline/novaseq.nf.test.snap | 2 +- tests/pipeline/pacbio_its.nf.test.snap | 4 ++-- tests/pipeline/pplace.nf.test.snap | 2 +- tests/pipeline/qiimecustom.nf.test.snap | 4 ++-- tests/pipeline/reftaxcustom.nf.test.snap | 4 ++-- tests/pipeline/single.nf.test.snap | 4 ++-- tests/pipeline/sintax.nf.test.snap | 2 +- tests/pipeline/test.nf.test.snap | 4 ++-- 11 files changed, 17 insertions(+), 17 deletions(-) diff --git a/tests/pipeline/doubleprimers.nf.test.snap b/tests/pipeline/doubleprimers.nf.test.snap index cfc3e292..e4d1feb4 100644 --- a/tests/pipeline/doubleprimers.nf.test.snap +++ b/tests/pipeline/doubleprimers.nf.test.snap @@ -46,7 +46,7 @@ }, "multiqc": { "content": [ - "multiqc_general_stats.txt:md5,5761ecfac7e4d5dca249af61cd3f3de9", + "multiqc_general_stats.txt:md5,87461482b83b797b1c6b139a0cf3164e", "multiqc_cutadapt.txt:md5,f022f739ce976fd43677d8889c7ba54b" ], "timestamp": "2023-05-28T21:08:54+0000" diff --git a/tests/pipeline/iontorrent.nf.test.snap b/tests/pipeline/iontorrent.nf.test.snap index 59a228c3..2852b3f9 100644 --- a/tests/pipeline/iontorrent.nf.test.snap +++ b/tests/pipeline/iontorrent.nf.test.snap @@ -38,8 +38,8 @@ }, "multiqc": { "content": [ - "multiqc_fastqc.txt:md5,6f1a5196d0840a35166b88e5b52bfcdd", - "multiqc_general_stats.txt:md5,d01288c9cb7eb23d9d80c76594c5c70a", + "multiqc_fastqc.txt:md5,3f5a64bd44351c6289d4392538132748", + "multiqc_general_stats.txt:md5,ded4ce8dd8c11463dd34317fb736e2ec", "multiqc_cutadapt.txt:md5,fc0fd8f43a96692ad13b0f3ad32c7328" ], "timestamp": "2023-06-20T01:42:35+0000" diff --git a/tests/pipeline/multi.nf.test.snap b/tests/pipeline/multi.nf.test.snap index 69dcdde5..79e2bfaa 100644 --- a/tests/pipeline/multi.nf.test.snap +++ b/tests/pipeline/multi.nf.test.snap @@ -41,7 +41,7 @@ "multiqc": { "content": [ "multiqc_general_stats.txt:md5,5692ee73c6933866807706d29b15c880", - "multiqc_fastqc.txt:md5,147764e40079c3abf97a17cfe2275c52" + "multiqc_fastqc.txt:md5,7d23984b06e4251f17e1cfce7a04aaae" ], "timestamp": "2023-05-28T21:15:03+0000" } diff --git a/tests/pipeline/novaseq.nf.test.snap b/tests/pipeline/novaseq.nf.test.snap index 2b6aea33..fdebd461 100644 --- a/tests/pipeline/novaseq.nf.test.snap +++ b/tests/pipeline/novaseq.nf.test.snap @@ -18,7 +18,7 @@ "multiqc": { "content": [ "multiqc_fastqc.txt:md5,a99548124efd185a7d4e33245edcb81b", - "multiqc_general_stats.txt:md5,195ce3e0c1b032459040613802d25d50" + "multiqc_general_stats.txt:md5,92648df79061fa3b17fea104fe1b7641" ], "timestamp": "2023-06-20T00:10:02+0000" } diff --git a/tests/pipeline/pacbio_its.nf.test.snap b/tests/pipeline/pacbio_its.nf.test.snap index 2ff64e53..3e196934 100644 --- a/tests/pipeline/pacbio_its.nf.test.snap +++ b/tests/pipeline/pacbio_its.nf.test.snap @@ -60,8 +60,8 @@ }, "multiqc": { "content": [ - "multiqc_fastqc.txt:md5,e646906d896ac4514235ae263566a1a8", - "multiqc_general_stats.txt:md5,adb8a2b3b0ac2de5d7d5fbfac81cbdaf", + "multiqc_fastqc.txt:md5,f11936dbbf1718301ceba86050e24799", + "multiqc_general_stats.txt:md5,1fef8358fe3cc974bf05e2f27fc7e250", "multiqc_cutadapt.txt:md5,ae5e5bf06cdbfa4d8305bbcb61c3ba04" ], "timestamp": "2023-06-20T02:07:02+0000" diff --git a/tests/pipeline/pplace.nf.test.snap b/tests/pipeline/pplace.nf.test.snap index f025937d..0c632ad5 100644 --- a/tests/pipeline/pplace.nf.test.snap +++ b/tests/pipeline/pplace.nf.test.snap @@ -46,7 +46,7 @@ }, "multiqc": { "content": [ - "multiqc_general_stats.txt:md5,1a11b1b81648ddd051b8b729b9f8f63d", + "multiqc_general_stats.txt:md5,7a395be7984aaa0f9154de4abed5d824", "multiqc_cutadapt.txt:md5,b4409890ffb9c6938433c374b50c380e" ], "timestamp": "2023-06-20T17:24:03+0000" diff --git a/tests/pipeline/qiimecustom.nf.test.snap b/tests/pipeline/qiimecustom.nf.test.snap index 14be695b..452bfc1c 100644 --- a/tests/pipeline/qiimecustom.nf.test.snap +++ b/tests/pipeline/qiimecustom.nf.test.snap @@ -28,8 +28,8 @@ }, "multiqc": { "content": [ - "multiqc_fastqc.txt:md5,147764e40079c3abf97a17cfe2275c52", - "multiqc_general_stats.txt:md5,5cdf44a2a9fb47a9d847eaa68fb770b7", + "multiqc_fastqc.txt:md5,7d23984b06e4251f17e1cfce7a04aaae", + "multiqc_general_stats.txt:md5,885c19ff3e53d16bfe7937d6694268d7", "multiqc_cutadapt.txt:md5,b4409890ffb9c6938433c374b50c380e" ], "timestamp": "2023-05-28T21:18:54+0000" diff --git a/tests/pipeline/reftaxcustom.nf.test.snap b/tests/pipeline/reftaxcustom.nf.test.snap index a67fd6af..dcbfe9fb 100644 --- a/tests/pipeline/reftaxcustom.nf.test.snap +++ b/tests/pipeline/reftaxcustom.nf.test.snap @@ -46,8 +46,8 @@ }, "multiqc": { "content": [ - "multiqc_fastqc.txt:md5,147764e40079c3abf97a17cfe2275c52", - "multiqc_general_stats.txt:md5,5cdf44a2a9fb47a9d847eaa68fb770b7", + "multiqc_fastqc.txt:md5,7d23984b06e4251f17e1cfce7a04aaae", + "multiqc_general_stats.txt:md5,885c19ff3e53d16bfe7937d6694268d7", "multiqc_cutadapt.txt:md5,b4409890ffb9c6938433c374b50c380e" ], "timestamp": "2023-05-28T21:18:54+0000" diff --git a/tests/pipeline/single.nf.test.snap b/tests/pipeline/single.nf.test.snap index adb9289f..0ccdb4ac 100644 --- a/tests/pipeline/single.nf.test.snap +++ b/tests/pipeline/single.nf.test.snap @@ -39,8 +39,8 @@ }, "multiqc": { "content": [ - "multiqc_fastqc.txt:md5,ede83a16cac9730e6b961ed051c1de0e", - "multiqc_general_stats.txt:md5,a77f38a488f9d1bf0bdf32e3e4b01939", + "multiqc_fastqc.txt:md5,75d0463a8b94a5dec14c3fb5b82169cd", + "multiqc_general_stats.txt:md5,1662178e2c1ac6cb0880f95c1746ce81", "multiqc_cutadapt.txt:md5,15ff9f378c1d8fb01fdd40b8010862d4" ], "timestamp": "2024-03-26T20:35:33+0000" diff --git a/tests/pipeline/sintax.nf.test.snap b/tests/pipeline/sintax.nf.test.snap index f24b515c..888e81c1 100644 --- a/tests/pipeline/sintax.nf.test.snap +++ b/tests/pipeline/sintax.nf.test.snap @@ -54,7 +54,7 @@ }, "multiqc": { "content": [ - "multiqc_general_stats.txt:md5,adb8a2b3b0ac2de5d7d5fbfac81cbdaf", + "multiqc_general_stats.txt:md5,1fef8358fe3cc974bf05e2f27fc7e250", "multiqc_cutadapt.txt:md5,ae5e5bf06cdbfa4d8305bbcb61c3ba04" ], "timestamp": "2023-06-20T16:40:18+0000" diff --git a/tests/pipeline/test.nf.test.snap b/tests/pipeline/test.nf.test.snap index 6bb36087..a4792488 100644 --- a/tests/pipeline/test.nf.test.snap +++ b/tests/pipeline/test.nf.test.snap @@ -51,8 +51,8 @@ }, "multiqc": { "content": [ - "multiqc_fastqc.txt:md5,147764e40079c3abf97a17cfe2275c52", - "multiqc_general_stats.txt:md5,5cdf44a2a9fb47a9d847eaa68fb770b7", + "multiqc_fastqc.txt:md5,7d23984b06e4251f17e1cfce7a04aaae", + "multiqc_general_stats.txt:md5,885c19ff3e53d16bfe7937d6694268d7", "multiqc_cutadapt.txt:md5,b4409890ffb9c6938433c374b50c380e" ], "timestamp": "2023-05-28T20:55:32+0000" From 4ffc595de39c783097e37d183062f68afb6bc6e9 Mon Sep 17 00:00:00 2001 From: d4straub Date: Mon, 21 Oct 2024 11:02:56 +0200 Subject: [PATCH 08/26] activate nf-schema lenientMode --- nextflow.config | 1 + 1 file changed, 1 insertion(+) diff --git a/nextflow.config b/nextflow.config index f6608f2e..3894f9fb 100644 --- a/nextflow.config +++ b/nextflow.config @@ -357,6 +357,7 @@ plugins { validation { defaultIgnoreParams = ["genomes","igenomes_base","dada_ref_databases","qiime_ref_databases","sintax_ref_databases","kraken2_ref_databases","sidle_ref_databases"] + lenientMode = true help { enabled = true command = "nextflow run $manifest.name -profile --input samplesheet.csv --outdir " From 07fcdd8c9b35fa7b585d0c33f1153867f7acf046 Mon Sep 17 00:00:00 2001 From: d4straub Date: Mon, 21 Oct 2024 11:09:21 +0200 Subject: [PATCH 09/26] fix typo --- workflows/ampliseq.nf | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/workflows/ampliseq.nf b/workflows/ampliseq.nf index e23b9ef4..7b9168b4 100644 --- a/workflows/ampliseq.nf +++ b/workflows/ampliseq.nf @@ -291,7 +291,7 @@ workflow AMPLISEQ { if ( params.multiregion ) { // is multiple region analysis ch_input_reads - .combine( Channel..fromList(samplesheetToList(params.multiregion, "${projectDir}/assets/schema_multiregion.json")) ) + .combine( Channel.fromList(samplesheetToList(params.multiregion, "${projectDir}/assets/schema_multiregion.json")) ) .map{ info, reads, multi -> def meta = info + multi return [ meta, reads ] } From a106c5dd82b0c2e6c39f5c2ab82dad09b7e85f27 Mon Sep 17 00:00:00 2001 From: d4straub Date: Mon, 21 Oct 2024 11:58:35 +0200 Subject: [PATCH 10/26] update md5sums in snaps --- tests/pipeline/multi.nf.test.snap | 2 +- tests/pipeline/multiregion.nf.test.snap | 2 +- 2 files changed, 2 insertions(+), 2 deletions(-) diff --git a/tests/pipeline/multi.nf.test.snap b/tests/pipeline/multi.nf.test.snap index 79e2bfaa..3ea3946e 100644 --- a/tests/pipeline/multi.nf.test.snap +++ b/tests/pipeline/multi.nf.test.snap @@ -40,7 +40,7 @@ }, "multiqc": { "content": [ - "multiqc_general_stats.txt:md5,5692ee73c6933866807706d29b15c880", + "multiqc_general_stats.txt:md5,5cca03b6090ae25c5c3d4b5f49a7acb8", "multiqc_fastqc.txt:md5,7d23984b06e4251f17e1cfce7a04aaae" ], "timestamp": "2023-05-28T21:15:03+0000" diff --git a/tests/pipeline/multiregion.nf.test.snap