diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml
index 977a90167..859aa6424 100644
--- a/.github/workflows/ci.yml
+++ b/.github/workflows/ci.yml
@@ -109,7 +109,18 @@ jobs:
       with:
         start: yarn serve
         wait-on: http://localhost:8080/
-        config_file: cypress.json
+        config-file: cypress.json
         spec: "tests/e2e/**/*"
       env:
-        CYPRESS_baseUrl: http://localhost:8080/
\ No newline at end of file
+        CYPRESS_baseUrl: http://localhost:8080/
+    # after the test run completes
+    # store any screenshots
+    # NOTE: screenshots will be generated only if E2E test failed
+    # thus we store screenshots only on failures
+    # Alternative: create and commit an empty cypress/screenshots folder
+    # to always have something to upload
+    - uses: actions/upload-artifact@v1
+      if: failure()
+      with:
+        name: cypress-screenshots
+        path: tests/e2e/screenshots
diff --git a/.release-version b/.release-version
index 2009c7dfa..fcdb2e109 100644
--- a/.release-version
+++ b/.release-version
@@ -1 +1 @@
-3.9.2
+4.0.0
diff --git a/jest.config.js b/jest.config.js
index 9be4acf1c..11f5a67a1 100644
--- a/jest.config.js
+++ b/jest.config.js
@@ -23,7 +23,9 @@ module.exports = {
   ],
   moduleNameMapper: {
     '^@/(.*)$': '<rootDir>/src/$1',
+    '^@tests/(.*)$': '<rootDir>/tests/$1',
   },
+  modulePaths: ['<rootDir>/tests/support/'],
   snapshotSerializers: [
     'jest-serializer-vue', //
   ],
diff --git a/lefthook.yml b/lefthook.yml
index 3bf891b23..7718c5311 100644
--- a/lefthook.yml
+++ b/lefthook.yml
@@ -17,3 +17,14 @@ pre-commit:
     eslint:
       glob: '*.{js,vue}'
       run: yarn lint {staged_files}
+
+fix:
+  parallel: false
+  commands:
+    prettier:
+      glob: '*.{js,vue}'
+      run: yarn prettier -write {staged_files} --ignore-unknown
+
+    eslint:
+      glob: '*.{js,vue}'
+      run: yarn lint {staged_files}
diff --git a/src/App.vue b/src/App.vue
index ddd93cc01..fd9178add 100644
--- a/src/App.vue
+++ b/src/App.vue
@@ -1,9 +1,13 @@
 <template>
-  <b-container id="app">
+  <b-container id="app" fluid>
     <br />
-    <router-link to="/dashboard">
-      <h1 id="traction-header">Traction</h1>
-    </router-link>
+    <!-- TODO: move this into a header component and add pipeline to store -->
+    <b-navbar ref="navbar" toggleable="md" type="dark" variant="info">
+      <b-navbar-brand id="traction-header" to="/dashboard"><h2>Traction</h2></b-navbar-brand>
+      <b-nav-text
+        ><h2>{{ pipeline }}</h2></b-nav-text
+      >
+    </b-navbar>
     <router-view />
     <InfoFooter></InfoFooter>
   </b-container>
@@ -15,6 +19,11 @@ export default {
   components: {
     InfoFooter,
   },
+  computed: {
+    pipeline() {
+      return localStorage.getItem('pipeline')
+    },
+  },
 }
 </script>
 
@@ -25,10 +34,12 @@ export default {
   -moz-osx-font-smoothing: grayscale;
   text-align: center;
   color: #2c3e50;
-  max-width: 80rem;
+}
+nav {
+  margin-bottom: 5px;
 }
 #nav {
-  padding-bottom: 20px;
+  margin-bottom: 5px;
   a {
     font-weight: bold;
     color: #2c3e50;
diff --git a/src/api/Config.json b/src/api/Config.json
index a2374f845..de22e9043 100644
--- a/src/api/Config.json
+++ b/src/api/Config.json
@@ -46,7 +46,7 @@
         "resources": [
           {
             "name": "libraries",
-            "include": "request,tag.tag_set,tube"
+            "include": "request,tag,tube"
           },
           {
             "name": "request_library",
@@ -62,7 +62,7 @@
           },
           {
             "name": "runs",
-            "include": "plate.wells.libraries",
+            "include": "plate.wells.pools.tube",
             "resources": [
               {
                 "name": "plates",
@@ -78,9 +78,21 @@
             "name": "plates",
             "include": "wells.materials"
           },
+          {
+            "name": "tag_sets",
+            "include": "tags"
+          },
           {
             "name": "wells",
             "include": ""
+          },
+          {
+            "name": "tag_sets",
+            "include": "tags"
+          },
+          {
+            "name": "pools",
+            "include": ""
           }
         ]
       }
diff --git a/src/api/JsonApi.js b/src/api/JsonApi.js
index acc9d1a1c..a7347e712 100644
--- a/src/api/JsonApi.js
+++ b/src/api/JsonApi.js
@@ -1,10 +1,13 @@
-// TODO: This needs a refactor with some documentation
-const extractAttributes = (data) => {
-  return { id: data.id, type: data.type, ...data.attributes }
-}
+/**
+ * Extract the attributes from a JSON API resource object, merge them with the id
+ * and type attributes
+ * @param {String} id The id of the jsonapi resource
+ * @param {String} type The type of the jsonapi resource
+ * @param {Object} attributes The attributes object of a JSON API resource
+ */
+const extractAttributes = ({ id, type, attributes }) => ({ id, type, ...attributes })
 
-const mapRelationships = (relationships) => {
-  if (relationships === undefined) return {}
+const mapRelationships = (relationships = {}) => {
   return Object.keys(relationships).reduce((result, name) => {
     if (relationships[name].data) {
       result[name] = relationships[name].data
@@ -13,6 +16,63 @@ const mapRelationships = (relationships) => {
   }, {})
 }
 
+/**
+ * Groups resources by their resource type
+ * @param {Array} included Array of JSON API resources
+ */
+const groupIncludedByResource = (included) => {
+  return included.reduce((group, resource) => {
+    if (group[resource.type] === undefined) {
+      group[resource.type] = []
+    }
+    group[resource.type].push(resource)
+    return group
+  }, {})
+}
+
+/**
+ * Groups resources by their resource type
+ * @param {Object} relationships Object of JSON API resources
+ * @returns {Object} each key will be the relationships grouped by type with an array of ids
+ */
+const extractRelationshipsAndGroupById = (relationships = {}) => {
+  return Object.keys(relationships).reduce((result, type) => {
+    const data = relationships[type].data
+    if (data instanceof Array) {
+      // We have multiple entries
+      result[type] = data.map(({ id }) => id)
+    } else {
+      // Add the id data is present, otherwise add the value of data itself
+      // this may be null (No relation) or undefined (relationship not loaded)
+      result[type] = data ? data.id : data
+    }
+    return result
+  }, {})
+}
+
+/**
+ * TODO: This will need to be extended to extract relationships?
+ * Groups resources by their resource type
+ * @param {Array} data Array of JSON API data
+ * @returns {Object} keys will be the id of the data
+ */
+const dataToObjectById = ({ data = [], includeRelationships = false }) => {
+  return data.reduce((result, { id, type, attributes, relationships }) => {
+    return {
+      [id]: {
+        // we still keep the id as it will be needed
+        id,
+        // the type can be useful for components
+        type,
+        ...attributes,
+        // we might not want to use the relationships
+        ...(includeRelationships ? extractRelationshipsAndGroupById(relationships) : {}),
+      },
+      ...result,
+    }
+  }, {})
+}
+
 const extractRelationship = (relationship, included, includeStore = {}) => {
   if (Array.isArray(relationship)) {
     return relationship.map((item) => deserializeIncluded(item, included, includeStore))
@@ -88,12 +148,15 @@ const deserialize = ({ data, included }, includeStore = {}) => {
 export {
   extractAttributes,
   mapRelationships,
+  groupIncludedByResource,
   extractRelationship,
   findIncluded,
   deserializeIncluded,
   extractRelationships,
   extractResourceObject,
   deserialize,
+  dataToObjectById,
+  extractRelationshipsAndGroupById,
 }
 
 export default deserialize
diff --git a/src/api/PacbioRun.js b/src/api/PacbioRun.js
index 00714f0fc..8001ccaa2 100644
--- a/src/api/PacbioRun.js
+++ b/src/api/PacbioRun.js
@@ -19,7 +19,9 @@ const buildWell = (
   on_plate_loading_concentration: '',
   generate_hifi,
   ccs_analysis_output,
+  // TODO remove
   libraries: [],
+  pools: [],
   pre_extension_time,
 })
 
@@ -54,8 +56,8 @@ const create = async (run, request) => {
     responses.push(plateResponse)
     let plateId = plateResponse.deserialize.plates[0].id
 
-    let wellsWithLibraries = run.plate.wells.filter((well) => well.libraries.length != 0)
-    let wellsPayload = createWellsPayload(wellsWithLibraries, plateId)
+    let wellsWithPools = run.plate.wells.filter((well) => well.pools.length != 0)
+    let wellsPayload = createWellsPayload(wellsWithPools, plateId)
     let wellResponse = await createResource(wellsPayload, request.runs.wells)
     responses.push(wellResponse)
   } catch (err) {
@@ -81,8 +83,8 @@ const update = async (run, request) => {
     let runPayload = updateRunPayload(run)
     let runResponse = await updateResource(runPayload, request.runs)
     responses.push(runResponse)
-    let wellsWithLibraries = run.plate.wells.filter((well) => well.libraries.length != 0)
-    for (const well of wellsWithLibraries) {
+    let wellsWithPools = run.plate.wells.filter((well) => well.pools.length != 0)
+    for (const well of wellsWithPools) {
       if (well.id) {
         // Well exists - Update well
         let wellPayload = updateWellPayload(well)
@@ -140,8 +142,8 @@ const createPlatePayload = (runId) => {
 
 const createWellsPayload = (wells, plateId) => {
   let wellsAttributes = wells.reduce((accumulator, well) => {
-    let librariesAttributes = well.libraries.map((l) => {
-      return { type: 'libraries', id: l.id }
+    let poolsAttributes = well.pools.map((l) => {
+      return { type: 'pools', id: l.id }
     })
 
     accumulator.push({
@@ -160,8 +162,8 @@ const createWellsPayload = (wells, plateId) => {
             id: plateId,
           },
         },
-        libraries: {
-          data: librariesAttributes,
+        pools: {
+          data: poolsAttributes,
         },
       },
     })
@@ -195,8 +197,8 @@ const updateRunPayload = (run) => {
 }
 
 const updateWellPayload = (well) => {
-  let librariesAttributes = well.libraries.map((l) => {
-    return { type: 'libraries', id: l.id }
+  let poolsAttributes = well.pools.map((l) => {
+    return { type: 'pools', id: l.id }
   })
 
   return {
@@ -214,8 +216,8 @@ const updateWellPayload = (well) => {
         pre_extension_time: well.pre_extension_time,
       },
       relationships: {
-        libraries: {
-          data: librariesAttributes,
+        pools: {
+          data: poolsAttributes,
         },
       },
     },
diff --git a/src/api/ResponseHelper.js b/src/api/ResponseHelper.js
new file mode 100644
index 000000000..363a013ae
--- /dev/null
+++ b/src/api/ResponseHelper.js
@@ -0,0 +1,66 @@
+/*
+ * @param {Object} errors
+ * @param {Object} error
+ * @returns {String or Object}
+ * TODO: Still wondering if there is more to do to make this more robust
+ * but probably better to find out with a bit of testing
+ */
+const parseErrors = ({ data, error }) => {
+  // if its stand alone return it
+  if (error) {
+    return error
+  }
+  // turn it into something nice i.e. a readable string if it is a 422
+  if (data.errors) {
+    const errors = data.errors
+    return Object.keys(errors)
+      .map((key) => {
+        return errors[key].map((item) => `${key} ${item}`).join(', ')
+      })
+      .join(', ')
+  } else {
+    return data
+  }
+}
+
+/*
+ * @param Boolean success
+ * @param {Object} data e.g. { data: { id: 1}}
+ * @returns { Boolean, {Object}, String} { success, data, errors } e.g. { success: true, data: {id: 1}} or {success: false, errors: 'there was an error'}
+ */
+const newResponse = ({ success, data, error }) => ({
+  success,
+  data,
+  // we need to parse the errors into something viewable
+  errors: !success ? parseErrors({ data, error }) : undefined,
+})
+
+/*
+ * @param {AxiosPromise} promise
+ * @returns {newResponse}
+ */
+const handleResponse = async (promise) => {
+  try {
+    // yay it worked.
+    const rawResponse = await promise
+    return newResponse({ success: true, ...rawResponse })
+  } catch (error) {
+    // we only want this to output during development or production
+    // eslint has got this wrong as it is always a string
+    // eslint-disable-next-line no-extra-boolean-cast
+    if (!!+process.env.VUE_APP_LOG) {
+      console.error(error)
+    }
+
+    // 400-500 range will throw an error with a response
+    if (error.response) {
+      return newResponse({ success: false, ...error.response })
+    }
+    // e.g. a network error which will not elicit an Axios response
+    return newResponse({ success: false, error, data: undefined })
+  }
+}
+
+export { newResponse, handleResponse }
+
+export default handleResponse
diff --git a/src/components/Alert.vue b/src/components/Alert.vue
index f2f27c071..59f773a93 100644
--- a/src/components/Alert.vue
+++ b/src/components/Alert.vue
@@ -3,6 +3,7 @@
     <b-alert
       id="showAlert"
       :variant="type"
+      data-type="error-message"
       dismissible
       :show="showDismissibleAlert"
       @dismissed="showDismissibleAlert = false"
diff --git a/src/components/ont/OntPlate.vue b/src/components/ont/OntPlate.vue
index 5989a57c0..3f62d3496 100644
--- a/src/components/ont/OntPlate.vue
+++ b/src/components/ont/OntPlate.vue
@@ -60,7 +60,7 @@ export default {
   },
   methods: {
     getWellAt(position) {
-      let well = this.wells.filter((well) => well.position == position)[0]
+      let well = this.wells.find((well) => well.position == position)
       return well ? well : { position: position, materials: [] }
     },
     poolSamples() {
diff --git a/src/components/pacbio/PacbioLabwareFind.vue b/src/components/pacbio/PacbioLabwareFind.vue
new file mode 100644
index 000000000..8a3a67966
--- /dev/null
+++ b/src/components/pacbio/PacbioLabwareFind.vue
@@ -0,0 +1,87 @@
+<template>
+  <b-col>
+    <b-form @submit.prevent="handleSubmit()">
+      <h3>Find plates</h3>
+      <Alert ref="alert"></Alert>
+      <b-form-input
+        v-model="enteredLabware"
+        data-input="labware-find"
+        autocomplete="off"
+        placeholder="Search or scan for labware by barcode"
+      >
+      </b-form-input>
+      <b-list-group data-type="labware-list" class="find-list-group">
+        <b-list-group-item
+          v-for="item in getFilteredList"
+          :key="item.id"
+          button
+          :active="item.selected"
+          @click="toggleSelected(item)"
+        >
+          Plate: {{ item.barcode }}
+        </b-list-group-item>
+      </b-list-group>
+    </b-form>
+  </b-col>
+</template>
+
+<script>
+import Helper from '@/mixins/Helper'
+import Alert from '@/components/Alert'
+import { createNamespacedHelpers } from 'vuex'
+const { mapMutations, mapActions } = createNamespacedHelpers('traction/pacbio/poolCreate')
+
+export default {
+  name: 'PacbioLabwareFind',
+  components: {
+    Alert,
+  },
+  mixins: [Helper],
+  data() {
+    return {
+      enteredLabware: '',
+    }
+  },
+  computed: {
+    getFilteredList() {
+      return this.labwareList.filter((labware) => labware.barcode.includes(this.enteredLabware))
+    },
+    labwareList() {
+      return this.$store.getters['traction/pacbio/poolCreate/labwareList']
+    },
+  },
+  methods: {
+    handleSubmit() {
+      let labware = this.labwareList.find((labware) => labware.barcode === this.enteredLabware)
+      labware
+        ? this.toggleSelected(labware)
+        : this.showAlert(
+            'Unable to find a plate with the barcode: ' + this.enteredLabware,
+            'danger',
+          )
+      this.enteredLabware = ''
+    },
+    toggleSelected({ id, selected }) {
+      if (selected) {
+        this.deselectPlateAndContents(id)
+      } else {
+        this.selectPlate({ id })
+      }
+    },
+    ...mapMutations(['selectPlate']),
+    ...mapActions(['deselectPlateAndContents']),
+  },
+}
+</script>
+
+<style scoped lang="scss">
+@import 'src/styles/components.scss';
+.find-list-group {
+  max-height: 150px;
+  overflow: scroll;
+}
+
+.list-group-item {
+  margin: 0;
+}
+</style>
diff --git a/src/components/pacbio/PacbioLabwareSelectedList.vue b/src/components/pacbio/PacbioLabwareSelectedList.vue
new file mode 100644
index 000000000..27ad00716
--- /dev/null
+++ b/src/components/pacbio/PacbioLabwareSelectedList.vue
@@ -0,0 +1,95 @@
+<template>
+  <b-col data-type="selected-plate-list">
+    <h3>Selected plates</h3>
+    <b-tabs content-class="mt-3" fill>
+      <b-tab title="Plates">
+        <div class="wrapper">
+          <div v-if="selectedPlates.length === 0" data-type="warning-message">
+            No plates selected
+          </div>
+          <div v-for="plate in selectedPlates" :key="plate.id" data-type="selected-plate-item">
+            {{ plate.barcode }}
+            <Plate ref="plate" v-bind="plate" @clickWell="selectWellRequests"></Plate>
+          </div>
+        </div>
+      </b-tab>
+      <b-tab title="Requests">
+        <b-list-group class="selected-list-group">
+          <b-table
+            :items="selectedPlateRequests"
+            show-empty
+            small
+            :fields="requestFields"
+            :tbody-tr-class="rowClass"
+            empty-text="No plates selected"
+            @row-clicked="requestClicked"
+          ></b-table>
+        </b-list-group>
+      </b-tab>
+    </b-tabs>
+  </b-col>
+</template>
+
+<script>
+import Helper from '@/mixins/Helper'
+import Plate from '@/components/pacbio/PacbioPlateItem'
+import { createNamespacedHelpers } from 'vuex'
+const { mapGetters, mapMutations, mapActions } = createNamespacedHelpers(
+  'traction/pacbio/poolCreate',
+)
+
+export default {
+  name: 'PacbioLabwareSelectedList',
+  components: {
+    Plate,
+  },
+  mixins: [Helper],
+  data() {
+    return {
+      requestFields: [
+        'source_identifier',
+        'sample_species',
+        'library_type',
+        'number_of_smrt_cells',
+        'estimate_of_gb_required',
+      ],
+    }
+  },
+  computed: {
+    ...mapGetters(['selectedPlates', 'wellList', 'requestList']),
+    selectedPlateRequests() {
+      // Not really sure this belongs here, and I'd prefer to see this handled
+      // in the getters.
+      return this.selectedPlates.flatMap((plate) => {
+        return this.wellList(plate.wells).flatMap((well) => {
+          return this.requestList(well.requests || [])
+        })
+      })
+    },
+  },
+  methods: {
+    ...mapMutations(['selectPlate', 'selectRequest']),
+    ...mapActions(['selectWellRequests']),
+    requestClicked({ id, selected }) {
+      this.selectRequest({ id, selected: !selected })
+    },
+    rowClass(item) {
+      if (item && item.selected) {
+        return 'table-primary'
+      }
+    },
+  },
+}
+</script>
+
+<style scoped lang="scss">
+@import 'src/styles/components.scss';
+.wrapper {
+  overflow: scroll;
+  display: flex;
+  flex-wrap: wrap;
+}
+.wrapper > div {
+  width: 50%;
+}
+</style>
diff --git a/src/components/pacbio/PacbioLibraryCreate.vue b/src/components/pacbio/PacbioLibraryCreate.vue
index ee09e6070..028509d32 100644
--- a/src/components/pacbio/PacbioLibraryCreate.vue
+++ b/src/components/pacbio/PacbioLibraryCreate.vue
@@ -33,30 +33,38 @@
           />
         </b-form-group>
 