b/tests/pipeline/multiregion.nf.test.snap index 41ecff60..886a9219 100644 --- a/tests/pipeline/multiregion.nf.test.snap +++ b/tests/pipeline/multiregion.nf.test.snap @@ -32,7 +32,7 @@ "multiqc": { "content": [ "multiqc_fastqc.txt:md5,9468ae91af1a841c5e1369f11f704604", - "multiqc_general_stats.txt:md5,92c968d218577d47c2364849c07f7ab6", + "multiqc_general_stats.txt:md5,68f2972dd2d44e499d5afac6cf8624c8", "multiqc_cutadapt.txt:md5,2ef3cbb36c9461cddf6c3f493d2ddbd4" ], "timestamp": "2024-02-23T00:00:00+0000" From fe2ec7b4e55773498eeecae73c8d07996568f02b Mon Sep 17 00:00:00 2001 From: d4straub Date: Mon, 21 Oct 2024 12:20:12 +0200 Subject: [PATCH 11/26] replace https://data.ace.uq.edu.au/public/gtdb/data by https://data.gtdb.ecogenomic.org --- conf/ref_databases.config | 24 ++++++++++++------------ 1 file changed, 12 insertions(+), 12 deletions(-) diff --git a/conf/ref_databases.config b/conf/ref_databases.config index cd2edf43..a87794fa 100644 --- a/conf/ref_databases.config +++ b/conf/ref_databases.config @@ -27,45 +27,45 @@ params { } 'gtdb' { title = "GTDB - Genome Taxonomy Database - Release R09-RS220" - file = [ "https://data.ace.uq.edu.au/public/gtdb/data/releases/release220/220.0/genomic_files_reps/bac120_ssu_reps_r220.fna.gz", "https://data.ace.uq.edu.au/public/gtdb/data/releases/release220/220.0/genomic_files_reps/ar53_ssu_reps_r220.fna.gz" ] + file = [ "https://data.gtdb.ecogenomic.org/releases/release220/220.0/genomic_files_reps/bac120_ssu_reps_r220.fna.gz", "https://data.gtdb.ecogenomic.org/releases/release220/220.0/genomic_files_reps/ar53_ssu_reps_r220.fna.gz" ] citation = "Parks DH, Chuvochina M, Waite DW, Rinke C, Skarshewski A, Chaumeil PA, Hugenholtz P. A standardized bacterial taxonomy based on genome phylogeny substantially revises the tree of life. Nat Biotechnol. 2018 Nov;36(10):996-1004. doi: 10.1038/nbt.4229. Epub 2018 Aug 27. PMID: 30148503." fmtscript = "taxref_reformat_gtdb.sh" - dbversion = "GTDB R09-RS220 (https://data.ace.uq.edu.au/public/gtdb/data/releases/release220/220.0)" + dbversion = "GTDB R09-RS220 (https://data.gtdb.ecogenomic.org/releases/release220/220.0)" } 'gtdb=R09-RS220' { title = "GTDB - Genome Taxonomy Database - Release R09-RS220" - file = [ "https://data.ace.uq.edu.au/public/gtdb/data/releases/release220/220.0/genomic_files_reps/bac120_ssu_reps_r220.fna.gz", "https://data.ace.uq.edu.au/public/gtdb/data/releases/release220/220.0/genomic_files_reps/ar53_ssu_reps_r220.fna.gz" ] + file = [ "https://data.gtdb.ecogenomic.org/releases/release220/220.0/genomic_files_reps/bac120_ssu_reps_r220.fna.gz", "https://data.gtdb.ecogenomic.org/releases/release220/220.0/genomic_files_reps/ar53_ssu_reps_r220.fna.gz" ] citation = "Parks DH, Chuvochina M, Waite DW, Rinke C, Skarshewski A, Chaumeil PA, Hugenholtz P. A standardized bacterial taxonomy based on genome phylogeny substantially revises the tree of life. Nat Biotechnol. 2018 Nov;36(10):996-1004. doi: 10.1038/nbt.4229. Epub 2018 Aug 27. PMID: 30148503." fmtscript = "taxref_reformat_gtdb.sh" - dbversion = "GTDB R09-RS220 (https://data.ace.uq.edu.au/public/gtdb/data/releases/release220/220.0)" + dbversion = "GTDB R09-RS220 (https://data.gtdb.ecogenomic.org/releases/release220/220.0)" } 'gtdb=R08-RS214' { title = "GTDB - Genome Taxonomy Database - Release R08-RS214.1" - file = [ "https://data.ace.uq.edu.au/public/gtdb/data/releases/release214/214.1/genomic_files_reps/bac120_ssu_reps_r214.tar.gz", "https://data.ace.uq.edu.au/public/gtdb/data/releases/release214/214.1/genomic_files_reps/ar53_ssu_reps_r214.tar.gz" ] + file = [ "https://data.gtdb.ecogenomic.org/releases/release214/214.1/genomic_files_reps/bac120_ssu_reps_r214.tar.gz", "https://data.gtdb.ecogenomic.org/releases/release214/214.1/genomic_files_reps/ar53_ssu_reps_r214.tar.gz" ] citation = "Parks DH, Chuvochina M, Waite DW, Rinke C, Skarshewski A, Chaumeil PA, Hugenholtz P. A standardized bacterial taxonomy based on genome phylogeny substantially revises the tree of life. Nat Biotechnol. 2018 Nov;36(10):996-1004. doi: 10.1038/nbt.4229. Epub 2018 Aug 27. PMID: 30148503." fmtscript = "taxref_reformat_gtdb.sh" - dbversion = "GTDB R08-RS214.1 (https://data.ace.uq.edu.au/public/gtdb/data/releases/release214/214.1)" + dbversion = "GTDB R08-RS214.1 (https://data.gtdb.ecogenomic.org/releases/release214/214.1)" } 'gtdb=R07-RS207' { title = "GTDB - Genome Taxonomy Database - Release R07-RS207" - file = [ "https://data.ace.uq.edu.au/public/gtdb/data/releases/release207/207.0/genomic_files_reps/bac120_ssu_reps_r207.tar.gz", "https://data.ace.uq.edu.au/public/gtdb/data/releases/release207/207.0/genomic_files_reps/ar53_ssu_reps_r207.tar.gz" ] + file = [ "https://data.gtdb.ecogenomic.org/releases/release207/207.0/genomic_files_reps/bac120_ssu_reps_r207.tar.gz", "https://data.gtdb.ecogenomic.org/releases/release207/207.0/genomic_files_reps/ar53_ssu_reps_r207.tar.gz" ] citation = "Parks DH, Chuvochina M, Waite DW, Rinke C, Skarshewski A, Chaumeil PA, Hugenholtz P. A standardized bacterial taxonomy based on genome phylogeny substantially revises the tree of life. Nat Biotechnol. 2018 Nov;36(10):996-1004. doi: 10.1038/nbt.4229. Epub 2018 Aug 27. PMID: 30148503." fmtscript = "taxref_reformat_gtdb.sh" - dbversion = "GTDB R07-RS207 (https://data.ace.uq.edu.au/public/gtdb/data/releases/release207/207.0)" + dbversion = "GTDB R07-RS207 (https://data.gtdb.ecogenomic.org/releases/release207/207.0)" } 'gtdb=R06-RS202' { title = "GTDB - Genome Taxonomy Database - Release R06-RS202" - file = [ "https://data.ace.uq.edu.au/public/gtdb/data/releases/release202/202.0/genomic_files_reps/bac120_ssu_reps_r202.tar.gz", "https://data.ace.uq.edu.au/public/gtdb/data/releases/release202/202.0/genomic_files_reps/ar122_ssu_reps_r202.tar.gz" ] + file = [ "https://data.gtdb.ecogenomic.org/releases/release202/202.0/genomic_files_reps/bac120_ssu_reps_r202.tar.gz", "https://data.gtdb.ecogenomic.org/releases/release202/202.0/genomic_files_reps/ar122_ssu_reps_r202.tar.gz" ] citation = "Parks DH, Chuvochina M, Waite DW, Rinke C, Skarshewski A, Chaumeil PA, Hugenholtz P. A standardized bacterial taxonomy based on genome phylogeny substantially revises the tree of life. Nat Biotechnol. 2018 Nov;36(10):996-1004. doi: 10.1038/nbt.4229. Epub 2018 Aug 27. PMID: 30148503." fmtscript = "taxref_reformat_gtdb.sh" - dbversion = "GTDB R06-RS202 (https://data.ace.uq.edu.au/public/gtdb/data/releases/release202/202.0/)" + dbversion = "GTDB R06-RS202 (https://data.gtdb.ecogenomic.org/releases/release202/202.0/)" } 'gtdb=R05-RS95' { title = "GTDB - Genome Taxonomy Database - Release R05-RS95" - file = [ "https://data.ace.uq.edu.au/public/gtdb/data/releases/release95/95.0/genomic_files_reps/bac120_ssu_reps_r95.tar.gz", "https://data.ace.uq.edu.au/public/gtdb/data/releases/release95/95.0/genomic_files_reps/ar122_ssu_reps_r95.tar.gz" ] + file = [ "https://data.gtdb.ecogenomic.org/releases/release95/95.0/genomic_files_reps/bac120_ssu_reps_r95.tar.gz", "https://data.gtdb.ecogenomic.org/releases/release95/95.0/genomic_files_reps/ar122_ssu_reps_r95.tar.gz" ] citation = "Parks DH, Chuvochina M, Waite DW, Rinke C, Skarshewski A, Chaumeil PA, Hugenholtz P. A standardized bacterial taxonomy based on genome phylogeny substantially revises the tree of life. Nat Biotechnol. 2018 Nov;36(10):996-1004. doi: 10.1038/nbt.4229. Epub 2018 Aug 27. PMID: 30148503." fmtscript = "taxref_reformat_gtdb.sh" - dbversion = "GTDB R05-RS95 (https://data.ace.uq.edu.au/public/gtdb/data/releases/release95/95.0/)" + dbversion = "GTDB R05-RS95 (https://data.gtdb.ecogenomic.org/releases/release95/95.0/)" } 'midori2-co1' { title = "MIDORI2 - CO1 Taxonomy Database - Release GB250" From e19a70ef04de5905548004b7ca601072365ab173 Mon Sep 17 00:00:00 2001 From: d4straub Date: Mon, 21 Oct 2024 13:05:39 +0200 Subject: [PATCH 12/26] update CHANGELOG --- CHANGELOG.md | 10 ++++++++++ 1 file changed, 10 insertions(+) diff --git a/CHANGELOG.md b/CHANGELOG.md index 5fad48aa..011fae01 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -9,10 +9,20 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### `Changed` +- [#785](https://github.com/nf-core/ampliseq/pull/785) - replaced https://data.ace.uq.edu.au/public/gtdb/data by https://data.gtdb.ecogenomic.org for GTDB versions via `--dada_ref_taxonomy` + ### `Fixed` +- [#785](https://github.com/nf-core/ampliseq/pull/785) - Template update for nf-core/tools version 3.0.2 + ### `Dependencies` +- [#785](https://github.com/nf-core/ampliseq/pull/785) - Update MultiQC + +| software | previously | now | +| -------- | ---------- | ------ | +| MultiQC | 1.21 | 1.25.1 | + ### `Removed` ## nf-core/ampliseq version 2.11.0 - 2024-08-06 From d288b34279bdb8c9bf3cd95568d3aaab88b25244 Mon Sep 17 00:00:00 2001 From: d4straub Date: Mon, 21 Oct 2024 13:09:49 +0200 Subject: [PATCH 13/26] remove unused code --- assets/multiqc_config.yml | 4 ---- 1 file changed, 4 deletions(-) diff --git