-        <b-form-group id="input-group-1" label="Volume:" label-for="library-volume">
+        <b-form-group id="input-group-volume" label="Volume:" label-for="library-volume">
           <b-form-input
             id="library-volume"
             v-model="library.volume"
             type="number"
+            min="0"
+            step="any"
             required
-            placeholder="1.0"
+            placeholder="Example: 1.0"
           >
           </b-form-input>
         </b-form-group>
 
-        <b-form-group id="input-group-2" label="Concentration:" label-for="library-concentration">
+        <b-form-group
+          id="input-group-concentration"
+          label="Concentration:"
+          label-for="library-concentration"
+        >
           <b-form-input
             id="library-concentration"
             v-model="library.concentration"
             type="number"
+            min="0"
+            step="any"
             required
-            placeholder="1.0"
+            placeholder="Example: 1.0"
           >
           </b-form-input>
         </b-form-group>
 
         <b-form-group
-          id="input-group-2"
+          id="input-group-templatePrepKitBoxBarcode"
           label="Template prep kit box barcode:"
           label-for="library-templatePrepKitBoxBarcode"
         >
@@ -65,18 +73,24 @@
             v-model="library.templatePrepKitBoxBarcode"
             type="text"
             required
-            placeholder="ABC"
+            placeholder="Example: 012345678901234567890"
           >
           </b-form-input>
         </b-form-group>
 
-        <b-form-group id="input-group-2" label="Fragment size" label-for="library-fragmentSize">
+        <b-form-group
+          id="input-group-fragmentSize"
+          label="Fragment size"
+          label-for="library-fragmentSize"
+        >
           <b-form-input
             id="library-fragmentSize"
             v-model="library.fragmentSize"
             type="number"
             required
-            placeholder="100"
+            step="1"
+            min="0"
+            placeholder="Example: 100"
           >
           </b-form-input>
         </b-form-group>
diff --git a/src/components/pacbio/PacbioPlateItem.vue b/src/components/pacbio/PacbioPlateItem.vue
new file mode 100644
index 000000000..861318a6c
--- /dev/null
+++ b/src/components/pacbio/PacbioPlateItem.vue
@@ -0,0 +1,74 @@
+<template>
+  <div data-type="plate-item">
+    <Plate96SVG v-if="wells" ref="plate96Svg" height="100%" width="100%">
+      <Well
+        v-for="well in mappedWells"
+        :key="well.position"
+        ref="well"
+        v-bind="well"
+        @click="clickWell(well.id)"
+      >
+      </Well>
+    </Plate96SVG>
+  </div>
+</template>
+
+<script>
+import Plate96SVG from '@/components/svg/Plate96SVG'
+import Well from '@/components/pacbio/PacbioWellItem'
+
+export default {
+  name: 'Plate',
+  components: {
+    Plate96SVG,
+    Well,
+  },
+  props: {
+    id: {
+      type: String,
+      default() {
+        return ''
+      },
+    },
+    barcode: {
+      type: String,
+      default() {
+        return ''
+      },
+    },
+    wells: {
+      type: Array,
+      default() {
+        return []
+      },
+    },
+  },
+  data() {
+    return {
+      wellData: [],
+    }
+  },
+  computed: {
+    mappedWells() {
+      return Object.entries(this.plateMap.wells).map(([position, mapWell]) => {
+        return this.getWellAt(mapWell, position)
+      })
+    },
+    plateMap() {
+      return this.$store.getters.plateMap
+    },
+  },
+  mounted() {
+    this.wellData = this.$store.getters['traction/pacbio/poolCreate/wellList'](this.wells)
+  },
+  methods: {
+    getWellAt(mapWell, position) {
+      let well = this.wellData.find((well) => well.position == position)
+      return well ? { ...mapWell, ...well } : mapWell
+    },
+    clickWell(id) {
+      this.$emit('clickWell', id)
+    },
+  },
+}
+</script>
diff --git a/src/components/pacbio/PacbioPoolLibraryEdit.vue b/src/components/pacbio/PacbioPoolLibraryEdit.vue
new file mode 100644
index 000000000..75e023298
--- /dev/null
+++ b/src/components/pacbio/PacbioPoolLibraryEdit.vue
@@ -0,0 +1,132 @@
+<template>
+  <b-tr data-type="pool-library-edit">
+    <b-td data-attribute="request-sample-name">
+      {{ request.sample_name }}
+    </b-td>
+    <b-td data-attribute="request-source-identifier">
+      {{ request.source_identifier }}
+    </b-td>
+    <b-td>
+      <b-form-select
+        v-if="tagList.length > 0"
+        v-model="library.tag_id"
+        data-type="tag-list"
+        :options="tagListOptions"
+        :state="hasErrors('tag_id')"
+      ></b-form-select>
+      <b-form-invalid-feedback data-attribute="tag-id-error">
+        {{ errorsFor('tag_id') }}
+      </b-form-invalid-feedback>
+    </b-td>
+    <b-td>
+      <b-form-input
+        v-model="library.template_prep_kit_box_barcode"
+        data-attribute="template-prep-kit-box-barcode"
+        :value="library.template_prep_kit_box_barcode"
+        placeholder="Template Prep Kit Box Barcode"
+        type="text"
+        title="Template Prep Kit Box Barcode"
+        :state="hasErrors('template_prep_kit_box_barcode')"
+      />
+      <b-form-invalid-feedback data-attribute="template-prep-kit-box-barcode-error">
+        {{ errorsFor('template_prep_kit_box_barcode') }}
+      </b-form-invalid-feedback>
+    </b-td>
+    <b-td>
+      <b-form-input
+        v-model="library.volume"
+        data-attribute="volume"
+        :value="library.volume"
+        placeholder="Volume"
+        type="text"
+        title="Volume"
+        :state="hasErrors('volume')"
+      />
+      <b-form-invalid-feedback data-attribute="volume-error">
+        {{ errorsFor('volume') }}
+      </b-form-invalid-feedback>
+    </b-td>
+    <b-td>
+      <b-form-input
+        v-model="library.concentration"
+        data-attribute="concentration"
+        :value="library.concentration"
+        placeholder="Concentration"
+        type="text"
+        title="Concentration"
+        :state="hasErrors('concentration')"
+      />
+      <b-form-invalid-feedback data-attribute="concentration-error">
+        {{ errorsFor('concentration') }}
+      </b-form-invalid-feedback>
+    </b-td>
+    <b-td>
+      <b-form-input
+        v-model="library.fragment_size"
+        data-attribute="fragment-size"
+        :value="library.fragment_size"
+        placeholder="Fragment Size"
+        type="text"
+        title="Fragment Size"
+        :state="hasErrors('fragment_size')"
+      />
+      <b-form-invalid-feedback data-attribute="fragment-size-error">
+        {{ errorsFor('fragment_size') }}
+      </b-form-invalid-feedback>
+    </b-td>
+  </b-tr>
+</template>
+
+<script>
+import { createNamespacedHelpers } from 'vuex'
+const { mapGetters } = createNamespacedHelpers('traction/pacbio/poolCreate')
+export default {
+  name: 'PacbioPoolLibraryEdit',
+  props: {
+    id: {
+      type: [String, Number],
+      default: '',
+    },
+    request: {
+      type: Object,
+      default() {
+        return { id: null }
+      },
+    },
+  },
+  data() {
+    return {}
+  },
+  computed: {
+    ...mapGetters(['selectedTagSet', 'libraryItem']),
+    tagList() {
+      return this.selectedTagSet.tags.map(({ id: value, group_id: text }) => ({ value, text }))
+    },
+    tagListOptions() {
+      return [{ value: null, text: 'Please select a tag' }, ...this.tagList]
+    },
+    library() {
+      return this.libraryItem(this.request.id)
+    },
+  },
+  methods: {
+    hasErrors(attribute) {
+      if (!this.library.errors) {
+        return null
+      }
+      return !this.library.errors[attribute]
+    },
+    errorsFor(attribute) {
+      return this.library.errors && this.library.errors[attribute]
+    },
+  },
+}
+</script>
+
+<style scoped lang="scss">
+td,
+.custom-select,
+.form-control {
+  font-size: 0.8em;
+}
+</style>
diff --git a/src/components/pacbio/PacbioPoolLibraryList.vue b/src/components/pacbio/PacbioPoolLibraryList.vue
new file mode 100644
index 000000000..5d4bacb1f
--- /dev/null
+++ b/src/components/pacbio/PacbioPoolLibraryList.vue
@@ -0,0 +1,98 @@
+<template>
+  <b-col v-if="selectedRequests" data-type="pool-library-list">
+    <b-alert
+      :show="!!result.message"
+      data-type="pool-create-message"
+      dismissible
+      :variant="alertVariant"
+    >
+      {{ result.message }}
+    </b-alert>
+    <h3>Pooled Samples</h3>
+    <b-table-simple>
+      <b-thead>
+        <b-tr>
+          <b-th>
+            Sample Name
+          </b-th>
+          <b-th>
+            Source
+          </b-th>
+          <b-th>
+            Tag
+          </b-th>
+          <b-th>
+            Template prep kit box barcode
+          </b-th>
+          <b-th>
+            Volume
+          </b-th>
+          <b-th>
+            Concentration
+          </b-th>
+          <b-th>
+            Fragment Size
+          </b-th>
+        </b-tr>
+      </b-thead>
+      <b-tbody>
+        <PacbioPoolLibraryEdit
+          v-for="request in selectedRequests"
+          :key="request.id"
+          :request="request"
+        ></PacbioPoolLibraryEdit>
+      </b-tbody>
+    </b-table-simple>
+    <div class="text-right">
+      <b-button data-action="create-pool" variant="success" :disabled="busy" @click="create()">
+        <span class="button-text">Create Pool </span>
+        <b-spinner v-show="busy" small></b-spinner>
+      </b-button>
+    </div>
+  </b-col>
+</template>
+
+<script>
+import PacbioPoolLibraryEdit from '@/components/pacbio/PacbioPoolLibraryEdit'
+import { createNamespacedHelpers } from 'vuex'
+const { mapGetters, mapActions } = createNamespacedHelpers('traction/pacbio/poolCreate')
+
+export default {
+  name: 'PacbioPoolLibraryList',
+  components: {
+    PacbioPoolLibraryEdit,
+  },
+  data() {
+    return {
+      busy: false,
+    }
+  },
+  computed: {
+    ...mapGetters(['selectedRequests', 'result']),
+    alertVariant() {
+      return this.result.success ? 'success' : 'danger'
+    },
+  },
+
+  methods: {
+    ...mapActions(['createPool']),
+    create() {
+      this.busy = true
+      this.createPool()
+      this.busy = false
+    },
+  },
+}
+</script>
+
+<style scoped lang="scss">
+@import 'src/styles/components.scss';
+th {
+  font-size: 0.8em;
+}
+.button-text {
+  padding-right: 2px;
+  position: relative;
+  top: 2px;
+}
+</style>
diff --git a/src/components/pacbio/PacbioLibraryList.vue b/src/components/pacbio/PacbioPoolList.vue
similarity index 60%
rename from src/components/pacbio/PacbioLibraryList.vue
rename to src/components/pacbio/PacbioPoolList.vue
index 5baf805c4..fdf349fa4 100644
--- a/src/components/pacbio/PacbioLibraryList.vue
+++ b/src/components/pacbio/PacbioPoolList.vue
@@ -1,7 +1,8 @@
 <template>
-  <div class="libraries">
+  <div class="pools">
+    <alert ref="alert"></alert>
     <b-list-group class="list-group">
-      <tube v-for="library in libraries" :key="library.id" v-bind="library"> </tube>
+      <tube v-for="pool in pools" :key="pool.id" v-bind="pool"> </tube>
     </b-list-group>
   </div>
 </template>
@@ -10,20 +11,22 @@
 import Helper from '@/mixins/Helper'
 import TableHelper from '@/mixins/TableHelper'
 import { createNamespacedHelpers } from 'vuex'
-import Tube from '@/components/pacbio/PacbioLibraryTubeItem'
-const { mapActions, mapGetters } = createNamespacedHelpers('traction/pacbio/libraries')
+import Tube from '@/components/pacbio/PacbioPoolTubeItem'
+import Alert from '@/components/Alert'
+const { mapActions, mapGetters } = createNamespacedHelpers('traction/pacbio/pools')
 
 export default {
-  name: 'PacbioLibraryList',
+  name: 'PacbioPoolList',
   components: {
     Tube,
+    Alert,
   },
   mixins: [Helper, TableHelper],
   data() {
     return {}
   },
   computed: {
-    ...mapGetters(['libraries']),
+    ...mapGetters(['pools']),
   },
   created() {
     this.provider()
@@ -31,18 +34,18 @@ export default {
   methods: {
     async provider() {
       try {
-        await this.setLibraries()
+        await this.setPools()
       } catch (error) {
-        this.showAlert('Failed to get libraries: ' + error.message, 'danger')
+        this.showAlert(`Failed to get pools: ${error.message}`, 'danger')
       }
     },
-    ...mapActions(['setLibraries']),
+    ...mapActions(['setPools']),
   },
 }
 </script>
 
 <style>
-.libraries {
+.pools {
   border: solid;
   border-width: 1px;
   padding: 20px;
diff --git a/src/components/pacbio/PacbioLibraryTubeItem.vue b/src/components/pacbio/PacbioPoolTubeItem.vue
similarity index 57%
rename from src/components/pacbio/PacbioLibraryTubeItem.vue
rename to src/components/pacbio/PacbioPoolTubeItem.vue
index 1589f3c58..9836eea6f 100644
--- a/src/components/pacbio/PacbioLibraryTubeItem.vue
+++ b/src/components/pacbio/PacbioPoolTubeItem.vue
@@ -6,18 +6,22 @@
     @mouseover="isActive = true"
     @mouseleave="isActive = false"
   >
-    <b-img left src="/tube.png" height="70" />
-    <div class="info">
-      <div class="barcode">
-        {{ barcode }}
-      </div>
-      <div class="sample_name">
-        {{ sample_name }}
-      </div>
-      <div class="tag_group_id">
-        {{ tag_group_id }}
-      </div>
-    </div>
+    <b-row>
+      <b-col cols="3">
+        <b-img src="/tube.png" />
+      </b-col>
+      <b-col cols="9">
+        <div class="barcode"><b>Barcode:</b> {{ barcode }}</div>
+        <b>Libraries:</b>
+        <ul>
+          <li v-for="library in libraries" :key="library.id">
+            {{ library.sample_name }}
+            <br />
+            {{ library.group_id }}
+          </li>
+        </ul>
+      </b-col>
+    </b-row>
   </b-list-group-item>
 </template>
 
@@ -32,14 +36,8 @@ export default {
       type: String,
       required: true,
     },
-    // eslint-disable-next-line vue/prop-name-casing
-    sample_name: {
-      type: String,
-      required: true,
-    },
-    // eslint-disable-next-line vue/prop-name-casing
-    tag_group_id: {
-      type: String,
+    libraries: {
+      type: Array,
       required: true,
     },
   },
@@ -59,14 +57,8 @@ export default {
 </script>
 
 <style scoped lang="scss">
-svg {
-  float: left;
-  width: 82px;
-  height: 64px;
-}
-image {
-  width: 82px;
-  height: 64px;
+img {
+  max-width: 100%;
 }
 div {
   text-align: left;
diff --git a/src/components/pacbio/PacbioRunWellEdit.vue b/src/components/pacbio/PacbioRunWellEdit.vue
index 61b9042a6..fd6fec116 100644
--- a/src/components/pacbio/PacbioRunWellEdit.vue
+++ b/src/components/pacbio/PacbioRunWellEdit.vue
@@ -1,8 +1,6 @@
 <template>
   <b-modal ref="well-modal" size="lg">
-    <template v-slot:modal-title :position="position">
-      Add Library to Well: {{ position }}
-    </template>
+    <template v-slot:modal-title :position="position"> Add Pool to Well: {{ position }} </template>
 
     <alert ref="alert"></alert>
 
@@ -87,17 +85,17 @@
       </b-form-group>
     </b-form>
 
-    <b-table id="wellLibraries" stacked :items="wellLibraries" :fields="wellLibrariesFields">
-      <template v-slot:table-caption>Libraries</template>
+    <b-table id="wellPools" stacked :items="wellPools" :fields="wellPoolsFields">
+      <template v-slot:table-caption>Pools</template>
 
       <template v-slot:cell(barcode)="row">
         <b-form inline>
           <b-form-input
-            id="libraryBarcode"
-            ref="libraryBarcode"
+            id="poolBarcode"
+            ref="poolBarcode"
             :value="`${row.item.barcode}`"
-            placeholder="Library Barcode"
-            @change="updateLibraryBarcode(row, $event)"
+            placeholder="Pool Barcode"
+            @change="updatePoolBarcode(row, $event)"
           >
           </b-form-input>
 
@@ -135,7 +133,7 @@ export default {
   data() {
     return {
       movieTimeOptions: [{ text: 'Movie Time', value: '' }, '15.0', '20.0', '24.0', '30.0'],
-      wellLibrariesFields: ['barcode'],
+      wellPoolsFields: ['barcode'],
       generateHifiOptions: {
         '': [{ text: 'Please select a System Name', value: '', disabled: true }],
         'Sequel I': ['In SMRT Link', 'Do Not Generate'],
@@ -150,7 +148,7 @@ export default {
       return ['In SMRT Link', 'On Instrument'].includes(this.generateHiFi)
     },
     ...mapGetters('traction/pacbio/runs', ['currentRun', 'well']),
-    ...mapGetters('traction/pacbio/libraries', ['libraryByBarcode']),
+    ...mapGetters('traction/pacbio/pools', ['poolByBarcode']),
     ...mapState('traction/pacbio/runs', {
       insertSize() {
         return this.well(this.position) ? this.well(this.position).insert_size : ''
@@ -163,8 +161,8 @@ export default {
       movieTime() {
         return this.well(this.position) ? this.well(this.position).movie_time : ''
       },
-      wellLibraries() {
-        return this.well(this.position) ? this.well(this.position).libraries : []
+      wellPools() {
+        return this.well(this.position) ? this.well(this.position).pools : []
       },
       preExtensionTime() {
         return this.well(this.position) ? this.well(this.position).pre_extension_time : ''
@@ -179,10 +177,10 @@ export default {
   },
   methods: {
     addRow() {
-      this.addEmptyLibraryToWell(this.position)
+      this.addEmptyPoolToWell(this.position)
     },
     removeRow(row) {
-      this.removeLibraryFromWell({ position: this.position, index: row.index })
+      this.removePoolFromWell({ position: this.position, index: row.index })
     },
     showModalForPosition() {
       if (!this.well(this.position)) {
@@ -231,31 +229,31 @@ export default {
         with: ccsAnalysisOutput,
       })
     },
-    async updateLibraryBarcode(row, barcode) {
+    async updatePoolBarcode(row, barcode) {
       let index = row.index
 
-      let isValid = await this.isLibraryBarcodeValid(barcode)
+      let isValid = await this.isPoolBarcodeValid(barcode)
 
       if (isValid) {
-        let libraryId = this.libraryByBarcode(barcode).id
+        let { id } = this.poolByBarcode(barcode)
         let payload = {
           position: this.position,
-          index: index,
-          with: { id: libraryId, barcode: barcode },
+          index,
+          with: { id, barcode },
         }
-        this.addLibraryToWell(payload)
-        this.showAlert('Library is valid', 'success')
+        this.addPoolToWell(payload)
+        this.showAlert('Pool is valid', 'success')
       } else {
-        this.showAlert('Library is not valid', 'danger')
+        this.showAlert('Pool is not valid', 'danger')
       }
     },
-    ...mapActions('traction/pacbio/tubes', ['isLibraryBarcodeValid', 'getTubeForBarcode']),
+    ...mapActions('traction/pacbio/tubes', ['isPoolBarcodeValid', 'getTubeForBarcode']),
     ...mapMutations('traction/pacbio/runs', [
       'createWell',
       'mutateWell',
-      'addEmptyLibraryToWell',
-      'removeLibraryFromWell',
-      'addLibraryToWell',
+      'addEmptyPoolToWell',
+      'removePoolFromWell',
+      'addPoolToWell',
     ]),
     alert(message, type) {
       this.$emit('alert', message, type)
diff --git a/src/components/pacbio/PacbioRunWellItem.vue b/src/components/pacbio/PacbioRunWellItem.vue
index 9c734fc57..21887d999 100644
--- a/src/components/pacbio/PacbioRunWellItem.vue
+++ b/src/components/pacbio/PacbioRunWellItem.vue
@@ -16,7 +16,7 @@
       @dragleave="endDrop"
       @click="showModal"
     >
-      <title v-if="hasLibraries" v-text="tooltip"></title>
+      <title v-if="hasPools" v-text="tooltip"></title>
     </ellipse>
     <foreignObject>
       <WellEdit ref="modal" class="modal" :position="position" @alert="alert"></WellEdit>
@@ -63,7 +63,7 @@ export default {
       type: Array,
       default() {
         // Below doesn't include 'generate_hifi', 'pre_extension_time' or 'ccs_analysis_output'
-        // as they have deafult values
+        // as they have default values
         return ['movie_time', 'insert_size', 'on_plate_loading_concentration']
       },
     },
@@ -75,17 +75,17 @@ export default {
   },
   computed: {
     ...mapGetters('traction/pacbio/runs', ['well']),
-    ...mapGetters('traction/pacbio/libraries', ['libraryByBarcode']),
+    ...mapGetters('traction/pacbio/pools', ['poolByBarcode']),
     position() {
       return `${this.row}${this.column}`
     },
     tooltip() {
-      return this.storeWell.libraries.map((l) => l.barcode).join(',')
+      return this.storeWell.pools.map((p) => p.barcode).join(',')
     },
-    hasLibraries() {
+    hasPools() {
       if (this.storeWell === undefined) return false
-      if (this.storeWell.libraries.every((l) => l.barcode == '')) return false
-      return this.storeWell.libraries.length > 0
+      if (this.storeWell.pools.every((p) => p.barcode == '')) return false
+      return this.storeWell.pools.length > 0
     },
     hasValidMetadata() {
       if (this.storeWell === undefined) return false
@@ -99,9 +99,9 @@ export default {
       return this.well(this.position)
     },
     status() {
-      if (this.hasLibraries && this.hasValidMetadata) {
+      if (this.hasPools && this.hasValidMetadata) {
         return 'complete'
-      } else if (this.hasLibraries || this.hasSomeMetadata) {
+      } else if (this.hasPools || this.hasSomeMetadata) {
         return 'filled'
       } else {
         return 'empty'
@@ -110,7 +110,7 @@ export default {
   },
   methods: {
     ...mapActions('traction/pacbio/tubes', ['getTubeForBarcode']),
-    ...mapMutations('traction/pacbio/runs', ['addLibraryToWell']),
+    ...mapMutations('traction/pacbio/runs', ['addPoolToWell']),
     alert(message, type) {
       this.$emit('alert', message, type)
     },
@@ -127,13 +127,13 @@ export default {
     },
     async drop(event) {
       event.preventDefault()
-      await this.updateLibraryBarcode(event.dataTransfer.getData('barcode'))
+      await this.updatePoolBarcode(event.dataTransfer.getData('barcode'))
       this.hover = false
     },
-    async updateLibraryBarcode(barcode) {
-      let libraryId = this.libraryByBarcode(barcode).id
-      let payload = { position: this.position, with: { id: libraryId, barcode: barcode } }
-      this.addLibraryToWell(payload)
+    async updatePoolBarcode(barcode) {
+      let poolId = this.poolByBarcode(barcode).id
+      let payload = { position: this.position, with: { id: poolId, barcode: barcode } }
+      this.addPoolToWell(payload)
     },
   },
 }
diff --git a/src/components/pacbio/PacbioTagSetItem.vue b/src/components/pacbio/PacbioTagSetItem.vue
new file mode 100644
index 000000000..346451904
--- /dev/null
+++ b/src/components/pacbio/PacbioTagSetItem.vue
@@ -0,0 +1,71 @@
+<template>
+  <b-col class="tag-set-item">
+    <div data-attribute="tag-set-name" class="tag-set-name">
+      <h3>{{ tagSetName }}</h3>
+    </div>
+    <div v-if="!isEmpty" data-type="tag-set-item" class="wrapper flex-wrap">
+      <div
+        v-for="tag in selectedTagSet.tags"
+        :key="tag.id"
+        data-attribute="group-id"
+        class="border rounded"
+        @click="setSelected(tag.id)"
+      >
+        {{ tag.group_id }}
+      </div>
+    </div>
+  </b-col>
+</template>
+
+<script>
+import { createNamespacedHelpers } from 'vuex'
+const { mapGetters } = createNamespacedHelpers('traction/pacbio/poolCreate')
+
+export default {
+  name: 'PacbioTagSetShow',
+  data() {
+    return {
+      selected: [],
+    }
+  },
+  computed: {
+    ...mapGetters(['selectedTagSet']),
+    isEmpty() {
+      return this.selectedTagSet.tags.length === 0
+    },
+    tagSetName() {
+      return this.selectedTagSet.name || 'No tag set selected'
+    },
+  },
+  methods: {
+    setSelected(id) {
+      const index = this.selected.indexOf(id)
+      if (index === -1) {
+        this.selected.push(id)
+      } else {
+        this.selected.splice(index, 1)
+      }
+    },
+  },
+}
+</script>
+
+<style scoped lang="scss">
+@import 'src/styles/components.scss';
+.wrapper {
+  display: flex;
+}
+.wrapper > div {
+  padding: 5px;
+  min-width: 100px;
+  margin: 2px;
+  height: 50px;
+  vertical-align: middle;
+}
+.tag-set-item {
+  padding-bottom: 10px;
+}
+.tag-set-name {
+  text-align: left;
+}
+</style>
diff --git a/src/components/pacbio/PacbioTagSetList.vue b/src/components/pacbio/PacbioTagSetList.vue
new file mode 100644
index 000000000..efcc0e062
--- /dev/null
+++ b/src/components/pacbio/PacbioTagSetList.vue
@@ -0,0 +1,53 @@
+<template>
+  <b-col class="tag-set-list">
+    <h3>Select tag set</h3>
+    <b-form-select
+      v-if="!isEmpty"
+      v-model="selected"
+      data-type="tag-set-list"
+      :options="options"
+      @change="updateSelected"
+    ></b-form-select>
+    <div>
+      <alert ref="alert"></alert>
+    </div>
+  </b-col>
+</template>
+
+<script>
+import Helper from '@/mixins/Helper'
+import Alert from '@/components/Alert'
+
+export default {
+  name: 'PacbioTagSetList',
+  components: { Alert },
+  mixins: [Helper],
+  data() {
+    return {
+      selected: null,
+    }
+  },
+  computed: {
+    isEmpty() {
+      return this.tagSets.length === 0
+    },
+    tagSets() {
+      return this.$store.getters[
+        'traction/pacbio/poolCreate/tagSetList'
+      ].map(({ id: value, name: text }) => ({ value, text }))
+    },
+    options() {
+      return [{ value: null, text: 'Please select a tag set' }, ...this.tagSets]
+    },
+  },
+  methods: {
+    updateSelected() {
+      this.$store.commit('traction/pacbio/poolCreate/selectTagSet', { id: this.selected })
+    },
+  },
+}
+</script>
+
+<style scoped lang="scss">
+@import 'src/styles/components.scss';
+</style>
diff --git a/src/components/pacbio/PacbioWellItem.vue b/src/components/pacbio/PacbioWellItem.vue
new file mode 100644
index 000000000..a06fbfd9c
--- /dev/null
+++ b/src/components/pacbio/PacbioWellItem.vue
@@ -0,0 +1,113 @@
+<template>
+  <ellipse :class="[checkRequest, selected]" :cx="cx" :cy="cy" :rx="rx" :ry="ry" @click="click">
+    <title v-if="getRequest" v-text="getRequest.sample_name"></title>
+  </ellipse>
+</template>
+
+<script>
+export default {
+  name: 'Well',
+  props: {
+    /**
+     * The name of the row with which the well is associated
+     * @example 'A'
+     */
+    row: {
+      type: String,
+      default: '',
+    },
+    /**
+     * The name of the column with which the well is associated
+     * @example '1'
+     */
+    column: {
+      type: String,
+      default: '',
+    },
+    /**
+     * The x-coordinate of the ellipse used to render the well. These values
+     * are usually pre-caluated, and are extracted from '@/config/PlateMap'
+     * by the plate SVG element
+     * @example 60.440327
+     */
+    cx: {
+      type: String,
+      default: '',
+    },
+    /**
+     * The x-coordinate of the ellipse used to render the well. These values
+     * are usually pre-caluated, and are extracted from '@/config/PlateMap'
+     * by the plate SVG element
+     * @example 75.818642
+     */
+    cy: {
+      type: String,
+      default: '',
+    },
+    /**
+     * The x-radius of the ellipse used to render the well. These values
+     * are usually pre-caluated, and are extracted from '@/config/PlateMap'
+     * by the plate SVG element
+     * @example 10.906492
+     */
+    rx: {
+      type: String,
+      default: '',
+    },
+    /**
+     * The y-radius of the ellipse used to render the well. These values
+     * are usually pre-caluated, and are extracted from '@/config/PlateMap'
+     * by the plate SVG element
+     * @example 11.032985
+     */
+    ry: {
+      type: String,
+      default: '',
+    },
+    /**
+     * An array of request ids associated with the well
+     */
+    requests: {
+      type: Array,
+      default() {
+        return []
+      },
+    },
+  },
+  computed: {
+    checkRequest() {
+      return this.getRequest ? 'filled' : 'empty'
+    },
+    selected() {
+      if (this.getRequest) {
+        return this.getRequest.selected ? 'selected' : 'unselected'
+      } else {
+        return 'unselected'
+      }
+    },
+    getRequest() {
+      return this.requests
+        ? this.$store.getters['traction/pacbio/poolCreate/requestList'](this.requests)[0]
+        : ''
+    },
+  },
+  methods: {
+    click() {
+      this.$emit('click')
+    },
+  },
+}
+</script>
+
+<style scoped lang="scss">
+ellipse {
+  transform: matrix(0.91863074, 0, 0, 0.92029059, 955.85411, 1007.3112);
+  stroke: #000000;
+}
+.filled {
+  fill: green;
+}
+.selected {
+  stroke: yellow;
+}
+</style>
diff --git a/src/components/plates/PlateItem.vue b/src/components/plates/PlateItem.vue
index 1675dd60d..9e5752dea 100644
--- a/src/components/plates/PlateItem.vue
+++ b/src/components/plates/PlateItem.vue
@@ -44,14 +44,9 @@ export default {
   },
   methods: {
     getWellAt(position) {
-      let well = this.wells.filter((well) => well.position == position)[0]
+      let well = this.wells.find((well) => well.position == position)
       return well && well.materials ? well : { position, materials: [] }
     },
   },
 }
 </script>
-<style>
-.b-table-sticky-header {
-  max-height: 500px;
-}
-</style>
diff --git a/src/config/PipelinesConfig.json b/src/config/PipelinesConfig.json
index 367118d40..28ff3a5c8 100644
--- a/src/config/PipelinesConfig.json
+++ b/src/config/PipelinesConfig.json
@@ -9,7 +9,7 @@
     "name": "pacbio",
     "title": "Pacbio",
     "description": "A LIMS pipeline to support tracking for PacBio Long-Read Sequencing",
-    "routes": ["reception", "plate-reception", "plates", "samples", "libraries", "runs"]
+    "routes": ["reception", "plate-reception", "plates", "samples", "libraries", "runs", "pool/new"]
   },
   {
     "name": "ont",
diff --git a/src/router.js b/src/router.js
index 2ae8ed7a5..9edd63040 100644
--- a/src/router.js
+++ b/src/router.js
@@ -23,6 +23,7 @@ import OntLibraries from './views/ont/OntLibraries'
 import OntHeronRun from './views/ont/OntHeronRun'
 import OntHeronRuns from './views/ont/OntHeronRuns'
 import PacbioReceptionPlate from './views/pacbio/PacbioReceptionPlate'
+import PacbioPoolCreate from './views/pacbio/PacbioPoolCreate'
 