a/assets/multiqc_config.yml b/assets/multiqc_config.yml index ec828d82..a363d72d 100644 --- a/assets/multiqc_config.yml +++ b/assets/multiqc_config.yml @@ -13,7 +13,3 @@ report_section_order: export_plots: true disable_version_detection: true - -# MultiQC version 1.20 & 1.21 need that flag to produce plots! -# TODO: Remove with version greater than 1.21! -plots_force_flat: true From 1889babc77cfe2535191cc5ca5f20f6c762ad9cf Mon Sep 17 00:00:00 2001 From: d4straub Date: Mon, 21 Oct 2024 14:28:03 +0200 Subject: [PATCH 14/26] update test profile snap --- tests/pipeline/test.nf.test.snap | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/tests/pipeline/test.nf.test.snap b/tests/pipeline/test.nf.test.snap index a4792488..ff2b4325 100644 --- a/tests/pipeline/test.nf.test.snap +++ b/tests/pipeline/test.nf.test.snap @@ -30,7 +30,7 @@ "content": [ "ASV_seqs.fasta:md5,864c3e0dc9b4a7649beee0c8665dceb5", "ASV_table.tsv:md5,2618251e597593e4d716dd9bed095539", - "ref_taxonomy.gtdb_R07-RS207.txt:md5,06b393cd18dfe6a26a8003dcef6c521c", + "ref_taxonomy.gtdb_R07-RS207.txt:md5,965c6b1f9097128572a5ec2b8e9cef06", "DADA2_stats.tsv:md5,54a1ac8d6c5a3ff15f700c4b2dd40c86", "DADA2_table.rds:md5,d095501019ce7ebccfa0eb801db1ed29", "DADA2_table.tsv:md5,5c9fb0bfd70da165f0ce6a361bfe0b43" From ce6684f51b6c2d26730608615a717d6cd6649e18 Mon Sep 17 00:00:00 2001 From: d4straub Date: Mon, 21 Oct 2024 15:40:48 +0200 Subject: [PATCH 15/26] correct indentation --- CITATIONS.md | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/CITATIONS.md b/CITATIONS.md index 09f1d7d5..fa98ef19 100644 --- a/CITATIONS.md +++ b/CITATIONS.md @@ -18,7 +18,7 @@ - [FastQC](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) -> Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence Data [Online]. + > Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence Data [Online]. - [Cutadapt](https://journal.embnet.org/index.php/embnetjournal/article/view/200/479) @@ -187,7 +187,7 @@ - [MultiQC](https://pubmed.ncbi.nlm.nih.gov/27312411/) -> Ewels P, Magnusson M, Lundin S, Käller M. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics. 2016 Oct 1;32(19):3047-8. doi: 10.1093/bioinformatics/btw354. Epub 2016 Jun 16. PubMed PMID: 27312411; PubMed Central PMCID: PMC5039924. + > Ewels P, Magnusson M, Lundin S, Käller M. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics. 2016 Oct 1;32(19):3047-8. doi: 10.1093/bioinformatics/btw354. Epub 2016 Jun 16. PubMed PMID: 27312411; PubMed Central PMCID: PMC5039924. ## Data From 12c037095689f824d606624f50d54043c77f34d7 Mon Sep 17 00:00:00 2001 From: d4straub Date: Thu, 24 Oct 2024 10:34:43 +0200 Subject: [PATCH 16/26] fix --dada_ref_taxonomy silva=132 --- CHANGELOG.md | 3 +++ conf/ref_databases.config | 13 ++++++++++--- nextflow_schema.json | 1 + 3 files changed, 14 insertions(+), 3 deletions(-) diff --git a/CHANGELOG.md b/CHANGELOG.md index 011fae01..1f6a8f26 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -7,6 +7,8 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### `Added` +- [#786](https://github.com/nf-core/ampliseq/pull/786) - Added version 20240904 of Kraken2 standard taxonomy database: `standard=20240904` or `standard` as parameter to `--kraken2_ref_taxonomy` + ### `Changed` - [#785](https://github.com/nf-core/ampliseq/pull/785) - replaced https://data.ace.uq.edu.au/public/gtdb/data by https://data.gtdb.ecogenomic.org for GTDB versions via `--dada_ref_taxonomy` @@ -14,6 +16,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### `Fixed` - [#785](https://github.com/nf-core/ampliseq/pull/785) - Template update for nf-core/tools version 3.0.2 +- [#786](https://github.com/nf-core/ampliseq/pull/786) - Creation of the summary report was failing with `--dada_ref_taxonomy silva=132` ### `Dependencies` diff --git a/conf/ref_databases.config b/conf/ref_databases.config index a87794fa..e640179a 100644 --- a/conf/ref_databases.config +++ b/conf/ref_databases.config @@ -192,7 +192,7 @@ params { dbversion = "SILVA v138.1 (https://zenodo.org/record/4587955)" } 'silva=132' { - title = "Silva Project's version 132 release" + title = "Silva Projects version 132 release" file = [ "https://zenodo.org/record/1172783/files/silva_nr_v132_train_set.fa.gz", "https://zenodo.org/record/1172783/files/silva_species_assignment_v132.fa.gz" ] citation = "Quast C, Pruesse E, Yilmaz P, Gerken J, Schweer T, Yarza P, Peplies J, Glöckner FO. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Res. 2013 Jan;41(Database issue):D590-6. doi: 10.1093/nar/gks1219. Epub 2012 Nov 28. PMID: 23193283; PMCID: PMC3531112." fmtscript = "taxref_reformat_standard.sh" @@ -528,8 +528,15 @@ params { taxlevels = "D,P,C,O,F,G,S" } 'standard' { - title = "Standard database - Version 20230605" - file = [ "https://genome-idx.s3.amazonaws.com/kraken/k2_standard_20230605.tar.gz" ] + title = "Standard database - Version 20240904" + file = [ "https://genome-idx.s3.amazonaws.com/kraken/k2_standard_20240904.tar.gz" ] + citation = "Wood, D. E., Lu, J., & Langmead, B. (2019). Improved metagenomic analysis with Kraken 2. Genome biology, 20(1), 257. https://doi.org/10.1186/s13059-019-1891-0" + fmtscript = "" + taxlevels = "D,P,C,O,F,G,S" + } + 'standard=20240904' { + title = "Standard database - Version 20240904" + file = [ "https://genome-idx.s3.amazonaws.com/kraken/k2_standard_20240904.tar.gz" ] citation = "Wood, D. E., Lu, J., & Langmead, B. (2019). Improved metagenomic analysis with Kraken 2. Genome biology, 20(1), 257. https://doi.org/10.1186/s13059-019-1891-0" fmtscript = "" taxlevels = "D,P,C,O,F,G,S" diff --git a/nextflow_schema.json b/nextflow_schema.json index 8ceba7b9..e0b263b2 100644 --- a/nextflow_schema.json +++ b/nextflow_schema.json @@ -479,6 +479,7 @@ "greengenes", "greengenes=13.5", "standard", + "standard=20240904", "standard=20230605" ] }, From d8e7eb66576410f356bc40c6bc6c6b96010f454b Mon Sep 17 00:00:00 2001 From: d4straub Date: Tue, 12 Nov 2024 14:13:40 +0100 Subject: [PATCH 17/26] Remove white spaces in process tags --- modules/local/qiime2_ancom_tax.nf | 2 +- modules/local/qiime2_ancombc_asv.nf | 2 +- modules/local/qiime2_ancombc_tax.nf | 2 +- modules/local/qiime2_diversity_adonis.nf | 2 +- modules/local/qiime2_diversity_beta.nf | 2 +- modules/local/qiime2_seqfiltertable.nf | 2 +- 6 files changed, 6 insertions(+), 6 deletions(-) diff --git a/modules/local/qiime2_ancom_tax.nf b/modules/local/qiime2_ancom_tax.nf index cf488276..f03a639c 100644 --- a/modules/local/qiime2_ancom_tax.nf +++ b/modules/local/qiime2_ancom_tax.nf @@ -1,5 +1,5 @@ process QIIME2_ANCOM_TAX { - tag "${table.baseName} - taxonomic level: ${taxlevel}" + tag "${table.baseName}-taxonomic_level:${taxlevel}" label 'process_medium' label 'single_cpu' diff --git a/modules/local/qiime2_ancombc_asv.nf b/modules/local/qiime2_ancombc_asv.nf index 22f264da..a3ebfc71 100644 --- a/modules/local/qiime2_ancombc_asv.nf +++ b/modules/local/qiime2_ancombc_asv.nf @@ -1,5 +1,5 @@ process QIIME2_ANCOMBC_ASV { - tag "${table.baseName} ${formula}" + tag "${table.baseName}-${formula}" label 'process_medium' label 'single_cpu' label 'process_long' diff --git a/modules/local/qiime2_ancombc_tax.nf b/modules/local/qiime2_ancombc_tax.nf index 4d1a6da5..56fd8315 100644 --- a/modules/local/qiime2_ancombc_tax.nf +++ b/modules/local/qiime2_ancombc_tax.nf @@ -1,5 +1,5 @@ process QIIME2_ANCOMBC_TAX { - tag "${table.baseName} ${formula} - ${taxlevel}" + tag "${table.baseName}-${formula}-${taxlevel}" label 'process_medium' label 'single_cpu' diff --git a/modules/local/qiime2_diversity_adonis.nf b/modules/local/qiime2_diversity_adonis.nf index 946a0512..cb4310cd 100644 --- a/modules/local/qiime2_diversity_adonis.nf +++ b/modules/local/qiime2_diversity_adonis.nf @@ -1,5 +1,5 @@ process QIIME2_DIVERSITY_ADONIS { - tag "${core.baseName} - ${formula}" + tag "${core.baseName}-${formula}" label 'process_low' container "qiime2/core:2023.7" diff --git a/modules/local/qiime2_diversity_beta.nf b/modules/local/qiime2_diversity_beta.nf index eef3cdf2..9c9af1a7 100644 --- a/modules/local/qiime2_diversity_beta.nf +++ b/modules/local/qiime2_diversity_beta.nf @@ -1,5 +1,5 @@ process QIIME2_DIVERSITY_BETA { - tag "${core.baseName} - ${category}" + tag "${core.baseName}-${category}" label 'process_low' container "qiime2/core:2023.7" diff --git a/modules/local/qiime2_seqfiltertable.nf b/modules/local/qiime2_seqfiltertable.nf index d0310fb6..f7c999e1 100644 --- a/modules/local/qiime2_seqfiltertable.nf +++ b/modules/local/qiime2_seqfiltertable.nf @@ -1,5 +1,5 @@ process QIIME2_SEQFILTERTABLE { - tag "${repseq} filter by ${table}" + tag "${repseq}-filter-by-${table}" label 'process_low' container "qiime2/core:2023.7" From 08bafc9effdce4afce402ae6860ebd2b8be0a1b6 Mon Sep 17 00:00:00 2001 From: d4straub Date: Tue, 12 Nov 2024 14:15:40 +0100 Subject: [PATCH 18/26] update changelog --- CHANGELOG.md | 1 + 1 file changed, 1 insertion(+) diff --git a/CHANGELOG.md