 Vue.use(Router)
 
@@ -63,6 +64,7 @@ export default new Router({
         { path: 'runs', name: 'PacbioRunIndex', component: PacbioRunIndex },
         { path: 'run/:id', name: 'PacbioRunShow', component: PacbioRunShow, props: true },
         { path: 'plate-reception', name: 'PacbioPlateReception', component: PacbioReceptionPlate },
+        { path: 'pool/:id', name: 'PacbioPoolCreate', component: PacbioPoolCreate, props: true },
       ],
     },
     {
diff --git a/src/store/index.js b/src/store/index.js
index 344804fc2..1439bfc24 100644
--- a/src/store/index.js
+++ b/src/store/index.js
@@ -5,6 +5,7 @@ import build from '@/api/ApiBuilder'
 import PrinterList from '@/config/PrinterList'
 import traction from '@/store/traction'
 import sampleExtraction from '@/store/sampleExtraction'
+import PlateMap from '@/config/PlateMap'
 
 Vue.use(Vuex)
 
@@ -12,11 +13,13 @@ export default new Vuex.Store({
   state: {
     api: build({ config: Api.Config, environment: process.env }),
     printers: PrinterList,
+    plateMap: PlateMap,
   },
   mutations: {},
   getters: {
     api: (state) => state.api,
     printers: (state) => state.printers,
+    plateMap: (state) => state.plateMap,
   },
   modules: {
     traction,
diff --git a/src/store/traction/pacbio/index.js b/src/store/traction/pacbio/index.js
index 1488a6fd2..94ff4dcf7 100644
--- a/src/store/traction/pacbio/index.js
+++ b/src/store/traction/pacbio/index.js
@@ -2,7 +2,9 @@ import pacbioTubesModule from '@/store/traction/pacbio/tubes'
 import pacbioRunsModule from '@/store/traction/pacbio/runs'
 import pacbioRequestsModule from '@/store/traction/pacbio/requests'
 import pacbioLibrariesModule from '@/store/traction/pacbio/libraries'
+import pacbioPoolsModule from '@/store/traction/pacbio/pools'
 import pacbioPlatesModule from '@/store/traction/pacbio/plates'
+import poolCreate from '@/store/traction/pacbio/poolCreate'
 
 const pacbio = {
   namespaced: true,
@@ -11,7 +13,9 @@ const pacbio = {
     runs: pacbioRunsModule,
     requests: pacbioRequestsModule,
     libraries: pacbioLibrariesModule,
+    pools: pacbioPoolsModule,
     plates: pacbioPlatesModule,
+    poolCreate: poolCreate,
   },
   state: {
     labelTemplateId: process.env.VUE_APP_PACBIO_LABEL_TEMPLATE_ID,
diff --git a/src/store/traction/pacbio/poolCreate/actions.js b/src/store/traction/pacbio/poolCreate/actions.js
new file mode 100644
index 000000000..08c3e33d7
--- /dev/null
+++ b/src/store/traction/pacbio/poolCreate/actions.js
@@ -0,0 +1,83 @@
+import { groupIncludedByResource } from '@/api/JsonApi'
+import { validate, payload, valid } from '@/store/traction/pacbio/poolCreate/libraries'
+import { handleResponse } from '@/api/ResponseHelper'
+
+// Actions handle asynchronous update of state, via mutations.
+// Note: The { commit } in the given example is destucturing
+// the store context
+// see https://vuex.vuejs.org/guide/actions.html
+export default {
+  fetchPacbioPlates: async ({ commit, rootState }) => {
+    const request = rootState.api.traction.pacbio.plates
+    const promise = request.get({ include: 'wells.requests' })
+    const response = await handleResponse(promise)
+
+    const { success, data: { data, included = [] } = {}, errors = [] } = response
+
+    if (success) {
+      const { wells, requests } = groupIncludedByResource(included)
+      commit('populatePlates', data)
+      commit('populateWells', wells)
+      commit('populateRequests', requests)
+    }
+
+    return { success, errors }
+  },
+  fetchPacbioTagSets: async ({ commit, rootState }) => {
+    const request = rootState.api.traction.pacbio.tag_sets
+    /* I've been explicit about the includes here as we make an assumption
+       below that only tags are included. */
+    const promise = request.get({ include: 'tags' })
+    const response = await handleResponse(promise)
+
+    const { success, data: { data, included = [] } = {}, errors = [] } = response
+
+    if (success) {
+      commit('populateTagSets', data)
+      /* We are currently only including tags. So this is really simple */
+      commit('populateTags', included)
+    }
+
+    return { success, errors, response }
+  },
+  /**
+   * Inverts the selected state of all requests associated with a
+   * well. We May need to iterate on this if we have multiple requests
+   * per well.
+   * @param state the vuex state object. Provides access to current state
+   * @param commit the vuex commit object. Provides access to mutations
+   */
+  selectWellRequests: ({ commit, state }, well_id) => {
+    const { requests } = state.resources.wells[well_id]
+    const selectedRequests = state.libraries
+    for (let id of requests) {
+      const selected = !!selectedRequests[`_${id}`]
+      commit('selectRequest', { id, selected: !selected })
+    }
+  },
+  /**
+   * When a plate is deselected, we need to also remove all its requests
+   */
+  deselectPlateAndContents: ({ commit, state }, plateId) => {
+    commit('selectPlate', { id: plateId, selected: false })
+    const { wells } = state.resources.plates[plateId]
+    for (let wellId of wells) {
+      const { requests = [] } = state.resources.wells[wellId]
+      for (let requestId of requests) {
+        commit('selectRequest', { id: requestId, selected: false })
+      }
+    }
+  },
+
+  /*
+   * Creates a pool from the libraries
+   */
+  createPool: async ({ commit, rootState, state: { libraries } }) => {
+    validate({ libraries })
+    if (!valid({ libraries })) return
+    const request = rootState.api.traction.pacbio.pools
+    const promise = request.create(payload({ libraries }))
+    const response = await handleResponse(promise)
+    commit('populateResult', response)
+  },
+}
diff --git a/src/store/traction/pacbio/poolCreate/getters.js b/src/store/traction/pacbio/poolCreate/getters.js
new file mode 100644
index 000000000..f021e33d2
--- /dev/null
+++ b/src/store/traction/pacbio/poolCreate/getters.js
@@ -0,0 +1,128 @@
+// Getters are like computed properties
+
+/**
+ * Merge together two representations of the same object.
+ * The parent object will be mapped over, and equivalent items from the
+ * child object will be merged in. keyFuntion allwos for cases where there
+ * is not a 1:1 mapping between ids.
+ * @param {Object} parent the parent object, only resources in here will be present in the output.
+ * @param {Object} child resources with a matching id will be merged into the parent
+ * @param {fn} keyFunction convert id to the key format in the child
+ * @example mergeRepresentations(requests,selectedRequests, id => `_${id}`)
+ */
+const mergeRepresentations = (parent, child, keyFunction = (id) => id) => {
+  return Object.values(parent).map((parentRecord) => {
+    return { ...child[keyFunction(parentRecord.id)], ...parentRecord }
+  })
+}
+
+const prefixWithUnderscore = (id) => `_${id}`
+
+export default {
+  /**
+   * Returns a list of all fetched labware
+   * @param {Object} state The Vuex state object
+   */
+  labwareList: ({ selected, resources }) => {
+    return mergeRepresentations(resources.plates, selected.plates, prefixWithUnderscore)
+  },
+  /**
+   * Returns a list of all fetched tagSet
+   * @param {Object} state The Vuex state object
+   */
+  tagSetList: (state) => {
+    return Object.values(state.resources.tagSets)
+  },
+  /**
+   * Returns a list of all fetched tagSet
+   * @param {Object} state The Vuex state object
+   */
+  tagList: (state) => (ids) => {
+    const tags = state.resources.tags
+    if (ids) {
+      return ids.map((id) => tags[id])
+    } else {
+      return tags.values
+    }
+  },
+  /**
+   * Returns the selected tag set
+   * @param {Object} state The Vuex state object
+   */
+  selectedTagSet: ({ resources, selected }) => {
+    if (selected.tagSet.id) {
+      const tagSet = resources.tagSets[selected.tagSet.id]
+      const tags = tagSet.tags.map((tag) => resources.tags[tag])
+      return { ...tagSet, tags }
+    } else {
+      return { id: null, tags: [] }
+    }
+  },
+
+  /**
+   * Returns a list of selected plates
+   * @param {Object} state The Vuex state object
+   */
+  selectedPlates: ({ selected, resources }) => {
+    return mergeRepresentations(selected.plates, resources.plates)
+  },
+
+  /**
+   * Returns a list of selected requests
+   *
+   * Note: Ordering depends on selectRequest prefixing ids with underscore, as javascript objects
+   * sort most keys in insertion order, but numeric keys in numeric order.
+   * @param {Object} state The Vuex state object
+   * @return {Array} An array of selected requests in the order in which they were selected
+   */
+  selectedRequests: ({ libraries, resources }) => {
+    return Object.values(libraries).map(({ pacbio_request_id }) => {
+      return { ...resources.requests[pacbio_request_id], selected: true }
+    })
+  },
+
+  /**
+   * Returns a list of all fetched wells
+   * @param {Object} state The Vuex state object
+   */
+  wellList: (state) => (ids) => {
+    const wells = state.resources.wells
+    if (ids) {
+      return ids.map((id) => wells[id])
+    } else {
+      return wells.values
+    }
+  },
+  /**
+   * Returns a list of all fetched requests
+   * @param {Object} state The Vuex state object
+   */
+  requestList: (state) => (ids) => {
+    const requests = state.resources.requests
+    const selectedRequests = state.libraries
+    if (ids) {
+      return ids.map((id) => {
+        return { ...requests[id], selected: !!selectedRequests[`_${id}`] }
+      })
+    } else {
+      return Object.values(requests).map((request) => {
+        return { ...request, selected: !!selectedRequests[`_${request.id}`] }
+      })
+    }
+  },
+  /**
+   * Returns a library
+   * @param {Object} state The Vuex state object
+   */
+  libraryItem: ({ libraries }) => (id) => {
+    return libraries[`_${id}`]
+  },
+
+  /**
+   * Returns the result of the pool creation
+   * @param {Object} state The Vuex state object
+   */
+  result: (state) => {
+    return state.result
+  },
+}
diff --git a/src/store/traction/pacbio/poolCreate/index.js b/src/store/traction/pacbio/poolCreate/index.js
new file mode 100644
index 000000000..c3d5cab9f
--- /dev/null
+++ b/src/store/traction/pacbio/poolCreate/index.js
@@ -0,0 +1,27 @@
+/*
+  Vuex Store configuration
+  Usage:
+    import Vuex from 'vuex'
+    import storeConfig from './store/store'
+    Vue.use(Vuex)
+
+    const store = new Vuex.Store(storeConfig)
+    new Vue({
+      ...,
+      store
+    })
+*/
+import actions from './actions'
+import mutations from './mutations'
+import getters from './getters'
+import state from './state'
+
+const poolCreate = {
+  namespaced: true,
+  state,
+  mutations,
+  actions,
+  getters,
+}
+
+export default poolCreate
diff --git a/src/store/traction/pacbio/poolCreate/libraries.js b/src/store/traction/pacbio/poolCreate/libraries.js
new file mode 100644
index 000000000..30af52b4d
--- /dev/null
+++ b/src/store/traction/pacbio/poolCreate/libraries.js
@@ -0,0 +1,78 @@
+import Vue from 'vue'
+
+const libraryAttributes = {
+  pacbio_request_id: null,
+  template_prep_kit_box_barcode: null,
+  tag_id: null,
+  volume: null,
+  concentration: null,
+  fragment_size: null,
+}
+
+const newLibrary = (attributes) => {
+  return {
+    ...libraryAttributes,
+    ...attributes,
+  }
+}
+
+/**
+ * This method will check each library to ensure that:
+ *  * required fields are present
+ *  * tags are unique
+ **/
+const validate = ({ libraries }) => {
+  for (const [key, library] of Object.entries(libraries)) {
+    const errors = {}
+    Object.keys(libraryAttributes).forEach((field) => {
+      if (!library[field]) {
+        errors[field] = 'must be present'
+      }
+    })
+
+    if (Object.entries(libraries).some(([k, e]) => e.tag_id === library.tag_id && k !== key)) {
+      errors['tag_id'] = 'duplicated'
+    }
+
+    Vue.set(libraries, key, { ...library, errors })
+  }
+}
+
+// a library is valid either if it has no errors or the errors are empty
+const valid = ({ libraries }) => {
+  return Object.values(libraries).every((library) => Object.keys(library.errors || {}).length === 0)
+}
+
+const extractLibraryAttributes = ({
+  pacbio_request_id,
+  template_prep_kit_box_barcode,
+  tag_id,
+  volume,
+  concentration,
+  fragment_size,
+}) => {
+  return {
+    pacbio_request_id,
+    template_prep_kit_box_barcode,
+    tag_id,
+    volume,
+    concentration,
+    fragment_size,
+  }
+}
+
+/* 
+  produce a json api compliant (sort of) payload
+  e.g. { data: attributes: { libraries: [ library1, library2 ... ]}}
+*/
+const payload = ({ libraries }) => {
+  return {
+    data: {
+      attributes: {
+        libraries: Object.values(libraries).map((library) => extractLibraryAttributes(library)),
+      },
+    },
+  }
+}
+
+export { libraryAttributes, newLibrary, validate, valid, payload }
diff --git a/src/store/traction/pacbio/poolCreate/mutations.js b/src/store/traction/pacbio/poolCreate/mutations.js
new file mode 100644
index 000000000..9ca146687
--- /dev/null
+++ b/src/store/traction/pacbio/poolCreate/mutations.js
@@ -0,0 +1,93 @@
+import { dataToObjectById } from '@/api/JsonApi'
+import Vue from 'vue'
+import { newLibrary } from '@/store/traction/pacbio/poolCreate/libraries.js'
+
+const populateById = (resource, { includeRelationships = false } = {}) => (state, data) => {
+  Vue.set(state.resources, resource, dataToObjectById({ data, includeRelationships }))
+}
+
+// Mutations handle synchronous update of state.
+export default {
+  /**
+   * Flags plate with `id` as selected. (Or unselected if selected is false)
+   * @param {Object} state The Vuex state object
+   * @param {String} id The id of the plate
+   * @param {Boolean} selected Whether the plate is selected (defaults to true)
+   */
+  selectPlate: (state, { id, selected = true }) => {
+    if (selected) {
+      Vue.set(state.selected.plates, `_${id}`, { id: id, selected: true })
+    } else {
+      Vue.delete(state.selected.plates, `_${id}`)
+    }
+  },
+  /**
+   * Flags tagSet with `id` as selected.
+   * @param {Object} state The Vuex state object
+   * @param {String} id The id of the plate
+   */
+  selectTagSet: (state, { id }) => {
+    state.selected.tagSet = { id }
+  },
+  /**
+   * Flags request with `id` as selected. (Or unselected if selected is false)
+   * @param {Object} state The Vuex state object
+   * @param {String} id The id of the request
+   * @param {Boolean} selected Set to false to de-select the request. [Optional] true by default
+   */
+  selectRequest: ({ libraries }, { id, selected = true }) => {
+    if (selected) {
+      Vue.set(libraries, `_${id}`, newLibrary({ pacbio_request_id: id }))
+    } else {
+      Vue.delete(libraries, `_${id}`)
+    }
+  },
+
+  /**
+   * Populated with resources via APi calls from the actions
+   * @param {Object} state The VueXState object
+   * @param {Array.{}} plates The plate resources to populate the store
+   */
+  populatePlates: populateById('plates', { includeRelationships: true }),
+  /**
+   * Populated with resources via APi calls from the actions
+   * @param {Object} state The VueXState object
+   * @param {Array.{}} wells The well resources to populate the store
+   */
+  populateWells: populateById('wells', { includeRelationships: true }),
+  /**
+   * Populated with resources via APi calls from the actions
+   * @param {Object} state The VueXState object
+   * @param {Array.{}} requests The request resources to populate the store
+   */
+  populateRequests: populateById('requests'),
+  /**
+   * Populated with resources via APi calls from the actions
+   * @param {Object} state The VueXState object
+   * @param {Array.{}} tagSets The tagSet resources to populate the store
+   */
+  populateTagSets: populateById('tagSets', { includeRelationships: true }),
+  /**
+   * Populated with resources via APi calls from the actions
+   * @param {Object} state The VueXState object
+   * @param {Array.{}} tags The tag resources to populate the store
+   */
+  populateTags: populateById('tags'),
+
+  /**
+   * Populated the result with the response
+   * @param {Object} state The VueXState object
+   * @param {Object} Response A response object
+   **/
+  populateResult: (state, response) => {
+    const { success, errors: message } = response
+    state.result = {
+      success,
+      message: success
+        ? // if the response is successful return an appropriate message
+          'Pool successfully created'
+        : // if the response is a failure return the errors
+          message,
+    }
+  },
+}
diff --git a/src/store/traction/pacbio/poolCreate/state.js b/src/store/traction/pacbio/poolCreate/state.js
new file mode 100644
index 000000000..d21b219ef
--- /dev/null
+++ b/src/store/traction/pacbio/poolCreate/state.js
@@ -0,0 +1,49 @@
+/**
+ * Generates an object describing a new library for population `store.libraries`
+ * @param {Object} attributes any attributes of the object to pre-populate
+ * @example newLibrary({pacbio_request_id: '1'})
+ */
+
+export default () => {
+  return {
+    // Resources returned by the server, each key represents a resource type.
+    // resource types are indexed by their id.
+    resources: {
+      // The main plate store. Represents the authoritative source of plate
+      // information. Plates are indexed by id.
+      plates: {},
+      /**
+       * The main source of well information. Wells are indexed by id.
+       * Populated by the wells included in the request for plates.
+       * @example {"id":"1","type":"wells","position":"A1","requests":["1"]}
+       */
+      wells: {},
+      // The main source of request information. Requests are indexed by id.
+      // Populated by the requests included in the request for plates.
+      requests: {},
+      // The main source of tagSet information. tagSets are indexed by id.
+      tagSets: {},
+      // The main source of tagSet information. tagSets are indexed by id.
+      // Populated by the tags from a tag set
+      tags: {},
+      //
+    },
+    // Selected collects together user input in the front end, such as
+    // selected plates and libraries.
+    selected: {
+      // Object reflecting the id of the selected tag set and a selected
+      // attribute.
+      // eg { id: '1' }
+      tagSet: {},
+      // Object representing all selected plates. Selected plates are indexed by
+      // id. Each plate is represented by an object with an id and a selected
+      // attribute { id: 'plate_id', selected: true }
+      plates: {},
+    },
+    // Libraries. Indexed by an internally generated id.
+    libraries: {},
+
+    // Result: The result of the pool create call i.e. response with message and status
+    result: {},
+  }
+}
diff --git a/src/store/traction/pacbio/pools/actions.js b/src/store/traction/pacbio/pools/actions.js
new file mode 100644
index 000000000..172d9c838
--- /dev/null
+++ b/src/store/traction/pacbio/pools/actions.js
@@ -0,0 +1,33 @@
+import handleResponse from '@/api/ResponseHelper'
+import { groupIncludedByResource } from '@/api/JsonApi'
+
+const setPools = async ({ commit, getters }) => {
+  let request = getters.poolRequest
+  let promise = request.get({
+    include: 'tube,libraries.tag,libraries.request',
+    fields: {
+      requests: 'sample_name',
+      tubes: 'barcode',
+      tags: 'group_id',
+      libraries: 'request,tag',
+    },
+  })
+  let response = await handleResponse(promise)
+
+  const { success, data: { data, included = [] } = {} } = response
+
+  if (success) {
+    const { tubes, libraries, tags, requests } = groupIncludedByResource(included)
+    commit('setPools', data)
+    commit('setTubes', tubes)
+    commit('setLibraries', libraries)
+    commit('setTags', tags)
+    commit('setRequests', requests)
+  }
+}
+
+const actions = { setPools }
+
+export { setPools }
+
+export default actions
diff --git a/src/store/traction/pacbio/pools/getters.js b/src/store/traction/pacbio/pools/getters.js
new file mode 100644
index 000000000..179e87426
--- /dev/null
+++ b/src/store/traction/pacbio/pools/getters.js
@@ -0,0 +1,21 @@
+const getters = {
+  poolRequest: (state, getters, rootState) => rootState.api.traction.pacbio.pools,
+  pools: (state) => {
+    return Object.values(state.pools).map(({ id, type, libraries: libraryIds, tube }) => {
+      const libraries = libraryIds.map((libraryId) => {
+        const { id, type, request, tag } = state.libraries[libraryId]
+        const { sample_name } = state.requests[request]
+        const { group_id } = state.tags[tag]
+        return { id, type, sample_name, group_id }
+      })
+      const { barcode } = state.tubes[tube]
+
+      return { id, type, libraries, barcode }
+    })
+  },
+  poolByBarcode: (state, { pools }) => (barcode) => {
+    return pools.find((pool) => pool.barcode === barcode)
+  },
+}
+
+export default getters
diff --git a/src/store/traction/pacbio/pools/index.js b/src/store/traction/pacbio/pools/index.js
new file mode 100644
index 000000000..e917aea0c
--- /dev/null
+++ b/src/store/traction/pacbio/pools/index.js
@@ -0,0 +1,14 @@
+import state from './state'
+import getters from './getters'
+import mutations from './mutations'
+import actions from './actions'
+
+const pools = {
+  namespaced: true,
+  state,
+  getters,
+  mutations,
+  actions,
+}
+
+export default pools
diff --git a/src/store/traction/pacbio/pools/mutations.js b/src/store/traction/pacbio/pools/mutations.js
new file mode 100644
index 000000000..e88e6ac4d
--- /dev/null
+++ b/src/store/traction/pacbio/pools/mutations.js
@@ -0,0 +1,21 @@
+import { dataToObjectById } from '@/api/JsonApi'
+
+const mutations = {
+  setPools(state, pools) {
+    state.pools = dataToObjectById({ data: pools, includeRelationships: true })
+  },
+  setTubes(state, tubes) {
+    state.tubes = dataToObjectById({ data: tubes, includeRelationships: false })
+  },
+  setLibraries(state, libraries) {
+    state.libraries = dataToObjectById({ data: libraries, includeRelationships: true })
+  },
+  setTags(state, tags) {
+    state.tags = dataToObjectById({ data: tags, includeRelationships: false })
+  },
+  setRequests(state, requests) {
+    state.requests = dataToObjectById({ data: requests, includeRelationships: false })
+  },
+}
+
+export default mutations
diff --git a/src/store/traction/pacbio/pools/state.js b/src/store/traction/pacbio/pools/state.js
new file mode 100644
index 000000000..e11332eaf
--- /dev/null
+++ b/src/store/traction/pacbio/pools/state.js
@@ -0,0 +1,9 @@
+const state = {
+  pools: {},
+  tubes: {},
+  libraries: {},
+  requests: {},
+  tags: {},
+}
+
+export default state
diff --git a/src/store/traction/pacbio/requests/actions.js b/src/store/traction/pacbio/requests/actions.js
index 587cd8b0b..3c2412563 100644
--- a/src/store/traction/pacbio/requests/actions.js
+++ b/src/store/traction/pacbio/requests/actions.js
@@ -13,7 +13,7 @@ const setRequests = async ({ commit, getters }) => {
 
 const updateRequest = async ({ getters }, payload) => {
   let request = getters.requestsRequest
-  let sample = getters.requests.filter((r) => r.id == payload.id)[0]
+  let sample = getters.requests.find((r) => r.id == payload.id)
 
   let requestPayload = createRequestPayload(sample)
   let promises = request.update(requestPayload)
diff --git a/src/store/traction/pacbio/runs/actions.js b/src/store/traction/pacbio/runs/actions.js
index 27e484ea0..0906b0cf4 100644
--- a/src/store/traction/pacbio/runs/actions.js
+++ b/src/store/traction/pacbio/runs/actions.js
@@ -25,7 +25,11 @@ const editRun = async ({ commit, getters }, runId) => {
   let response = await handlePromise(promise)
 
   if (response.successful) {
-    let run = response.deserialize.runs[0]
+    const run = response.deserialize.runs[0]
+    run.plate.wells.forEach((well) => {
+      // Needed for well edit pool barcodes
+      well.pools.forEach((pool) => (pool.barcode = pool.tube.barcode))
+    })
     commit('setCurrentRun', run)
   }
 }
diff --git a/src/store/traction/pacbio/runs/mutations.js b/src/store/traction/pacbio/runs/mutations.js
index 029c6dc68..02893ea0e 100644
--- a/src/store/traction/pacbio/runs/mutations.js
+++ b/src/store/traction/pacbio/runs/mutations.js
@@ -14,7 +14,7 @@ const mutateRun = (key) => (state, val) => {
 }
 
 const getCurrentWell = (state, position) => {
-  let currentWell = state.currentRun.plate.wells.filter((well) => well.position === position)[0]
+  let currentWell = state.currentRun.plate.wells.find((well) => well.position === position)
 
   // If well does not exist - Build a new well
   if (!currentWell) {
@@ -55,6 +55,7 @@ const mutations = {
     let currentWell = getCurrentWell(state, payload.position)
     currentWell[payload.property] = payload.with
   },
+  // TODO Remove these library methods
   addEmptyLibraryToWell(state, position) {
     let currentWell = getCurrentWell(state, position)
     currentWell.libraries.push({ id: '', barcode: '' })
@@ -73,6 +74,22 @@ const mutations = {
       currentWell.libraries.push(payload.with)
     }
   },
+  addEmptyPoolToWell(state, position) {
+    let currentWell = getCurrentWell(state, position)
+    currentWell.pools.push({ id: '', barcode: '' })
+  },
+  removePoolFromWell(state, { index, position }) {
+    let currentWell = getCurrentWell(state, position)
+    currentWell.pools.splice(index, 1)
+  },
+  addPoolToWell(state, { index, position, with: pool }) {
+    let currentWell = getCurrentWell(state, position)
+    if (index !== undefined) {
+      currentWell.pools.splice(index, 1, pool)
+    } else {
+      currentWell.pools.push(pool)
+    }
+  },
 }
 
 export default mutations
diff --git a/src/store/traction/pacbio/tubes/actions.js b/src/store/traction/pacbio/tubes/actions.js
index ddeade418..df03fa2ff 100644
--- a/src/store/traction/pacbio/tubes/actions.js
+++ b/src/store/traction/pacbio/tubes/actions.js
@@ -34,6 +34,7 @@ const validateLibraryTube = (tube) => {
 
 const actions = {
   isLibraryBarcodeValid,
+  isPoolBarcodeValid: isLibraryBarcodeValid,
   getTubeForBarcode,
 }
 
diff --git a/src/styles/components.scss b/src/styles/components.scss
new file mode 100644
index 000000000..5f516f795
--- /dev/null
+++ b/src/styles/components.scss
@@ -0,0 +1,5 @@
+h3 {
+  text-align: left;
+  border-bottom: 1px solid;
+  padding: 5px;
+}
diff --git a/src/views/PipelineView.vue b/src/views/PipelineView.vue
index b2069b049..3a7401d4b 100644
--- a/src/views/PipelineView.vue
+++ b/src/views/PipelineView.vue
@@ -1,6 +1,5 @@
 <template>
   <div>
-    <p>{{ pipelineInfo.title }}</p>
     <b-card no-body>
       <b-card-header header-tag="nav">
         <b-nav tabs fill card-header>
diff --git a/src/views/pacbio/PacbioLibraryIndex.vue b/src/views/pacbio/PacbioLibraryIndex.vue
index 235a4131c..b0958e0f7 100644
--- a/src/views/pacbio/PacbioLibraryIndex.vue
+++ b/src/views/pacbio/PacbioLibraryIndex.vue
@@ -51,40 +51,6 @@
       <template v-slot:cell(actions)="row">
         <PacbioLibraryEdit :lib="row.item" @alert="showAlert"> </PacbioLibraryEdit>
       </template>
-
-      <template v-slot:cell(show_details)="row">
-        <b-button
-          :id="'details-btn-' + row.item.id"
-          size="sm"
-          class="mr-2"
-          variant="outline-info"
-          @click="row.toggleDetails"
-        >
-          {{ row.detailsShowing ? 'Hide' : 'Show' }} Details
-        </b-button>
-      </template>
-
-      <template v-slot:row-details="row">
-        <b-card>
-          <b-table
-            small
-            bordered
-            show-empty
-            :items="row.item.requests"
-            :fields="field_in_details"
-            :filter="filter"
-          >
-            <template v-slot:cell(edit_tag)="row">
-              <PacbioLibraryTagEdit
-                :request_library="row.item"
-                @alert="showAlert"
-                @reloadPage="provider"
-              >
-              </PacbioLibraryTagEdit>
-            </template>
-          </b-table>
-        </b-card>
-      </template>
     </b-table>
 
     <span class="font-weight-bold">Total records: {{ libraries.length }}</span>
@@ -126,7 +92,6 @@
 <script>
 import Helper from '@/mixins/Helper'
 import PacbioLibraryEdit from '@/components/pacbio/PacbioLibraryEdit'
-import PacbioLibraryTagEdit from '@/components/pacbio/PacbioLibraryTagEdit'
 import TableHelper from '@/mixins/TableHelper'
 import Alert from '@/components/Alert'
 import PrinterModal from '@/components/PrinterModal'
@@ -140,13 +105,13 @@ export default {
     Alert,
     PrinterModal,
     PacbioLibraryEdit,
-    PacbioLibraryTagEdit,
   },
   mixins: [Helper, TableHelper],
   data() {
     return {
       fields: [
         { key: 'selected', label: '' },
+        { key: 'pool.id', label: 'pool ID', sortable: true, tdClass: 'pool-id' },
         { key: 'id', label: 'Library ID', sortable: true, tdClass: 'library-id' },
         { key: 'sample_name', label: 'Sample Name', sortable: true, tdClass: 'sample-name' },
         { key: 'barcode', label: 'Barcode', sortable: true, tdClass: 'barcode' },
@@ -160,15 +125,11 @@ export default {
           tdClass: 'template-prep-kit-box-barcode',
         },
         { key: 'fragment_size', label: 'Fragment Size', sortable: true, tdClass: 'fragment-size' },
+        { key: 'tag_group_id', label: 'Tag', sortable: true, tdClass: 'tag-group-id' },
         { key: 'created_at', label: 'Created at', sortable: true, tdClass: 'created-at' },
         { key: 'actions', label: 'Actions' },
-        { key: 'show_details', label: '' },
-      ],
-      field_in_details: [
-        { key: 'sample_name', label: 'Sample(s)' },
-        { key: 'tag_group_id', label: 'Tag(s)' },
-        { key: 'edit_tag', label: 'Actions' },
       ],
+      primary_key: 'id',
       filteredItems: [],
       selected: [],
       filter: null,
diff --git a/src/views/pacbio/PacbioPoolCreate.vue b/src/views/pacbio/PacbioPoolCreate.vue
new file mode 100644
index 000000000..ee932cfb0
--- /dev/null
+++ b/src/views/pacbio/PacbioPoolCreate.vue
@@ -0,0 +1,69 @@
+<template>
+  <div>
+    <b-container id="pool" fluid>
+      <b-row>
+        <PacbioLabwareFind ref="labwareFind" />
+        <b-col>
+          <b-row>
+            <PacbioTagSetList ref="tagSetList"></PacbioTagSetList>
+          </b-row>
+          <b-row>
+            <PacbioTagSetItem></PacbioTagSetItem>
+          </b-row>
+        </b-col>
+      </b-row>
+      <b-row>
+        <PacbioLabwareSelectedList />
+        <PacbioPoolLibraryList />
+      </b-row>
+    </b-container>
+  </div>
+</template>
+
+<script>
+import PacbioTagSetList from '@/components/pacbio/PacbioTagSetList'
+import PacbioLabwareFind from '@/components/pacbio/PacbioLabwareFind'
+import PacbioLabwareSelectedList from '@/components/pacbio/PacbioLabwareSelectedList'
+import PacbioTagSetItem from '@/components/pacbio/PacbioTagSetItem'
+import PacbioPoolLibraryList from '@/components/pacbio/PacbioPoolLibraryList'
+
+import { createNamespacedHelpers } from 'vuex'
+const { mapActions } = createNamespacedHelpers('traction/pacbio/poolCreate')
+
+export default {
+  name: 'PacbioPoolCreate',
+  components: {
+    PacbioTagSetList,
+    PacbioLabwareFind,
+    PacbioLabwareSelectedList,
+    PacbioTagSetItem,
+    PacbioPoolLibraryList,
+  },
+  data() {
+    return {}
+  },
+  created() {
+    const plates = this.fetchPacbioPlates()
+    const tagSets = this.fetchPacbioTagSets()
+    // We don't use await here as otherwise the handling of one response will be blocked
+    // by the other
+    plates.then(this.plateAlert)
+    tagSets.then(this.tagSetAlert)
+  },
+  methods: {
+    plateAlert({ success, errors }) {
+      if (!success) {
+        this.$refs['labwareFind'].showAlert(errors, 'danger')
+      }
+    },
+    tagSetAlert({ success, errors }) {
+      if (!success) {
+        this.$refs['tagSetList'].showAlert(errors, 'danger')
+      }
+    },
+    ...mapActions(['fetchPacbioPlates', 'fetchPacbioTagSets']),
+  },
+}
+</script>
+
+<style scoped></style>
diff --git a/src/views/pacbio/PacbioRunIndex.vue b/src/views/pacbio/PacbioRunIndex.vue
index 78ae0d301..bbc05ad51 100644
--- a/src/views/pacbio/PacbioRunIndex.vue
+++ b/src/views/pacbio/PacbioRunIndex.vue
@@ -80,7 +80,7 @@
         </b-button>
 