b/CHANGELOG.md index 1f6a8f26..7b48a9da 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -15,6 +15,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### `Fixed` +- [#792](https://github.com/nf-core/ampliseq/pull/792) - Remove white spaces in process tags to avoid errors on some systems - [#785](https://github.com/nf-core/ampliseq/pull/785) - Template update for nf-core/tools version 3.0.2 - [#786](https://github.com/nf-core/ampliseq/pull/786) - Creation of the summary report was failing with `--dada_ref_taxonomy silva=132` From 4e4c124d2c6f93ec40f7edac7efa0a81593d924e Mon Sep 17 00:00:00 2001 From: d4straub Date: Tue, 12 Nov 2024 15:23:31 +0100 Subject: [PATCH 19/26] update nf-core modules and picrust --- CHANGELOG.md | 1 + modules.json | 10 +- modules/local/picrust.nf | 6 +- modules/nf-core/cutadapt/environment.yml | 2 - modules/nf-core/cutadapt/meta.yml | 57 +++--- modules/nf-core/cutadapt/tests/main.nf.test | 6 +- .../nf-core/kraken2/kraken2/environment.yml | 7 +- .../kraken2/kraken2/kraken2-kraken2.diff | 6 + modules/nf-core/kraken2/kraken2/main.nf | 4 +- modules/nf-core/kraken2/kraken2/meta.yml | 121 +++++++----- .../kraken2/kraken2/tests/main.nf.test | 12 +- .../kraken2/kraken2/tests/main.nf.test.snap | 24 ++- .../nf-core/vsearch/cluster/environment.yml | 5 +- modules/nf-core/vsearch/cluster/meta.yml | 175 ++++++++++++++---- .../vsearch/cluster/tests/main.nf.test | 10 +- .../nf-core/vsearch/sintax/environment.yml | 2 - modules/nf-core/vsearch/sintax/meta.yml | 51 +++-- .../nf-core/vsearch/sintax/tests/main.nf.test | 33 ++++ .../vsearch/sintax/tests/main.nf.test.snap | 35 ++++ .../vsearch/usearchglobal/environment.yml | 2 - .../nf-core/vsearch/usearchglobal/meta.yml | 171 +++++++++++------ .../vsearch/usearchglobal/tests/main.nf.test | 64 +++++++ .../usearchglobal/tests/main.nf.test.snap | 96 ++++++++++ 23 files changed, 669 insertions(+), 231 deletions(-) create mode 100644 modules/nf-core/vsearch/sintax/tests/main.nf.test create mode 100644 modules/nf-core/vsearch/sintax/tests/main.nf.test.snap create mode 100644 modules/nf-core/vsearch/usearchglobal/tests/main.nf.test create mode 100644 modules/nf-core/vsearch/usearchglobal/tests/main.nf.test.snap diff --git a/CHANGELOG.md b/CHANGELOG.md index 7b48a9da..9a59f85e 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -26,6 +26,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 | software | previously | now | | -------- | ---------- | ------ | | MultiQC | 1.21 | 1.25.1 | +| Picrust2 | 2.5.2 | 2.5.3 | ### `Removed` diff --git a/modules.json b/modules.json index 69d29b25..ea99de76 100644 --- a/modules.json +++ b/modules.json @@ -7,7 +7,7 @@ "nf-core": { "cutadapt": { "branch": "master", - "git_sha": "6618151ed69274863dc6fe6d2920afa90abaca1f", + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", "installed_by": ["modules"] }, "epang/place": { @@ -62,7 +62,7 @@ }, "kraken2/kraken2": { "branch": "master", - "git_sha": "653218e79ffa76fde20319e9062f8b8da5cf7555", + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", "installed_by": ["modules"], "patch": "modules/nf-core/kraken2/kraken2/kraken2-kraken2.diff" }, @@ -89,17 +89,17 @@ }, "vsearch/cluster": { "branch": "master", - "git_sha": "d97b335eb448073c1b680710303c02a55f40c77c", + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", "installed_by": ["modules"] }, "vsearch/sintax": { "branch": "master", - "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", "installed_by": ["modules"] }, "vsearch/usearchglobal": { "branch": "master", - "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", "installed_by": ["modules"] } } diff --git a/modules/local/picrust.nf b/modules/local/picrust.nf index 0f09a899..720a800d 100644 --- a/modules/local/picrust.nf +++ b/modules/local/picrust.nf @@ -2,10 +2,10 @@ process PICRUST { tag "${seq},${abund}" label 'process_medium' - conda "bioconda::picrust2=2.5.2" + conda "bioconda::picrust2=2.5.3" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/picrust2:2.5.2--pyhdfd78af_0' : - 'biocontainers/picrust2:2.5.2--pyhdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/picrust2:2.5.3--pyhdfd78af_0' : + 'biocontainers/picrust2:2.5.3--pyhdfd78af_0' }" input: path(seq) diff --git a/modules/nf-core/cutadapt/environment.yml b/modules/nf-core/cutadapt/environment.yml index 288ea6f0..dfdbd1c2 100644 --- a/modules/nf-core/cutadapt/environment.yml +++ b/modules/nf-core/cutadapt/environment.yml @@ -1,7 +1,5 @@ -name: cutadapt channels: - conda-forge - bioconda - - defaults dependencies: - bioconda::cutadapt=4.6 diff --git a/modules/nf-core/cutadapt/meta.yml b/modules/nf-core/cutadapt/meta.yml index 5ecfe27a..8844d86c 100644 --- a/modules/nf-core/cutadapt/meta.yml +++ b/modules/nf-core/cutadapt/meta.yml @@ -12,35 +12,44 @@ tools: documentation: https://cutadapt.readthedocs.io/en/stable/index.html doi: 10.14806/ej.17.1.200 licence: ["MIT"] + identifier: biotools:cutadapt input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - reads: - type: file - description: | - List of input FastQ files of size 1 and 2 for single-end and paired-end data, - respectively. + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - reads: + type: file + description: | + List of input FastQ files of size 1 and 2 for single-end and paired-end data, + respectively. output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - reads: - type: file - description: The trimmed/modified fastq reads - pattern: "*fastq.gz" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.trim.fastq.gz": + type: file + description: The trimmed/modified fastq reads + pattern: "*fastq.gz" - log: - type: file - description: cuatadapt log file - pattern: "*cutadapt.log" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.log": + type: file + description: cuatadapt log file + pattern: "*cutadapt.log" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@drpatelh" - "@kevinmenden" diff --git a/modules/nf-core/cutadapt/tests/main.nf.test b/modules/nf-core/cutadapt/tests/main.nf.test index b7ea6ef9..36927bd7 100644 --- a/modules/nf-core/cutadapt/tests/main.nf.test +++ b/modules/nf-core/cutadapt/tests/main.nf.test @@ -18,7 +18,7 @@ nextflow_process { input[0] = [ [ id: 'test', single_end:true ], [ - file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] ] """ @@ -47,8 +47,8 @@ nextflow_process { input[0] = [ [ id: 'test', single_end:false ], [ - file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), - file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] ] """ diff --git a/modules/nf-core/kraken2/kraken2/environment.yml b/modules/nf-core/kraken2/kraken2/environment.yml index 63be419b..ba776d31 100644 --- a/modules/nf-core/kraken2/kraken2/environment.yml +++ b/modules/nf-core/kraken2/kraken2/environment.yml @@ -1,8 +1,7 @@ -name: kraken2_kraken2 channels: - conda-forge - bioconda - - defaults dependencies: - - bioconda::kraken2=2.1.2 - - conda-forge::pigz=2.6 + - "bioconda::kraken2=2.1.3" + - "coreutils=9.4" + - "pigz=2.8" diff --git a/modules/nf-core/kraken2/kraken2/kraken2-kraken2.diff b/modules/nf-core/kraken2/kraken2/kraken2-kraken2.diff index 4ad9339e..c6c57ad4 100644 --- a/modules/nf-core/kraken2/kraken2/kraken2-kraken2.diff +++ b/modules/nf-core/kraken2/kraken2/kraken2-kraken2.diff @@ -1,4 +1,6 @@ Changes in module 'nf-core/kraken2/kraken2' +'modules/nf-core/kraken2/kraken2/meta.yml' is unchanged +Changes in 'kraken2/kraken2/main.nf': --- modules/nf-core/kraken2/kraken2/main.nf +++ modules/nf-core/kraken2/kraken2/main.nf @@ -39,7 +39,6 @@ @@ -10,4 +12,8 @@ Changes in module 'nf-core/kraken2/kraken2' $classified_option \\ $readclassification_option \\ +'modules/nf-core/kraken2/kraken2/environment.yml' is unchanged +'modules/nf-core/kraken2/kraken2/tests/main.nf.test' is unchanged +'modules/nf-core/kraken2/kraken2/tests/main.nf.test.snap' is unchanged +'modules/nf-core/kraken2/kraken2/tests/tags.yml' is unchanged ************************************************************ diff --git a/modules/nf-core/kraken2/kraken2/main.nf b/modules/nf-core/kraken2/kraken2/main.nf index 1c97f9ba..6978e3dc 100644 --- a/modules/nf-core/kraken2/kraken2/main.nf +++ b/modules/nf-core/kraken2/kraken2/main.nf @@ -4,8 +4,8 @@ process KRAKEN2_KRAKEN2 { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/mulled-v2-5799ab18b5fc681e75923b2450abaa969907ec98:87fc08d11968d081f3e8a37131c1f1f6715b6542-0' : - 'biocontainers/mulled-v2-5799ab18b5fc681e75923b2450abaa969907ec98:87fc08d11968d081f3e8a37131c1f1f6715b6542-0' }" + 'https://depot.galaxyproject.org/singularity/mulled-v2-8706a1dd73c6cc426e12dd4dd33a5e917b3989ae:c8cbdc8ff4101e6745f8ede6eb5261ef98bdaff4-0' : + 'biocontainers/mulled-v2-8706a1dd73c6cc426e12dd4dd33a5e917b3989ae:c8cbdc8ff4101e6745f8ede6eb5261ef98bdaff4-0' }" input: tuple val(meta), path(reads) diff --git a/modules/nf-core/kraken2/kraken2/meta.yml b/modules/nf-core/kraken2/kraken2/meta.yml index 7909ffe7..86937646 100644 --- a/modules/nf-core/kraken2/kraken2/meta.yml +++ b/modules/nf-core/kraken2/kraken2/meta.yml @@ -13,63 +13,84 @@ tools: documentation: https://github.com/DerrickWood/kraken2/wiki/Manual doi: 10.1186/s13059-019-1891-0 licence: ["MIT"] + identifier: biotools:kraken2 input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - reads: - type: file - description: | - List of input FastQ files of size 1 and 2 for single-end and paired-end data, - respectively. - - db: - type: directory - description: Kraken2 database - - save_output_fastqs: - type: string - description: | - If true, optional commands are added to save classified and unclassified reads - as fastq files - - save_reads_assignment: - type: string - description: | - If true, an optional command is added to save a file reporting the taxonomic - classification of each input read + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - reads: + type: file + description: | + List of input FastQ files of size 1 and 2 for single-end and paired-end data, + respectively. + - - db: + type: directory + description: Kraken2 database + - - save_output_fastqs: + type: string + description: | + If true, optional commands are added to save classified and unclassified reads + as fastq files + - - save_reads_assignment: + type: string + description: | + If true, an optional command is added to save a file reporting the taxonomic + classification of each input read output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - classified_reads_fastq: - type: file - description: | - Reads classified as belonging to any of the taxa - on the Kraken2 database. - pattern: "*{fastq.gz}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.classified{.,_}*": + type: file + description: | + Reads classified as belonging to any of the taxa + on the Kraken2 database. + pattern: "*{fastq.gz}" - unclassified_reads_fastq: - type: file - description: | - Reads not classified to any of the taxa - on the Kraken2 database. - pattern: "*{fastq.gz}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.unclassified{.,_}*": + type: file + description: | + Reads not classified to any of the taxa + on the Kraken2 database. + pattern: "*{fastq.gz}" - classified_reads_assignment: - type: file - description: | - Kraken2 output file indicating the taxonomic assignment of - each input read + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*classifiedreads.txt": + type: file + description: | + Kraken2 output file indicating the taxonomic assignment of + each input read - report: - type: file - description: | - Kraken2 report containing stats about classified - and not classifed reads. - pattern: "*.{report.txt}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*report.txt": + type: file + description: | + Kraken2 report containing stats about classified + and not classifed reads. + pattern: "*.{report.txt}" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@joseespinosa" - "@drpatelh" diff --git a/modules/nf-core/kraken2/kraken2/tests/main.nf.test b/modules/nf-core/kraken2/kraken2/tests/main.nf.test index 4c513021..c0843df2 100644 --- a/modules/nf-core/kraken2/kraken2/tests/main.nf.test +++ b/modules/nf-core/kraken2/kraken2/tests/main.nf.test @@ -16,7 +16,7 @@ nextflow_process { input[0] = Channel.of([ [], file( - params.test_data['sarscov2']['genome']['kraken2_tar_gz'], + params.modules_testdata_base_path + "genomics/sarscov2/genome/db/kraken2.tar.gz", checkIfExists: true ) ]) @@ -32,7 +32,7 @@ nextflow_process { input[0] = [ [ id:'test', single_end:true ], // meta map [ file( - params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], + params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_1.fastq.gz", checkIfExists: true )] ] @@ -69,16 +69,16 @@ nextflow_process { [ id:'test', single_end:false ], // meta map [ file( - params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], + params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_1.fastq.gz", checkIfExists: true ), file( - params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], + params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_2.fastq.gz", checkIfExists: true ) + ] ] - ] input[1] = UNTAR.out.untar.map{ it[1] } input[2] = true input[3] = false @@ -117,7 +117,7 @@ nextflow_process { input[0] = [ [ id:'test', single_end:true ], // meta map [ file( - params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], + params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_1.fastq.gz", checkIfExists: true )] ] diff --git a/modules/nf-core/kraken2/kraken2/tests/main.nf.test.snap b/modules/nf-core/kraken2/kraken2/tests/main.nf.test.snap index c1bdd0c6..b432f878 100644 --- a/modules/nf-core/kraken2/kraken2/tests/main.nf.test.snap +++ b/modules/nf-core/kraken2/kraken2/tests/main.nf.test.snap @@ -11,10 +11,14 @@ ] ], [ - "versions.yml:md5,bcb3e2520685846df02bb27cc6b1794b" + "versions.yml:md5,79adf2ca1cfc625cb77e391b27142c43" ] ], - "timestamp": "2023-10-25T09:01:29.775797" + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-04-04T18:47:03.745692" }, "sarscov2 illumina paired end [fastq]": { "content": [ @@ -28,10 +32,14 @@ ] ], [ - "versions.yml:md5,bcb3e2520685846df02bb27cc6b1794b" + "versions.yml:md5,79adf2ca1cfc625cb77e391b27142c43" ] ], - "timestamp": "2023-10-25T09:01:37.025389" + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-04-04T18:47:13.75649" }, "sarscov2 illumina single end [fastq] + save_reads_assignment": { "content": [ @@ -54,9 +62,13 @@ ] ], [ - "versions.yml:md5,bcb3e2520685846df02bb27cc6b1794b" + "versions.yml:md5,79adf2ca1cfc625cb77e391b27142c43" ] ], - "timestamp": "2023-10-25T09:01:45.775262" + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-04-04T18:47:22.459465" } } \ No newline at end of file diff --git a/modules/nf-core/vsearch/cluster/environment.yml b/modules/nf-core/vsearch/cluster/environment.yml index 965a7fab..e9b4c9dc 100644 --- a/modules/nf-core/vsearch/cluster/environment.yml +++ b/modules/nf-core/vsearch/cluster/environment.yml @@ -1,8 +1,7 @@ -name: vsearch_cluster channels: - conda-forge - bioconda - - defaults + dependencies: - - bioconda::vsearch=2.21.1 - bioconda::samtools=1.16.1 + - bioconda::vsearch=2.21.1 diff --git a/modules/nf-core/vsearch/cluster/meta.yml b/modules/nf-core/vsearch/cluster/meta.yml index 60d64347..5013feb5 100644 --- a/modules/nf-core/vsearch/cluster/meta.yml +++ b/modules/nf-core/vsearch/cluster/meta.yml @@ -1,67 +1,160 @@ name: "vsearch_cluster" -description: Cluster sequences using a single-pass, greedy centroid-based clustering algorithm. +description: Cluster sequences using a single-pass, greedy centroid-based clustering + algorithm. keywords: - vsearch - clustering - microbiome tools: - vsearch: - description: VSEARCH is a versatile open-source tool for microbiome analysis, including chimera detection, clustering, dereplication and rereplication, extraction, FASTA/FASTQ/SFF file processing, masking, orienting, pair-wise alignment, restriction site cutting, searching, shuffling, sorting, subsampling, and taxonomic classification of amplicon sequences for metagenomics, genomics, and population genetics. (USEARCH alternative) + description: VSEARCH is a versatile open-source tool for microbiome analysis, + including chimera detection, clustering, dereplication and rereplication, extraction, + FASTA/FASTQ/SFF file processing, masking, orienting, pair-wise alignment, restriction + site cutting, searching, shuffling, sorting, subsampling, and taxonomic classification + of amplicon sequences for metagenomics, genomics, and population genetics. (USEARCH + alternative) homepage: https://github.com/torognes/vsearch documentation: https://github.com/torognes/vsearch/releases/download/v2.21.1/vsearch_manual.pdf tool_dev_url: https://github.com/torognes/vsearch doi: 10.7717/peerj.2584 licence: ["GPL v3-or-later OR BSD-2-clause"] + identifier: biotools:vsearch input: - - meta: - type: map - description: Groovy Map containing sample information e.g. [ id:'test' ] - - fasta: - type: file - description: Sequences to cluster in FASTA format - pattern: "*.{fasta,fa,fasta.gz,fa.gz}" + - - meta: + type: map + description: Groovy Map containing sample information e.g. [ id:'test' ] + - fasta: + type: file + description: Sequences to cluster in FASTA format + pattern: "*.