         <a
-          v-show="row.item.all_wells_have_libraries"
+          v-show="row.item.all_wells_have_pools"
           :id="generateId('generate-sample-sheet', row.item.id)"
           :href="generateSampleSheetPath(row.item.id)"
           class="text-primary"
diff --git a/src/views/pacbio/PacbioRunShow.vue b/src/views/pacbio/PacbioRunShow.vue
index 1a7ea2c4f..c6e4db8a7 100644
--- a/src/views/pacbio/PacbioRunShow.vue
+++ b/src/views/pacbio/PacbioRunShow.vue
@@ -25,7 +25,7 @@
       <br />
       <b-row>
         <b-col cols="6">
-          <pacbioLibraryList ref="pacbioLibraryList"></pacbioLibraryList>
+          <pacbioPoolList ref="pacbioPoolList"></pacbioPoolList>
         </b-col>
         <b-col>
           <Plate v-if="currentRun.id" ref="plate" @alert="showAlert"></Plate>
@@ -37,7 +37,7 @@
 
 <script>
 import PacbioRunInfoEdit from '@/components/pacbio/PacbioRunInfoEdit'
-import PacbioLibraryList from '@/components/pacbio/PacbioLibraryList'
+import pacbioPoolList from '@/components/pacbio/PacbioPoolList'
 import Plate from '@/components/pacbio/PacbioRunPlateItem'
 import Alert from '@/components/Alert'
 import Helper from '@/mixins/Helper'
@@ -50,7 +50,7 @@ export default {
   components: {
     Alert,
     PacbioRunInfoEdit,
-    PacbioLibraryList,
+    pacbioPoolList,
     Plate,
   },
   mixins: [Helper],
diff --git a/tests/data/StoreLibraries.json b/tests/data/StoreLibraries.json
deleted file mode 100644
index 68b0c4e66..000000000
--- a/tests/data/StoreLibraries.json
+++ /dev/null
@@ -1,72 +0,0 @@
-[
-  {
-    "id": "1",
-    "type": "libraries",
-    "state": "pending",
-    "barcode": "TRAC-16",
-    "volume": 1.0,
-    "concentration": 1.1,
-    "template_prep_kit_box_barcode": "LK12345",
-    "fragment_size": 100,
-    "created_at": "09/23/2019 11:18",
-    "deactivated_at": null,
-    "sample_name": "4616STDY7535900",
-    "tag_group_id": "1"
-  },
-  {
-    "id": "2",
-    "type": "libraries",
-    "state": "pending",
-    "barcode": "TRAC-17",
-    "volume": 1.0,
-    "concentration": 1.0,
-    "template_prep_kit_box_barcode": "LK12345",
-    "fragment_size": 100,
-    "created_at": "09/23/2019 11:18",
-    "deactivated_at": null,
-    "sample_name": "4616STDY7535900",
-    "tag_group_id": "1"
-  },
-  {
-    "id": "3",
-    "type": "libraries",
-    "state": "pending",
-    "barcode": "TRAC-18",
-    "volume": 1.0,
-    "concentration": 1.0,
-    "template_prep_kit_box_barcode": "LK12345",
-    "fragment_size": 100,
-    "created_at": "09/23/2019 11:18",
-    "deactivated_at": null,
-    "sample_name": "4642STDY7515249",
-    "tag_group_id": "1"
-  },
-  {
-    "id": "4",
-    "type": "libraries",
-    "state": "pending",
-    "barcode": "TRAC-19",
-    "volume": 1.0,
-    "concentration": 1.0,
-    "template_prep_kit_box_barcode": "LK12345",
-    "fragment_size": 100,
-    "created_at": "09/23/2019 11:18",
-    "deactivated_at": null,
-    "sample_name": "4616STDY7644356",
-    "tag_group_id": "1"
-  },
-  {
-    "id": "5",
-    "type": "libraries",
-    "state": "pending",
-    "barcode": "TRAC-20",
-    "volume": 1.0,
-    "concentration": 1.0,
-    "template_prep_kit_box_barcode": "LK12345",
-    "fragment_size": 100,
-    "created_at": "09/23/2019 11:18",
-    "deactivated_at": null,
-    "sample_name": "25G257228308",
-    "tag_group_id": "1"
-  }
-]
diff --git a/tests/data/StorePools.json b/tests/data/StorePools.json
new file mode 100644
index 000000000..3094e7079
--- /dev/null
+++ b/tests/data/StorePools.json
@@ -0,0 +1,22 @@
+{
+  "pools": {
+    "1": { "id": "1", "libraries": ["1"], "tube": "1", "type": "pools" },
+    "2": { "id": "2", "libraries": ["2"], "tube": "2", "type": "pools" }
+  },
+  "tubes": {
+    "1": { "barcode": "TRAC-2-1", "id": "1", "type": "tubes" },
+    "2": { "barcode": "TRAC-2-2", "id": "2", "type": "tubes" }
+  },
+  "libraries": {
+    "1": { "id": "1", "request": "1", "tag": "26", "type": "libraries" },
+    "2": { "id": "2", "request": "2", "tag": "7", "type": "libraries" }
+  },
+  "tags": {
+    "26": { "group_id": "bc1019", "id": "26", "type": "tags" },
+    "7": { "group_id": "bc1011_BAK8A_OA", "id": "7", "type": "tags" }
+  },
+  "requests": {
+    "1": { "id": "1", "sample_name": "Sample48", "type": "requests" },
+    "2": { "id": "2", "sample_name": "Sample47", "type": "requests" }
+  }
+}
diff --git a/tests/data/index.js b/tests/data/index.js
index 4cdf92a17..931fb0274 100644
--- a/tests/data/index.js
+++ b/tests/data/index.js
@@ -21,11 +21,15 @@ import CreatePacbioRequest from './createPacbioRequest'
 import TractionPacbioLibrary from './tractionPacbioLibrary'
 import TractionPacbioLibraries from './tractionPacbioLibraries'
 import TractionPacbioLibrariesNoRelationships from './tractionPacbioLibrariesNoRelationships'
+import TractionPacbioPools from './tractionPacbioPools'
+import TractionPacbioPoolsNoRelationships from './tractionPacbioPoolsNoRelationships'
 import TractionPacbioSamples from './tractionPacbioSamples'
 import SampleExtractionTubesWithSample from './sampleExtractionTubesWithSample'
 import PacbioRuns from './pacbioRuns'
 import PacbioRun from './pacbioRun'
 import PacbioPlates from './pacbioPlates'
+import PacbioPlatesRequest from './pacbioPlatesRequest'
+import PacbioTagSets from './pacbioTagSets'
 import PacbioSequencingPlate from './pacbioSequencingPlate'
 import PacbioWell from './pacbioWell'
 import PacbioWells from './pacbioWells'
@@ -59,11 +63,15 @@ export default {
   CreatePacbioRequest,
   TractionPacbioLibraries,
   TractionPacbioLibrariesNoRelationships,
+  TractionPacbioPools,
+  TractionPacbioPoolsNoRelationships,
   TractionPacbioLibrary,
   TractionPacbioSamples,
   PacbioRuns,
   PacbioRun,
   PacbioPlates,
+  PacbioPlatesRequest,
+  PacbioTagSets,
   PacbioSequencingPlate,
   PacbioWell,
   PacbioWells,
diff --git a/tests/data/pacbioPlatesRequest.json b/tests/data/pacbioPlatesRequest.json
new file mode 100644
index 000000000..ab96ce9ad
--- /dev/null
+++ b/tests/data/pacbioPlatesRequest.json
@@ -0,0 +1,212 @@
+{
+  "data": {
+    "data": [
+      {
+        "id": "61",
+        "type": "plates",
+        "links": {
+          "self": "/v1/pacbio/plates/61"
+        },
+        "attributes": {
+          "barcode": "DN814327C",
+          "created_at": "2021/06/03 06:59"
+        },
+        "relationships": {
+          "wells": {
+            "links": {
+              "self": "/v1/pacbio/plates/61/relationships/wells",
+              "related": "/v1/pacbio/plates/61/wells"
+            },
+            "data": [
+              {
+                "type": "wells",
+                "id": "4722"
+              },
+              {
+                "type": "wells",
+                "id": "4723"
+              }
+            ]
+          }
+        }
+      },
+      {
+        "id": "62",
+        "type": "plates",
+        "links": {
+          "self": "/v1/pacbio/plates/62"
+        },
+        "attributes": {
+          "barcode": "DN814567Q",
+          "created_at": "2021/06/03 14:57"
+        },
+        "relationships": {
+          "wells": {
+            "links": {
+              "self": "/v1/pacbio/plates/62/relationships/wells",
+              "related": "/v1/pacbio/plates/62/wells"
+            },
+            "data": [
+              {
+                "type": "wells",
+                "id": "4818"
+              },
+              {
+                "type": "wells",
+                "id": "4819"
+              }
+            ]
+          }
+        }
+      }
+    ],
+    "included": [
+      {
+        "id": "4722",
+        "type": "wells",
+        "attributes": {
+          "position": "A1"
+        },
+        "relationships": {
+          "requests": {
+            "data": [
+              {
+                "type": "requests",
+                "id": "40"
+              }
+            ]
+          }
+        }
+      },
+      {
+        "id": "4723",
+        "type": "wells",
+        "attributes": {
+          "position": "A2"
+        },
+        "relationships": {
+          "requests": {
+            "data": [
+              {
+                "type": "requests",
+                "id": "41"
+              }
+            ]
+          }
+        }
+      },
+      {
+        "id": "4818",
+        "type": "wells",
+        "attributes": {
+          "position": "A1"
+        },
+        "relationships": {
+          "requests": {
+            "data": [
+              {
+                "type": "requests",
+                "id": "136"
+              }
+            ]
+          }
+        }
+      },
+      {
+        "id": "4819",
+        "type": "wells",
+        "attributes": {
+          "position": "B1"
+        },
+        "relationships": {
+          "requests": {
+            "data": [
+              {
+                "type": "requests",
+                "id": "137"
+              }
+            ]
+          }
+        }
+      },
+      {
+        "id": "40",
+        "type": "requests",
+        "links": {
+          "self": "/v1/pacbio/requests/40"
+        },
+        "attributes": {
+          "library_type": null,
+          "estimate_of_gb_required": null,
+          "number_of_smrt_cells": null,
+          "cost_code": null,
+          "external_study_id": "fec8a1fa-b9e2-11e9-9123-fa163e99b035",
+          "sample_name": "sample_DN814327C_A1",
+          "barcode": null,
+          "sample_species": "human",
+          "created_at": "2021/06/03 06:59",
+          "source_identifier": "DN814327C:A1"
+        }
+      },
+      {
+        "id": "41",
+        "type": "requests",
+        "links": {
+          "self": "/v1/pacbio/requests/41"
+        },
+        "attributes": {
+          "library_type": null,
+          "estimate_of_gb_required": null,
+          "number_of_smrt_cells": null,
+          "cost_code": null,
+          "external_study_id": "fec8a1fa-b9e2-11e9-9123-fa163e99b035",
+          "sample_name": "sample_DN814327C_A2",
+          "barcode": null,
+          "sample_species": "human",
+          "created_at": "2021/06/03 06:59",
+          "source_identifier": "DN814327C:A2"
+        }
+      },
+      {
+        "id": "136",
+        "type": "requests",
+        "links": {
+          "self": "/v1/pacbio/requests/136"
+        },
+        "attributes": {
+          "library_type": null,
+          "estimate_of_gb_required": null,
+          "number_of_smrt_cells": null,
+          "cost_code": null,
+          "external_study_id": "d160363e-ba2e-11e7-b4cc-68b599768938",
+          "sample_name": "5049STDY8152829",
+          "barcode": null,
+          "sample_species": "human",
+          "created_at": "2021/06/03 14:57",
+          "source_identifier": "DN814567Q:A1"
+        }
+      },
+      {
+        "id": "137",
+        "type": "requests",
+        "links": {
+          "self": "/v1/pacbio/requests/137"
+        },
+        "attributes": {
+          "library_type": null,
+          "estimate_of_gb_required": null,
+          "number_of_smrt_cells": null,
+          "cost_code": null,
+          "external_study_id": "d160363e-ba2e-11e7-b4cc-68b599768938",
+          "sample_name": "5049STDY8152830",
+          "barcode": null,
+          "sample_species": "cat",
+          "created_at": "2021/06/03 14:57",
+          "source_identifier": "DN814567Q:B1"
+        }
+      }
+    ]
+  },
+  "status": 200,
+  "statusText": "Success"
+}
diff --git a/tests/data/pacbioRun.json b/tests/data/pacbioRun.json
index 9aec52f07..75613e2a7 100644
--- a/tests/data/pacbioRun.json
+++ b/tests/data/pacbioRun.json
@@ -13,8 +13,63 @@
         "dna_control_complex_box_barcode": "Lxxxxx10171760012319",
         "system_name": "Sequel II",
         "created_at": "10/17/2019 12:56"
+      },
+      "relationships": {
+        "plate": {
+          "links": {
+            "self": "http://localhost:3100/v1/pacbio/runs/plates/1",
+            "related": "http://localhost:3100/v1/pacbio/runs/plates/1"
+          },
+          "data": {
+            "type": "plates",
+            "id": "1"
+          }
+        }
+      }
+    },
+    "included": [
+      {
+        "id": "1",
+        "type": "plates",
+        "attributes": {
+          "pacbio_run_id": "1"
+        },
+        "relationships": {
+          "wells": {
+            "links": {
+              "self": "http://localhost:3100/v1/pacbio/runs/wells/4",
+              "related": "http://localhost:3100/v1/pacbio/runs/wells/4"
+            },
+            "data": [
+              {
+                "id": "4",
+                "type": "wells",
+                "movie_time": "10.0",
+                "insert_size": 1001,
+                "on_plate_loading_concentration": 10.1,
+                "row": "A",
+                "column": "1",
+                "pacbio_plate_id": 5,
+                "comment": null,
+                "generate_hifi": "In SMRT Link",
+                "ccs_analysis_output": "",
+                "pre_extension_time": "2",
+                "pools": [
+                  {
+                    "id": "1",
+                    "tube": {
+                      "barcode": "1234",
+                      "type": "tube"
+                    },
+                    "type": "pools"
+                  }
+                ]
+              }
+            ]
+          }
+        }
       }
-    }
+    ]
   },
   "status": 200,
   "statusText": "Success"
diff --git a/tests/data/pacbioRuns.json b/tests/data/pacbioRuns.json
index 574c8a40c..7fc1151c1 100644
--- a/tests/data/pacbioRuns.json
+++ b/tests/data/pacbioRuns.json
@@ -15,7 +15,7 @@
           "dna_control_complex_box_barcode": "Lxxxxx10171760012311",
           "system_name": "Sequel I",
           "created_at": "11/09/2019 01:11",
-          "all_wells_have_libraries": true
+          "all_wells_have_pools": true
         }
       },
       {
@@ -32,7 +32,7 @@
           "dna_control_complex_box_barcode": "Lxxxxx10171760012312",
           "system_name": "Sequel II",
           "created_at": "12/09/2019 02:22",
-          "all_wells_have_libraries": true
+          "all_wells_have_pools": true
         }
       },
       {
@@ -65,7 +65,7 @@
           "dna_control_complex_box_barcode": "Lxxxxx10171760012312",
           "system_name": "Sequel II",
           "created_at": "10/09/2019 02:22",
-          "all_wells_have_libraries": true
+          "all_wells_have_pools": true
         }
       },
       {
@@ -82,7 +82,7 @@
           "dna_control_complex_box_barcode": "Lxxxxx10171760012312",
           "system_name": "Sequel II",
           "created_at": "10/09/2019 02:22",
-          "all_wells_have_libraries": true
+          "all_wells_have_pools": true
         }
       },
       {
@@ -99,7 +99,7 @@
           "dna_control_complex_box_barcode": "Lxxxxx10171760012312",
           "system_name": "Sequel II",
           "created_at": "10/09/2019 02:22",
-          "all_wells_have_libraries": false
+          "all_wells_have_pools": false
         }
       }
     ],
diff --git a/tests/data/pacbioTagSets.json b/tests/data/pacbioTagSets.json
new file mode 100644
index 000000000..319aac415
--- /dev/null
+++ b/tests/data/pacbioTagSets.json
@@ -0,0 +1,134 @@
+{
+  "data": {
+    "data": [
+      {
+        "id": "1",
+        "type": "tag_sets",
+        "links": {
+          "self": "/v1/pacbio/tag_sets/1"
+        },
+        "attributes": {
+          "name": "Sequel_16_barcodes_v3",
+          "uuid": "4d87a8ab-4d16-f0b0-77e5-0f467dba442e",
+          "pipeline": "pacbio"
+        },
+        "relationships": {
+          "tags": {
+            "links": {
+              "self": "/v1/pacbio/tag_sets/1/relationships/tags",
+              "related": "/v1/pacbio/tag_sets/1/tags"
+            },
+            "data": [
+              {
+                "type": "tags",
+                "id": "3"
+              },
+              {
+                "type": "tags",
+                "id": "4"
+              }
+            ]
+          }
+        }
+      },
+      {
+        "id": "6",
+        "type": "tag_sets",
+        "links": {
+          "self": "/v1/pacbio/tag_sets/6"
+        },
+        "attributes": {
+          "name": "IsoSeq_v1",
+          "uuid": "1e8244b6-dabe-4e88-8b6f-f74ae02f397e",
+          "pipeline": "pacbio"
+        },
+        "relationships": {
+          "tags": {
+            "links": {
+              "self": "/v1/pacbio/tag_sets/6/relationships/tags",
+              "related": "/v1/pacbio/tag_sets/6/tags"
+            },
+            "data": [
+              {
+                "type": "tags",
+                "id": "323"
+              },
+              {
+                "type": "tags",
+                "id": "324"
+              }
+            ]
+          }
+        }
+      }
+    ],
+    "included": [
+      {
+        "id": "3",
+        "type": "tags",
+        "attributes": {
+          "oligo": "CACATATCAGAGTGCGT",
+          "group_id": "bc1001_BAK8A_OA"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "1"
+            }
+          }
+        }
+      },
+      {
+        "id": "4",
+        "type": "tags",
+        "attributes": {
+          "oligo": "ACACACAGACTGTGAGT",
+          "group_id": "bc1002_BAK8A_OA"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "1"
+            }
+          }
+        }
+      },
+      {
+        "id": "323",
+        "type": "tags",
+        "attributes": {
+          "oligo": "CACATATCAGAGTGCGGCAATGAAGTCGCAGGGTTG",
+          "group_id": "bc1001-F"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "6"
+            }
+          }
+        }
+      },
+      {
+        "id": "324",
+        "type": "tags",
+        "attributes": {
+          "oligo": "CACATATCAGAGTGCGAAGCAGTGGTATCAACGCAGAGT",
+          "group_id": "bc1001-R"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "6"
+            }
+          }
+        }
+      }
+    ]
+  },
+  "status": 200,
+  "statusText": "Success"
+}
diff --git a/tests/data/pacbioWells.json b/tests/data/pacbioWells.json
index dd434673d..fc91bc26c 100644
--- a/tests/data/pacbioWells.json
+++ b/tests/data/pacbioWells.json
@@ -16,16 +16,15 @@
           "pacbio_plate_id": 1,
           "comment": "comment1",
           "generate_hifi": "In SMRT Link",
-          "ccs_analysis_output": "",
           "pre_extension_time": "2",
           "position": "A1",
           "ccs_analysis_output": "No"
         },
         "relationships": {
-          "libraries": {
+          "pools": {
             "links": {
-              "self": "http://localhost:3100/v1/pacbio/wells/1/relationships/libraries",
-              "related": "http://localhost:3100/v1/pacbio/wells/1/libraries"
+              "self": "http://localhost:3100/v1/pacbio/wells/1/relationships/pools",
+              "related": "http://localhost:3100/v1/pacbio/wells/1/pools"
             }
           }
         }
@@ -45,16 +44,15 @@
           "pacbio_plate_id": 5,
           "comment": null,
           "generate_hifi": "In SMRT Link",
-          "ccs_analysis_output": "",
           "pre_extension_time": "2",
           "position": "A1",
           "ccs_analysis_output": "No"
         },
         "relationships": {
-          "libraries": {
+          "pools": {
             "links": {
-              "self": "http://localhost:3100/v1/pacbio/wells/4/relationships/libraries",
-              "related": "http://localhost:3100/v1/pacbio/wells/4/libraries"
+              "self": "http://localhost:3100/v1/pacbio/wells/4/relationships/pools",
+              "related": "http://localhost:3100/v1/pacbio/wells/4/pools"
             }
           }
         }
diff --git a/tests/data/tractionPacbioLibraries.json b/tests/data/tractionPacbioLibraries.json
index da38ee9d8..15c92c0b6 100644
--- a/tests/data/tractionPacbioLibraries.json
+++ b/tests/data/tractionPacbioLibraries.json
@@ -47,6 +47,16 @@
               "type": "tags",
               "id": "5"
             }
+          },
+          "pool": {
+            "links": {
+              "self": "http://localhost:3100/v1/pacbio/libraries/721/relationships/pool",
+              "related": "http://localhost:3100/v1/pacbio/libraries/721/pool"
+            },
+            "data": {
+              "type": "pools",
+              "id": "1"
+            }
           }
         }
       },
@@ -96,6 +106,16 @@
               "type": "tags",
               "id": "4"
             }
+          },
+          "pool": {
+            "links": {
+              "self": "http://localhost:3100/v1/pacbio/libraries/721/relationships/pool",
+              "related": "http://localhost:3100/v1/pacbio/libraries/721/pool"
+            },
+            "data": {
+              "type": "pools",
+              "id": "2"
+            }
           }
         }
       },
@@ -145,6 +165,16 @@
               "type": "tags",
               "id": "3"
             }
+          },
+          "pool": {
+            "links": {
+              "self": "http://localhost:3100/v1/pacbio/libraries/721/relationships/pool",
+              "related": "http://localhost:3100/v1/pacbio/libraries/721/pool"
+            },
+            "data": {
+              "type": "pools",
+              "id": "3"
+            }
           }
         }
       },
@@ -194,6 +224,16 @@
               "type": "tags",
               "id": "11"
             }
+          },
+          "pool": {
+            "links": {
+              "self": "http://localhost:3100/v1/pacbio/libraries/721/relationships/pool",
+              "related": "http://localhost:3100/v1/pacbio/libraries/721/pool"
+            },
+            "data": {
+              "type": "pools",
+              "id": "4"
+            }
           }
         }
       },
@@ -243,6 +283,16 @@
               "type": "tags",
               "id": "2"
             }
+          },
+          "pool": {
+            "links": {
+              "self": "http://localhost:3100/v1/pacbio/libraries/721/relationships/pool",
+              "related": "http://localhost:3100/v1/pacbio/libraries/721/pool"
+            },
+            "data": {
+              "type": "pools",
+              "id": "6"
+            }
           }
         }
       }
diff --git a/tests/data/tractionPacbioPools.json b/tests/data/tractionPacbioPools.json
new file mode 100644
index 000000000..bd651a5a8
--- /dev/null
+++ b/tests/data/tractionPacbioPools.json
@@ -0,0 +1,184 @@
+{
+  "data": {
+    "data": [
+      {
+        "id": "1",
+        "type": "pools",
+        "links": {
+          "self": "http://localhost:3100/v1/pacbio/pools/1"
+        },
+        "relationships": {
+          "tube": {
+            "links": {
+              "self": "http://localhost:3100/v1/pacbio/pools/1/relationships/tube",
+              "related": "http://localhost:3100/v1/pacbio/pools/1/tube"
+            },
+            "data": {
+              "type": "tubes",
+              "id": "1"
+            }
+          },
+          "libraries": {
+            "links": {
+              "self": "http://localhost:3100/v1/pacbio/pools/1/relationships/libraries",
+              "related": "http://localhost:3100/v1/pacbio/pools/1/libraries"
+            },
+            "data": [
+              {
+                "type": "libraries",
+                "id": "1"
+              }
+            ]
+          }
+        }
+      },
+      {
+        "id": "2",
+        "type": "pools",
+        "links": {
+          "self": "http://localhost:3100/v1/pacbio/pools/2"
+        },
+        "relationships": {
+          "tube": {
+            "links": {
+              "self": "http://localhost:3100/v1/pacbio/pools/2/relationships/tube",
+              "related": "http://localhost:3100/v1/pacbio/pools/2/tube"
+            },
+            "data": {
+              "type": "tubes",
+              "id": "2"
+            }
+          },
+          "libraries": {
+            "links": {
+              "self": "http://localhost:3100/v1/pacbio/pools/2/relationships/libraries",
+              "related": "http://localhost:3100/v1/pacbio/pools/2/libraries"
+            },
+            "data": [
+              {
+                "type": "libraries",
+                "id": "2"
+              }
+            ]
+          }
+        }
+      }
+    ],
+    "included": [
+      {
+        "id": "1",
+        "type": "tubes",
+        "links": {
+          "self": "http://localhost:3100/v1/pacbio/tubes/1"
+        },
+        "attributes": {
+          "barcode": "TRAC-2-1"
+        }
+      },
+      {
+        "id": "2",
+        "type": "tubes",
+        "links": {
+          "self": "http://localhost:3100/v1/pacbio/tubes/2"
+        },
+        "attributes": {
+          "barcode": "TRAC-2-2"
+        }
+      },
+      {
+        "id": "1",
+        "type": "libraries",
+        "links": {
+          "self": "http://localhost:3100/v1/pacbio/libraries/1"
+        },
+        "relationships": {
+          "request": {
+            "links": {
+              "self": "http://localhost:3100/v1/pacbio/libraries/1/relationships/request",
+              "related": "http://localhost:3100/v1/pacbio/libraries/1/request"
+            },
+            "data": {
+              "type": "requests",
+              "id": "1"
+            }
+          },
+          "tag": {
+            "links": {
+              "self": "http://localhost:3100/v1/pacbio/libraries/1/relationships/tag",
+              "related": "http://localhost:3100/v1/pacbio/libraries/1/tag"
+            },
+            "data": {
+              "type": "tags",
+              "id": "26"
+            }
+          }
+        }
+      },
+      {
+        "id": "2",
+        "type": "libraries",
+        "links": {
+          "self": "http://localhost:3100/v1/pacbio/libraries/2"
+        },
+        "relationships": {
+          "request": {
+            "links": {
+              "self": "http://localhost:3100/v1/pacbio/libraries/2/relationships/request",
+              "related": "http://localhost:3100/v1/pacbio/libraries/2/request"
+            },
+            "data": {
+              "type": "requests",
+              "id": "2"
+            }
+          },
+          "tag": {
+            "links": {
+              "self": "http://localhost:3100/v1/pacbio/libraries/2/relationships/tag",
+              "related": "http://localhost:3100/v1/pacbio/libraries/2/tag"
+            },
+            "data": {
+              "type": "tags",
+              "id": "7"
+            }
+          }
+        }
+      },
+      {
+        "id": "7",
+        "type": "tags",
+        "attributes": {
+          "group_id": "bc1011_BAK8A_OA"
+        }
+      },
+      {
+        "id": "26",
+        "type": "tags",
+        "attributes": {
+          "group_id": "bc1019"
+        }
+      },
+      {
+        "id": "1",
+        "type": "requests",
+        "links": {
+          "self": "http://localhost:3100/v1/pacbio/requests/1"
+        },
+        "attributes": {
+          "sample_name": "Sample48"
+        }
+      },
+      {
+        "id": "2",
+        "type": "requests",
+        "links": {
+          "self": "http://localhost:3100/v1/pacbio/requests/2"
+        },
+        "attributes": {
+          "sample_name": "Sample47"
+        }
+      }
+    ]
+  },
+  "status": 200,
+  "statusText": "Success"
+}
diff --git a/tests/data/tractionPacbioPoolsNoRelationships.json b/tests/data/tractionPacbioPoolsNoRelationships.json
new file mode 100644
index 000000000..903efbfea
--- /dev/null
+++ b/tests/data/tractionPacbioPoolsNoRelationships.json
@@ -0,0 +1,55 @@
+{
+  "data": {
+    "data": [
+      {
+        "id": "1",
+        "type": "pools",
+        "links": {
+          "self": "http://localhost:3100/v1/pacbio/pools/1"
+        },
+        "relationships": {
+          "tube": {
+            "links": {
+              "self": "http://localhost:3100/v1/pacbio/pools/1/relationships/tube",
+              "related": "http://localhost:3100/v1/pacbio/pools/1/tube"
+            },
+            "data": null
+          },
+          "libraries": {
+            "links": {
+              "self": "http://localhost:3100/v1/pacbio/pools/1/relationships/libraries",
+              "related": "http://localhost:3100/v1/pacbio/pools/1/libraries"
+            },
+            "data": []
+          }
+        }
+      },
+      {
+        "id": "2",
+        "type": "pools",
+        "links": {
+          "self": "http://localhost:3100/v1/pacbio/pools/2"
+        },
+        "relationships": {
+          "tube": {
+            "links": {
+              "self": "http://localhost:3100/v1/pacbio/pools/2/relationships/tube",
+              "related": "http://localhost:3100/v1/pacbio/pools/2/tube"
+            },
+            "data": null
+          },
+          "libraries": {
+            "links": {
+              "self": "http://localhost:3100/v1/pacbio/pools/2/relationships/libraries",
+              "related": "http://localhost:3100/v1/pacbio/pools/2/libraries"
+            },
+            "data": []
+          }
+        }
+      }
+    ],
+    "included": []
+  },
+  "status": 200,
+  "statusText": "Success"
+}
diff --git a/tests/data/tractionPacbioTagSets.json b/tests/data/tractionPacbioTagSets.json
new file mode 100644
index 000000000..5de4012ef
--- /dev/null
+++ b/tests/data/tractionPacbioTagSets.json
@@ -0,0 +1,854 @@
+{
+  "data": {
+    "data": [
+      {
+        "id": "3",
+        "type": "tag_sets",
+        "links": {
+          "self": "/v1/pacbio/tag_sets/3"
+        },
+        "attributes": {
+          "name": "Sequel_16_barcodes_v3",
+          "uuid": "4d87a8ab-4d16-f0b0-77e5-0f467dba442e",
+          "pipeline": "pacbio"
+        },
+        "relationships": {
+          "tags": {
+            "links": {
+              "self": "/v1/pacbio/tag_sets/3/relationships/tags",
+              "related": "/v1/pacbio/tag_sets/3/tags"
+            },
+            "data": [
+              {
+                "type": "tags",
+                "id": "113"
+              },
+              {
+                "type": "tags",
+                "id": "114"
+              },
+              {
+                "type": "tags",
+                "id": "115"
+              },
+              {
+                "type": "tags",
+                "id": "116"
+              },
+              {
+                "type": "tags",
+                "id": "117"
+              },
+              {
+                "type": "tags",
+                "id": "118"
+              },
+              {
+                "type": "tags",
+                "id": "119"
+              },
+              {
+                "type": "tags",
+                "id": "120"
+              },
+              {
+                "type": "tags",
+                "id": "121"
+              },
+              {
+                "type": "tags",
+                "id": "122"
+              },
+              {
+                "type": "tags",
+                "id": "123"
+              },
+              {
+                "type": "tags",
+                "id": "124"
+              },
+              {
+                "type": "tags",
+                "id": "125"
+              },
+              {
+                "type": "tags",
+                "id": "126"
+              },
+              {
+                "type": "tags",
+                "id": "127"
+              },
+              {
+                "type": "tags",
+                "id": "128"
+              }
+            ]
+          }
+        }
+      },
+      {
+        "id": "4",
+        "type": "tag_sets",
+        "links": {
+          "self": "/v1/pacbio/tag_sets/4"
+        },
+        "attributes": {
+          "name": "IsoSeq_v1",
+          "uuid": "6f2eccc7-e7ef-4195-abdd-494e635ee944",
+          "pipeline": "pacbio"
+        },
+        "relationships": {
+          "tags": {
+            "links": {
+              "self": "/v1/pacbio/tag_sets/4/relationships/tags",
+              "related": "/v1/pacbio/tag_sets/4/tags"
+            },
+            "data": [
+              {
+                "type": "tags",
+                "id": "129"
+              },
+              {
+                "type": "tags",
+                "id": "130"
+              },
+              {
+                "type": "tags",
+                "id": "131"
+              },
+              {
+                "type": "tags",
+                "id": "132"
+              },
+              {
+                "type": "tags",
+                "id": "133"
+              },
+              {
+                "type": "tags",
+                "id": "134"
+              },
+              {
+                "type": "tags",
+                "id": "135"
+              },
+              {
+                "type": "tags",
+                "id": "136"
+              },
+              {
+                "type": "tags",
+                "id": "137"
+              },
+              {
+                "type": "tags",
+                "id": "138"
+              },
+              {
+                "type": "tags",
+                "id": "139"
+              },
+              {
+                "type": "tags",
+                "id": "140"
+              },
+              {
+                "type": "tags",
+                "id": "141"
+              },
+              {
+                "type": "tags",
+                "id": "142"
+              },
+              {
+                "type": "tags",
+                "id": "143"
+              },
+              {
+                "type": "tags",