{fasta,fa,fasta.gz,fa.gz}" output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test' ] - aln: - type: file - description: Results in pairwise alignment format - pattern: "*.aln.gz" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test' ] + - "*.aln.gz": + type: file + description: Results in pairwise alignment format + pattern: "*.aln.gz" - biom: - type: file - description: Results in an OTU table in the biom version 1.0 file format - pattern: "*.biom.gz" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test' ] + - "*.biom.gz": + type: file + description: Results in an OTU table in the biom version 1.0 file format + pattern: "*.biom.gz" - mothur: - type: file - description: Results in an OTU table in the mothur ’shared’ tab-separated plain text file format - pattern: "*.mothur.tsv.gz" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test' ] + - "*.mothur.tsv.gz": + type: file + description: Results in an OTU table in the mothur ’shared’ tab-separated plain + text file format + pattern: "*.mothur.tsv.gz" - otu: - type: file - description: Results in an OTU table in the classic tab-separated plain text format - pattern: "*.otu.tsv.gz" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test' ] + - "*.otu.tsv.gz": + type: file + description: Results in an OTU table in the classic tab-separated plain text + format + pattern: "*.otu.tsv.gz" - bam: - type: file - description: Results written in bam format - pattern: "*.bam" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test' ] + - "*.bam": + type: file + description: Results written in bam format + pattern: "*.bam" - out: - type: file - description: Results in tab-separated output, columns defined by user - pattern: "*.out.tsv.gz" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test' ] + - "*.out.tsv.gz": + type: file + description: Results in tab-separated output, columns defined by user + pattern: "*.out.tsv.gz" - blast: - type: file - description: Tab delimited results in blast-like tabular format - pattern: "*.blast.tsv.gz" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test' ] + - "*.blast.tsv.gz": + type: file + description: Tab delimited results in blast-like tabular format + pattern: "*.blast.tsv.gz" - uc: - type: file - description: Tab delimited results in a uclust-like format with 10 columns - pattern: "*.uc.gz" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test' ] + - "*.uc.tsv.gz": + type: file + description: Tab delimited results in a uclust-like format with 10 columns + pattern: "*.uc.gz" + - centroids: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test' ] + - "*.centroids.fasta.gz": + type: file + description: Centroid sequences in FASTA format + pattern: "*.centroids.fasta.gz" + - clusters: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test' ] + - "*.clusters.fasta*.gz": + type: file + description: Clustered sequences in FASTA format + pattern: "*.clusters.fasta*.gz" + - profile: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test' ] + - "*.profile.txt.gz": + type: file + description: Profile of the clustering results + pattern: "*.profile.txt.gz" + - msa: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test' ] + - "*.msa.fasta.gz": + type: file + description: Multiple sequence alignment of the centroids + pattern: "*.msa.fasta.gz" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@mirpedrol" maintainers: diff --git a/modules/nf-core/vsearch/cluster/tests/main.nf.test b/modules/nf-core/vsearch/cluster/tests/main.nf.test index 1a376793..155a949d 100644 --- a/modules/nf-core/vsearch/cluster/tests/main.nf.test +++ b/modules/nf-core/vsearch/cluster/tests/main.nf.test @@ -18,7 +18,7 @@ nextflow_process { """ input[0] = [ [ id:'test', single_end:false ], // meta map - file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] """ } @@ -42,7 +42,7 @@ nextflow_process { """ input[0] = [ [ id:'test', single_end:false ], // meta map - file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] """ } @@ -66,7 +66,7 @@ nextflow_process { """ input[0] = [ [ id:'test', single_end:false ], // meta map - file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] """ } @@ -90,7 +90,7 @@ nextflow_process { """ input[0] = [ [ id:'test', single_end:false ], // meta map - file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] """ } @@ -114,7 +114,7 @@ nextflow_process { """ input[0] = [ [ id:'test', single_end:false ], // meta map - file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] """ } diff --git a/modules/nf-core/vsearch/sintax/environment.yml b/modules/nf-core/vsearch/sintax/environment.yml index 16e8d300..acba2f67 100644 --- a/modules/nf-core/vsearch/sintax/environment.yml +++ b/modules/nf-core/vsearch/sintax/environment.yml @@ -1,7 +1,5 @@ -name: vsearch_sintax channels: - conda-forge - bioconda - - defaults dependencies: - bioconda::vsearch=2.21.1 diff --git a/modules/nf-core/vsearch/sintax/meta.yml b/modules/nf-core/vsearch/sintax/meta.yml index 6346260e..7b387b90 100644 --- a/modules/nf-core/vsearch/sintax/meta.yml +++ b/modules/nf-core/vsearch/sintax/meta.yml @@ -3,34 +3,47 @@ description: Taxonomic classification using the sintax algorithm. keywords: - vsearch - sintax + - taxonomy tools: - "vsearch": - description: "VSEARCH is a versatile open-source tool for microbiome analysis, including chimera detection, clustering, dereplication and rereplication, extraction, FASTA/FASTQ/SFF file processing, masking, orienting, pair-wise alignment, restriction site cutting, searching, shuffling, sorting, subsampling, and taxonomic classification of amplicon sequences for metagenomics, genomics, and population genetics. (USEARCH alternative)" + description: "VSEARCH is a versatile open-source tool for microbiome analysis, + including chimera detection, clustering, dereplication and rereplication, extraction, + FASTA/FASTQ/SFF file processing, masking, orienting, pair-wise alignment, restriction + site cutting, searching, shuffling, sorting, subsampling, and taxonomic classification + of amplicon sequences for metagenomics, genomics, and population genetics. (USEARCH + alternative)" homepage: "https://github.com/torognes/vsearch" tool_dev_url: "https://github.com/torognes/vsearch" doi: "10.7717/peerj.2584" - licence: "['GPL v3-or-later OR BSD-2-clause']" + licence: ["GPL v3-or-later OR BSD-2-clause"] + identifier: biotools:vsearch input: - - meta: - type: map - description: Groovy Map containing query file information e.g. [ id:'test' ] - - queryfasta: - type: file - description: Query sequences in FASTA or FASTQ format - pattern: "*.{fasta,fa,fna,faa,fastq,fq}" - - db: - type: file - description: Reference database file in FASTA or UDB format - pattern: "*" + - - meta: + type: map + description: Groovy Map containing query file information e.g. [ id:'test' ] + - queryfasta: + type: file + description: Query sequences in FASTA or FASTQ format + pattern: "*.{fasta,fa,fna,faa,fastq,fq}" + - - db: + type: file + description: Reference database file in FASTA or UDB format + pattern: "*" output: - tsv: - type: file - description: Results written to tab-delimited file - pattern: "*.{tsv}" + - meta: + type: file + description: Results written to tab-delimited file + pattern: "*.{tsv}" + - "*.tsv": + type: file + description: Results written to tab-delimited file + pattern: "*.{tsv}" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@jtangrot" maintainers: diff --git a/modules/nf-core/vsearch/sintax/tests/main.nf.test b/modules/nf-core/vsearch/sintax/tests/main.nf.test new file mode 100644 index 00000000..ebad65cb --- /dev/null +++ b/modules/nf-core/vsearch/sintax/tests/main.nf.test @@ -0,0 +1,33 @@ + +nextflow_process { + + name "Test Process VSEARCH_SINTAX" + script "../main.nf" + process "VSEARCH_SINTAX" + + tag "modules" + tag "modules_nfcore" + tag "vsearch" + tag "vsearch/sintax" + + test("test-vsearch-sintax") { + + when { + process { + """ + input[0] = [[id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + input[1] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/transcriptome.fasta', checkIfExists: true) + + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + +} diff --git a/modules/nf-core/vsearch/sintax/tests/main.nf.test.snap b/modules/nf-core/vsearch/sintax/tests/main.nf.test.snap new file mode 100644 index 00000000..769bf051 --- /dev/null +++ b/modules/nf-core/vsearch/sintax/tests/main.nf.test.snap @@ -0,0 +1,35 @@ +{ + "test-vsearch-sintax": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.tsv:md5,93bc75fb89343e23fbae971df157b14a" + ] + ], + "1": [ + "versions.yml:md5,6584e256329124c6abe9e76715edfe92" + ], + "tsv": [ + [ + { + "id": "test" + }, + "test.tsv:md5,93bc75fb89343e23fbae971df157b14a" + ] + ], + "versions": [ + "versions.yml:md5,6584e256329124c6abe9e76715edfe92" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-08-27T11:46:06.901625" + } +} \ No newline at end of file diff --git a/modules/nf-core/vsearch/usearchglobal/environment.yml b/modules/nf-core/vsearch/usearchglobal/environment.yml index a4f4e862..acba2f67 100644 --- a/modules/nf-core/vsearch/usearchglobal/environment.yml +++ b/modules/nf-core/vsearch/usearchglobal/environment.yml @@ -1,7 +1,5 @@ -name: vsearch_usearchglobal channels: - conda-forge - bioconda - - defaults dependencies: - bioconda::vsearch=2.21.1 diff --git a/modules/nf-core/vsearch/usearchglobal/meta.yml b/modules/nf-core/vsearch/usearchglobal/meta.yml index dc953946..9f4b4203 100644 --- a/modules/nf-core/vsearch/usearchglobal/meta.yml +++ b/modules/nf-core/vsearch/usearchglobal/meta.yml @@ -1,5 +1,6 @@ name: "vsearch_usearchglobal" -description: Compare target sequences to fasta-formatted query sequences using global pairwise alignment. +description: Compare target sequences to fasta-formatted query sequences using global + pairwise alignment. keywords: - vsearch - usearch @@ -7,74 +8,136 @@ keywords: - fasta tools: - "vsearch": - description: "VSEARCH is a versatile open-source tool for microbiome analysis, including chimera detection, clustering, dereplication and rereplication, extraction, FASTA/FASTQ/SFF file processing, masking, orienting, pair-wise alignment, restriction site cutting, searching, shuffling, sorting, subsampling, and taxonomic classification of amplicon sequences for metagenomics, genomics, and population genetics. (USEARCH alternative)" + description: "VSEARCH is a versatile open-source tool for microbiome analysis, + including chimera detection, clustering, dereplication and rereplication, extraction, + FASTA/FASTQ/SFF file processing, masking, orienting, pair-wise alignment, restriction + site cutting, searching, shuffling, sorting, subsampling, and taxonomic classification + of amplicon sequences for metagenomics, genomics, and population genetics. (USEARCH + alternative)" homepage: "https://github.com/torognes/vsearch" tool_dev_url: "https://github.com/torognes/vsearch" doi: "10.7717/peerj.2584" - licence: "['GPL v3-or-later OR BSD-2-clause']" + licence: ["GPL v3-or-later OR BSD-2-clause"] + identifier: biotools:vsearch input: - - meta: - type: map - description: Groovy Map containing sample information e.g. [ id:'test' ] - - queryfasta: - type: file - description: Query sequences in FASTA format - pattern: "*.{fasta,fa,fna,faa}" - - db: - type: file - description: Reference database file in FASTA or UDB format - pattern: "*" - - idcutoff: - type: real - description: Reject the sequence match if the pairwise identity is lower than the given id cutoff value (value ranging from 0.0 to 1.0 included) - - outoption: - type: string - description: Specify the type of output file to be generated by selecting one of the vsearch output file options - pattern: "alnout|biomout|blast6out|mothur_shared_out|otutabout|samout|uc|userout|lcaout" - - user_columns: - type: string - description: If using the `userout` option, specify which columns to include in output, with fields separated with `+` (e.g. query+target+id). See USEARCH manual for valid options. For other output options, use an empty string. + - - meta: + type: map + description: Groovy Map containing sample information e.g. [ id:'test' ] + - queryfasta: + type: file + description: Query sequences in FASTA format + pattern: "*.{fasta,fa,fna,faa}" + - - db: + type: file + description: Reference database file in FASTA or UDB format + pattern: "*" + - - idcutoff: + type: float + description: Reject the sequence match if the pairwise identity is lower than + the given id cutoff value (value ranging from 0.0 to 1.0 included) + - - outoption: + type: string + description: Specify the type of output file to be generated by selecting one + of the vsearch output file options + pattern: "alnout|biomout|blast6out|mothur_shared_out|otutabout|samout|uc|userout|lcaout" + - - user_columns: + type: string + description: If using the `userout` option, specify which columns to include + in output, with fields separated with `+` (e.g. query+target+id). See USEARCH + manual for valid options. For other output options, use an empty string. output: - aln: - type: file - description: Results in pairwise alignment format - pattern: "*.{aln}" + - meta: + type: file + description: Results in pairwise alignment format + pattern: "*.{aln}" + - "*.aln": + type: file + description: Results in pairwise alignment format + pattern: "*.{aln}" - biom: - type: file - description: Results in an OTU table in the biom version 1.0 file format - pattern: "*.{biom}" + - meta: + type: file + description: Results in an OTU table in the biom version 1.0 file format + pattern: "*.{biom}" + - "*.biom": + type: file + description: Results in an OTU table in the biom version 1.0 file format + pattern: "*.{biom}" - lca: - type: file - description: Last common ancestor (LCA) information about the hits of each query in tab-separated format - pattern: "*.{lca}" + - meta: + type: file + description: Last common ancestor (LCA) information about the hits of each query + in tab-separated format + pattern: "*.{lca}" + - "*.lca": + type: file + description: Last common ancestor (LCA) information about the hits of each query + in tab-separated format + pattern: "*.{lca}" - mothur: - type: file - description: Results in an OTU table in the mothur ’shared’ tab-separated plain text file format - pattern: "*.{mothur}" + - meta: + type: file + description: Results in an OTU table in the mothur ’shared’ tab-separated plain + text file format + pattern: "*.{mothur}" + - "*.mothur": + type: file + description: Results in an OTU table in the mothur ’shared’ tab-separated plain + text file format + pattern: "*.{mothur}" - otu: - type: file - description: Results in an OTU table in the classic tab-separated plain text format - pattern: "*.{otu}" + - meta: + type: file + description: Results in an OTU table in the classic tab-separated plain text + format + pattern: "*.{otu}" + - "*.otu": + type: file + description: Results in an OTU table in the classic tab-separated plain text + format + pattern: "*.{otu}" - sam: - type: file - description: Results written in sam format - pattern: "*.{sam}" + - meta: + type: file + description: Results written in sam format + pattern: "*.{sam}" + - "*.sam": + type: file + description: Results written in sam format + pattern: "*.{sam}" - tsv: - type: file - description: Results in tab-separated output, columns defined by user - pattern: "*.{tsv}" + - meta: + type: file + description: Results in tab-separated output, columns defined by user + pattern: "*.{tsv}" + - "*.tsv": + type: file + description: Results in tab-separated output, columns defined by user + pattern: "*.{tsv}" - txt: - type: file - description: Tab delimited results in blast-like tabular format - pattern: "*.{txt}" + - meta: + type: file + description: Tab delimited results in blast-like tabular format + pattern: "*.{txt}" + - "*.txt": + type: file + description: Tab delimited results in blast-like tabular format + pattern: "*.{txt}" - uc: - type: file - description: Tab delimited results in a uclust-like format with 10 columns - pattern: "*.{uc}" + - meta: + type: file + description: Tab delimited results in a uclust-like format with 10 columns + pattern: "*.{uc}" + - "*.uc": + type: file + description: Tab delimited results in a uclust-like format with 10 columns + pattern: "*.{uc}" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@jtangrot" maintainers: diff --git a/modules/nf-core/vsearch/usearchglobal/tests/main.nf.test b/modules/nf-core/vsearch/usearchglobal/tests/main.nf.test new file mode 100644 index 00000000..756895b4 --- /dev/null +++ b/modules/nf-core/vsearch/usearchglobal/tests/main.nf.test @@ -0,0 +1,64 @@ + +nextflow_process { + + name "Test Process VSEARCH_USEARCHGLOBAL" + script "../main.nf" + process "VSEARCH_USEARCHGLOBAL" + + tag "modules" + tag "modules_nfcore" + tag "vsearch" + tag "vsearch/usearchglobal" + + test("test-vsearch-usearchglobal") { + + when { + process { + """ + input[0] = [[id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/transcriptome.fasta', checkIfExists: true)] + input[1] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + input[2] = 0.985 + input[3] = "xcfert" + input[4] = "" + + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert file(process.out.aln[0][1]).text.contains('Query >lcl|MT192765.1_cds_QIK50427.1_2') }, + { assert snapshot( + file(process.out.aln[0][1]).name, + process.out.versions + ).match() + } + ) + } + } + + test("test-vsearch-usearchglobal-userout") { + + when { + process { + """ + input[0] = [[id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/transcriptome.fasta', checkIfExists: true)] + input[1] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + input[2] = 0.985 + input[3] = "userout" + input[4] = "query+target+id" + + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + +} diff --git a/modules/nf-core/vsearch/usearchglobal/tests/main.nf.test.snap b/modules/nf-core/vsearch/usearchglobal/tests/main.nf.test.snap new file mode 100644 index 00000000..5b1b348a --- /dev/null +++ b/modules/nf-core/vsearch/usearchglobal/tests/main.nf.test.snap @@ -0,0 +1,96 @@ +{ + "test-vsearch-usearchglobal": { + "content": [ + "test.aln", + [ + "versions.yml:md5,12310613a8f7129bab978fdfb8ac8bc4" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-08-22T17:11:19.035984" + }, + "test-vsearch-usearchglobal-userout": { + "content": [ + { + "0": [ + + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + + ], + "4": [ + + ], + "5": [ + + ], + "6": [ + [ + { + "id": "test" + }, + "test.tsv:md5,b6cc50f7c8d18cb82e74dab70ed4baab" + ] + ], + "7": [ + + ], + "8": [ + + ], + "9": [ + "versions.yml:md5,12310613a8f7129bab978fdfb8ac8bc4" + ], + "aln": [ + + ], + "biom": [ + + ], + "lca": [ + + ], + "mothur": [ + + ], + "otu": [ + + ], + "sam": [ + + ], + "tsv": [ + [ + { + "id": "test" + }, + "test.tsv:md5,b6cc50f7c8d18cb82e74dab70ed4baab" + ] + ], + "txt": [ + + ], + "uc": [ + + ], + "versions": [ + "versions.yml:md5,12310613a8f7129bab978fdfb8ac8bc4" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-08-22T16:33:20.01829" + } +} \ No newline at end of file From 2c22f747a378932c2088d6774ed6ce5eeeb79dc5 Mon Sep 17 00:00:00 2001 From: d4straub Date: Tue, 12 Nov 2024 15:24:54 +0100 Subject: [PATCH 20/26] update changelog --- CHANGELOG.md | 3 ++- 1 file changed, 2 insertions(+), 1 deletion(-) diff --git a/CHANGELOG.md b/CHANGELOG.md index 9a59f85e..af0c4239 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -15,13 +15,14 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### `Fixed` -- [#792](https://github.com/nf-core/ampliseq/pull/792) - Remove white spaces in process tags to avoid errors on some systems - [#785](https://github.com/nf-core/ampliseq/pull/785) - Template update for nf-core/tools version 3.0.2 - [#786](https://github.com/nf-core/ampliseq/pull/786) - Creation of the summary report was failing with `--dada_ref_taxonomy silva=132` +- [#792](https://github.com/nf-core/ampliseq/pull/792) - Remove white spaces in process tags to avoid errors on some systems ### `Dependencies` - [#785](https://github.com/nf-core/ampliseq/pull/785) - Update MultiQC +- [#793](https://github.com/nf-core/ampliseq/pull/793) - Update Picrust2 and nf-core modules | software | previously | now | | -------- | ---------- | ------ | From 45a764cc00fdc75bc6e67baf4d8d5542ad9c0747 Mon Sep 17 00:00:00 2001 From: d4straub Date: Wed, 13 Nov 2024 11:37:05 +0100 Subject: [PATCH 21/26] bump version 2.12.0 --- .nf-core.yml | 2 +- assets/multiqc_config.yml | 4 ++-- nextflow.config | 2 +- 3 files changed, 4 insertions(+), 4 deletions(-) diff --git a/.nf-core.yml b/.nf-core.yml index db3cd2f0..85c8915d 100644 --- a/.nf-core.yml +++ b/.nf-core.yml @@ -23,7 +23,7 @@ template: outdir: . skip_features: - igenomes - version: 2.12.0dev + version: 2.12.0 update: https://github.com/nf-core/modules.git: nf-core: diff --git a/assets/multiqc_config.yml b/assets/multiqc_config.yml index a363d72d..699ea0f7 100644 --- a/assets/multiqc_config.yml +++ b/assets/multiqc_config.yml @@ -1,7 +1,7 @@ report_comment: > - This report has been generated by the nf-core/ampliseq + This report has been generated by the nf-core/ampliseq analysis pipeline. For information about how to interpret these results, please see the - documentation. + documentation. report_section_order: "nf-core-ampliseq-methods-description": order: -1000 diff --git a/nextflow.config b/nextflow.config index 3894f9fb..4fb664b5 100644 --- a/nextflow.config +++ b/nextflow.config @@ -346,7 +346,7 @@ manifest { description = """Amplicon sequencing analysis workflow using DADA2 and QIIME2""" mainScript = 'main.nf' nextflowVersion = '!>=24.04.2' - version = '2.12.0dev' + version = '2.12.0' doi = '10.5281/zenodo.1493841,10.3389/fmicb.2020.550420' } From 96be42b0bd5f3e7bbc058f52bd94af80ea8b3b9a Mon Sep 17 00:00:00 2001 From: d4straub Date: Wed, 13 Nov 2024 11:39:32 +0100 Subject: [PATCH 22/26] update CHANGELOG --- CHANGELOG.md | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/CHANGELOG.md b/CHANGELOG.md index af0c4239..06384802 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -3,7 +3,7 @@ The format is based on [Keep a Changelog](https://keepachangelog.com/en/1.0.0/) and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0.html). -## nf-core/ampliseq version 2.12.0dev +## nf-core/ampliseq version 2.12.0 ### `Added` @@ -15,7 +15,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 ### `Fixed` -- [#785](https://github.com/nf-core/ampliseq/pull/785) - Template update for nf-core/tools version 3.0.2 +- [#785](https://github.com/nf-core/ampliseq/pull/785),[#795](https://github.com/nf-core/ampliseq/pull/795) - Template update for nf-core/tools version 3.0.2 - [#786](https://github.com/nf-core/ampliseq/pull/786) - Creation of the summary report was failing with `--dada_ref_taxonomy silva=132` - [#792](https://github.com/nf-core/ampliseq/pull/792) - Remove white spaces in process tags to avoid errors on some systems From 0052ee05845b7840976f9b106a9904c85fbe0876 Mon Sep 17 00:00:00 2001 From: d4straub Date: Wed, 13 Nov 2024 12:22:19 +0100 Subject: [PATCH 23/26] include custom configs --- nextflow.config | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/nextflow.config b/nextflow.config index 4fb664b5..97d006e7 100644 --- a/nextflow.config +++ b/nextflow.config @@ -286,7 +286,7 @@ includeConfig !System.getenv('NXF_OFFLINE') && params.custom_config_base ? "${pa // Load nf-core/ampliseq custom profiles from different institutions. // nf-core: Optionally, you can add a pipeline-specific nf-core config at https://github.com/nf-core/configs -// includeConfig !System.getenv('NXF_OFFLINE') && params.custom_config_base ? "${params.custom_config_base}/pipeline/ampliseq.config" : "/dev/null" +includeConfig !System.getenv('NXF_OFFLINE') && params.custom_config_base ? "${params.custom_config_base}/pipeline/ampliseq.config" : "/dev/null" // Set default registry for Apptainer, Docker, Podman, Charliecloud and Singularity independent of -profile // Will not be used unless Apptainer / Docker / Podman / Charliecloud / Singularity are enabled From 88b5322c8f977a5cca7321c959c149727f79d611 Mon Sep 17 00:00:00 2001 From: d4straub Date: Wed, 13 Nov 2024 12:26:11 +0100 Subject: [PATCH 24/26] update docs --- docs/usage.md | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/docs/usage.md b/docs/usage.md index 0ca85af0..3a340800 100644 --- a/docs/usage.md +++ b/docs/usage.md @@ -323,7 +323,7 @@ nextflow pull nf-core/ampliseq It is a good idea to specify a pipeline version when running the pipeline on your data. This ensures that a specific version of the pipeline code and software are used when you run your pipeline. If you keep using the same tag, you'll be running the same version of the pipeline, even if there have been changes to the code since. -First, go to the [nf-core/ampliseq releases page](https://github.com/nf-core/ampliseq/releases) and find the latest pipeline version - numeric only (eg. `2.4.1`). Then specify this when running the pipeline with `-r` (one hyphen) - eg. `-r 2.4.1`. Of course, you can switch to another version by changing the number after the `-r` flag. +First, go to the [nf-core/ampliseq releases page](https://github.com/nf-core/ampliseq/releases) and find the latest pipeline version - numeric only (eg. `2.12.0`). Then specify this when running the pipeline with `-r` (one hyphen) - eg. `-r 2.12.0`. Of course, you can switch to another version by changing the number after the `-r` flag. This version number will be logged in reports when you run the pipeline, so that you'll know what you used when you look back in the future. For example, at the bottom of the MultiQC reports. From 9162fe0d035f2b598646366608eb19be88ac5d72 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Matthias=20H=C3=B6rtenhuber?= Date: Thu, 14 Nov 2024 09:02:17 +0000 Subject: [PATCH 25/26] disable checking for reviews on workflow_dispatch --- .github/workflows/awsfulltest.yml | 1 + 1 file changed, 1 insertion(+) diff --git a/.github/workflows/awsfulltest.yml b/.github/workflows/awsfulltest.yml index 95e89f04..601d5edb 100644 --- a/.github/workflows/awsfulltest.yml +++ b/.github/workflows/awsfulltest.yml @@ -19,6 +19,7 @@ jobs: runs-on: ubuntu-latest steps: - uses: octokit/request-action@v2.x + if: github.event_name != 'workflow_dispatch' id: check_approvals with: route: GET /repos/${{ github.repository }}/pulls/${{ github.event.pull_request.number }}/reviews From ca63a521edd3bbc3f0508375db9dc65688f9471e Mon Sep 17 00:00:00 2001 From: Daniel Straub <42973691+d4straub@users.noreply.github.com> Date: Thu, 14 Nov 2024 14:13:20 +0100 Subject: [PATCH 26/26] Apply suggestions from code review --- CHANGELOG.md | 3 ++- 1 file changed, 2 insertions(+), 1 deletion(-) diff --git a/CHANGELOG.md b/CHANGELOG.md index 06384802..ee2c5472 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -3,7 +3,7 @@ The format is based on [Keep a Changelog](https://keepachangelog.com/en/1.0.0/) and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0.html). -## nf-core/ampliseq version 2.12.0 +## nf-core/ampliseq version 2.12.0 - 2024-11-14 ### `Added` @@ -27,6 +27,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0 | software | previously | now | | -------- | ---------- | ------ | | MultiQC | 1.21 | 1.25.1 | +| Kraken2 | 2.1.2 | 2.1.3 | | Picrust2 | 2.5.2 | 2.5.3 | ### `Removed`