+                "id": "144"
+              },
+              {
+                "type": "tags",
+                "id": "145"
+              },
+              {
+                "type": "tags",
+                "id": "146"
+              },
+              {
+                "type": "tags",
+                "id": "147"
+              },
+              {
+                "type": "tags",
+                "id": "148"
+              },
+              {
+                "type": "tags",
+                "id": "149"
+              },
+              {
+                "type": "tags",
+                "id": "150"
+              },
+              {
+                "type": "tags",
+                "id": "151"
+              },
+              {
+                "type": "tags",
+                "id": "152"
+              }
+            ]
+          }
+        }
+      }
+    ],
+    "included": [
+      {
+        "id": "113",
+        "type": "tags",
+        "attributes": {
+          "oligo": "CACATATCAGAGTGCGT",
+          "group_id": "bc1001_BAK8A_OA"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "3"
+            }
+          }
+        }
+      },
+      {
+        "id": "114",
+        "type": "tags",
+        "attributes": {
+          "oligo": "ACACACAGACTGTGAGT",
+          "group_id": "bc1002_BAK8A_OA"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "3"
+            }
+          }
+        }
+      },
+      {
+        "id": "115",
+        "type": "tags",
+        "attributes": {
+          "oligo": "ACACATCTCGTGAGAGT",
+          "group_id": "bc1003_BAK8A_OA"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "3"
+            }
+          }
+        }
+      },
+      {
+        "id": "116",
+        "type": "tags",
+        "attributes": {
+          "oligo": "ACAGTCGAGCGCTGCGT",
+          "group_id": "bc1008_BAK8A_OA"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "3"
+            }
+          }
+        }
+      },
+      {
+        "id": "117",
+        "type": "tags",
+        "attributes": {
+          "oligo": "ACACACGCGAGACAGAT",
+          "group_id": "bc1009_BAK8A_OA"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "3"
+            }
+          }
+        }
+      },
+      {
+        "id": "118",
+        "type": "tags",
+        "attributes": {
+          "oligo": "ACGCGCTATCTCAGAGT",
+          "group_id": "bc1010_BAK8A_OA"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "3"
+            }
+          }
+        }
+      },
+      {
+        "id": "119",
+        "type": "tags",
+        "attributes": {
+          "oligo": "CTATACGTATATCTATT",
+          "group_id": "bc1011_BAK8A_OA"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "3"
+            }
+          }
+        }
+      },
+      {
+        "id": "120",
+        "type": "tags",
+        "attributes": {
+          "oligo": "ACACTAGATCGCGTGTT",
+          "group_id": "bc1012_BAK8A_OA"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "3"
+            }
+          }
+        }
+      },
+      {
+        "id": "121",
+        "type": "tags",
+        "attributes": {
+          "oligo": "CGCATGACACGTGTGTT",
+          "group_id": "bc1015_BAK8B_OA"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "3"
+            }
+          }
+        }
+      },
+      {
+        "id": "122",
+        "type": "tags",
+        "attributes": {
+          "oligo": "CATAGAGAGATAGTATT",
+          "group_id": "bc1016_BAK8B_OA"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "3"
+            }
+          }
+        }
+      },
+      {
+        "id": "123",
+        "type": "tags",
+        "attributes": {
+          "oligo": "CACACGCGCGCTATATT",
+          "group_id": "bc1017_BAK8B_OA"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "3"
+            }
+          }
+        }
+      },
+      {
+        "id": "124",
+        "type": "tags",
+        "attributes": {
+          "oligo": "TCACGTGCTCACTGTGT",
+          "group_id": "bc1018_BAK8B_OA"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "3"
+            }
+          }
+        }
+      },
+      {
+        "id": "125",
+        "type": "tags",
+        "attributes": {
+          "oligo": "ACACACTCTATCAGATT",
+          "group_id": "bc1019_BAK8B_OA"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "3"
+            }
+          }
+        }
+      },
+      {
+        "id": "126",
+        "type": "tags",
+        "attributes": {
+          "oligo": "CACGACACGACGATGTT",
+          "group_id": "bc1020_BAK8B_OA"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "3"
+            }
+          }
+        }
+      },
+      {
+        "id": "127",
+        "type": "tags",
+        "attributes": {
+          "oligo": "CTATACATAGTGATGTT",
+          "group_id": "bc1021_BAK8B_OA"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "3"
+            }
+          }
+        }
+      },
+      {
+        "id": "128",
+        "type": "tags",
+        "attributes": {
+          "oligo": "CACTCACGTGTGATATT",
+          "group_id": "bc1022_BAK8B_OA"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "3"
+            }
+          }
+        }
+      },
+      {
+        "id": "129",
+        "type": "tags",
+        "attributes": {
+          "oligo": "CACATATCAGAGTGCGGCAATGAAGTCGCAGGGTTG",
+          "group_id": "bc1001-F"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "4"
+            }
+          }
+        }
+      },
+      {
+        "id": "130",
+        "type": "tags",
+        "attributes": {
+          "oligo": "CACATATCAGAGTGCGAAGCAGTGGTATCAACGCAGAGT",
+          "group_id": "bc1001-R"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "4"
+            }
+          }
+        }
+      },
+      {
+        "id": "131",
+        "type": "tags",
+        "attributes": {
+          "oligo": "ACACACAGACTGTGAGGCAATGAAGTCGCAGGGTTG",
+          "group_id": "bc1002-F"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "4"
+            }
+          }
+        }
+      },
+      {
+        "id": "132",
+        "type": "tags",
+        "attributes": {
+          "oligo": "ACACACAGACTGTGAGAAGCAGTGGTATCAACGCAGAGT",
+          "group_id": "bc1002-R"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "4"
+            }
+          }
+        }
+      },
+      {
+        "id": "133",
+        "type": "tags",
+        "attributes": {
+          "oligo": "ACACATCTCGTGAGAGGCAATGAAGTCGCAGGGTTG",
+          "group_id": "bc1003-F"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "4"
+            }
+          }
+        }
+      },
+      {
+        "id": "134",
+        "type": "tags",
+        "attributes": {
+          "oligo": "ACACATCTCGTGAGAGAAGCAGTGGTATCAACGCAGAGT",
+          "group_id": "bc1003-R"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "4"
+            }
+          }
+        }
+      },
+      {
+        "id": "135",
+        "type": "tags",
+        "attributes": {
+          "oligo": "CACGCACACACGCGCGGCAATGAAGTCGCAGGGTTG",
+          "group_id": "bc1004-F"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "4"
+            }
+          }
+        }
+      },
+      {
+        "id": "136",
+        "type": "tags",
+        "attributes": {
+          "oligo": "CACGCACACACGCGCGAAGCAGTGGTATCAACGCAGAGT",
+          "group_id": "bc1004-R"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "4"
+            }
+          }
+        }
+      },
+      {
+        "id": "137",
+        "type": "tags",
+        "attributes": {
+          "oligo": "CACTCGACTCTCGCGTGCAATGAAGTCGCAGGGTTG",
+          "group_id": "bc1005-F"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "4"
+            }
+          }
+        }
+      },
+      {
+        "id": "138",
+        "type": "tags",
+        "attributes": {
+          "oligo": "CACTCGACTCTCGCGTAAGCAGTGGTATCAACGCAGAGT",
+          "group_id": "bc1005-R"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "4"
+            }
+          }
+        }
+      },
+      {
+        "id": "139",
+        "type": "tags",
+        "attributes": {
+          "oligo": "CATATATATCAGCTGTGCAATGAAGTCGCAGGGTTG",
+          "group_id": "bc1006-F"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "4"
+            }
+          }
+        }
+      },
+      {
+        "id": "140",
+        "type": "tags",
+        "attributes": {
+          "oligo": "CATATATATCAGCTGTAAGCAGTGGTATCAACGCAGAGT",
+          "group_id": "bc1006-R"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "4"
+            }
+          }
+        }
+      },
+      {
+        "id": "141",
+        "type": "tags",
+        "attributes": {
+          "oligo": "ACAGTCGAGCGCTGCGGCAATGAAGTCGCAGGGTTG",
+          "group_id": "bc1008-F"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "4"
+            }
+          }
+        }
+      },
+      {
+        "id": "142",
+        "type": "tags",
+        "attributes": {
+          "oligo": "ACAGTCGAGCGCTGCGAAGCAGTGGTATCAACGCAGAGT",
+          "group_id": "bc1008-R "
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "4"
+            }
+          }
+        }
+      },
+      {
+        "id": "143",
+        "type": "tags",
+        "attributes": {
+          "oligo": "ACACTAGATCGCGTGTGCAATGAAGTCGCAGGGTTG",
+          "group_id": "bc1012-F"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "4"
+            }
+          }
+        }
+      },
+      {
+        "id": "144",
+        "type": "tags",
+        "attributes": {
+          "oligo": "ACACTAGATCGCGTGTAAGCAGTGGTATCAACGCAGAGT",
+          "group_id": "bc1012-R"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "4"
+            }
+          }
+        }
+      },
+      {
+        "id": "145",
+        "type": "tags",
+        "attributes": {
+          "oligo": "TCACGTGCTCACTGTGGCAATGAAGTCGCAGGGTTG",
+          "group_id": "bc1018-F"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "4"
+            }
+          }
+        }
+      },
+      {
+        "id": "146",
+        "type": "tags",
+        "attributes": {
+          "oligo": "TCACGTGCTCACTGTGAAGCAGTGGTATCAACGCAGAGT",
+          "group_id": "bc1018-R"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "4"
+            }
+          }
+        }
+      },
+      {
+        "id": "147",
+        "type": "tags",
+        "attributes": {
+          "oligo": "ACACACTCTATCAGATGCAATGAAGTCGCAGGGTTG",
+          "group_id": "bc1019-F"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "4"
+            }
+          }
+        }
+      },
+      {
+        "id": "148",
+        "type": "tags",
+        "attributes": {
+          "oligo": "ACACACTCTATCAGATAAGCAGTGGTATCAACGCAGAGT",
+          "group_id": "bc1019-R"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "4"
+            }
+          }
+        }
+      },
+      {
+        "id": "149",
+        "type": "tags",
+        "attributes": {
+          "oligo": "CACGACACGACGATGTGCAATGAAGTCGCAGGGTTG",
+          "group_id": "bc1020-F"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "4"
+            }
+          }
+        }
+      },
+      {
+        "id": "150",
+        "type": "tags",
+        "attributes": {
+          "oligo": "CACGACACGACGATGTAAGCAGTGGTATCAACGCAGAGT",
+          "group_id": "bc1020-R"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "4"
+            }
+          }
+        }
+      },
+      {
+        "id": "151",
+        "type": "tags",
+        "attributes": {
+          "oligo": "CAGAGAGATATCTCTGGCAATGAAGTCGCAGGGTTG",
+          "group_id": "bc1023-F"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "4"
+            }
+          }
+        }
+      },
+      {
+        "id": "152",
+        "type": "tags",
+        "attributes": {
+          "oligo": "CAGAGAGATATCTCTGAAGCAGTGGTATCAACGCAGAGT",
+          "group_id": "bc1023-R"
+        },
+        "relationships": {
+          "tag_set": {
+            "data": {
+              "type": "tag_sets",
+              "id": "4"
+            }
+          }
+        }
+      }
+    ]
+  },
+  "status": 200,
+  "statusText": "Success"
+}
diff --git a/tests/e2e/fixtures/pacbioPlatesRequest.json b/tests/e2e/fixtures/pacbioPlatesRequest.json
new file mode 100644
index 000000000..79a42d933
--- /dev/null
+++ b/tests/e2e/fixtures/pacbioPlatesRequest.json
@@ -0,0 +1,208 @@
+{
+  "data": [
+    {
+      "id": "61",
+      "type": "plates",
+      "links": {
+        "self": "/v1/pacbio/plates/61"
+      },
+      "attributes": {
+        "barcode": "DN814327C",
+        "created_at": "2021/06/03 06:59"
+      },
+      "relationships": {
+        "wells": {
+          "links": {
+            "self": "/v1/pacbio/plates/61/relationships/wells",
+            "related": "/v1/pacbio/plates/61/wells"
+          },
+          "data": [
+            {
+              "type": "wells",
+              "id": "4722"
+            },
+            {
+              "type": "wells",
+              "id": "4723"
+            }
+          ]
+        }
+      }
+    },
+    {
+      "id": "62",
+      "type": "plates",
+      "links": {
+        "self": "/v1/pacbio/plates/62"
+      },
+      "attributes": {
+        "barcode": "DN814567Q",
+        "created_at": "2021/06/03 14:57"
+      },
+      "relationships": {
+        "wells": {
+          "links": {
+            "self": "/v1/pacbio/plates/62/relationships/wells",
+            "related": "/v1/pacbio/plates/62/wells"
+          },
+          "data": [
+            {
+              "type": "wells",
+              "id": "4818"
+            },
+            {
+              "type": "wells",
+              "id": "4819"
+            }
+          ]
+        }
+      }
+    }
+  ],
+  "included": [
+    {
+      "id": "4722",
+      "type": "wells",
+      "attributes": {
+        "position": "A1"
+      },
+      "relationships": {
+        "requests": {
+          "data": [
+            {
+              "type": "requests",
+              "id": "40"
+            }
+          ]
+        }
+      }
+    },
+    {
+      "id": "4723",
+      "type": "wells",
+      "attributes": {
+        "position": "A2"
+      },
+      "relationships": {
+        "requests": {
+          "data": [
+            {
+              "type": "requests",
+              "id": "41"
+            }
+          ]
+        }
+      }
+    },
+    {
+      "id": "4818",
+      "type": "wells",
+      "attributes": {
+        "position": "A1"
+      },
+      "relationships": {
+        "requests": {
+          "data": [
+            {
+              "type": "requests",
+              "id": "136"
+            }
+          ]
+        }
+      }
+    },
+    {
+      "id": "4819",
+      "type": "wells",
+      "attributes": {
+        "position": "B1"
+      },
+      "relationships": {
+        "requests": {
+          "data": [
+            {
+              "type": "requests",
+              "id": "137"
+            }
+          ]
+        }
+      }
+    },
+    {
+      "id": "40",
+      "type": "requests",
+      "links": {
+        "self": "/v1/pacbio/requests/40"
+      },
+      "attributes": {
+        "library_type": null,
+        "estimate_of_gb_required": null,
+        "number_of_smrt_cells": null,
+        "cost_code": null,
+        "external_study_id": "fec8a1fa-b9e2-11e9-9123-fa163e99b035",
+        "sample_name": "sample_DN814327C_A1",
+        "barcode": null,
+        "sample_species": "human",
+        "created_at": "2021/06/03 06:59",
+        "source_identifier": "DN814327C:A1"
+      }
+    },
+    {
+      "id": "41",
+      "type": "requests",
+      "links": {
+        "self": "/v1/pacbio/requests/41"
+      },
+      "attributes": {
+        "library_type": null,
+        "estimate_of_gb_required": null,
+        "number_of_smrt_cells": null,
+        "cost_code": null,
+        "external_study_id": "fec8a1fa-b9e2-11e9-9123-fa163e99b035",
+        "sample_name": "sample_DN814327C_A2",
+        "barcode": null,
+        "sample_species": "human",
+        "created_at": "2021/06/03 06:59",
+        "source_identifier": "DN814327C:A2"
+      }
+    },
+    {
+      "id": "136",
+      "type": "requests",
+      "links": {
+        "self": "/v1/pacbio/requests/136"
+      },
+      "attributes": {
+        "library_type": null,
+        "estimate_of_gb_required": null,
+        "number_of_smrt_cells": null,
+        "cost_code": null,
+        "external_study_id": "d160363e-ba2e-11e7-b4cc-68b599768938",
+        "sample_name": "5049STDY8152829",
+        "barcode": null,
+        "sample_species": "human",
+        "created_at": "2021/06/03 14:57",
+        "source_identifier": "DN814567Q:A1"
+      }
+    },
+    {
+      "id": "137",
+      "type": "requests",
+      "links": {
+        "self": "/v1/pacbio/requests/137"
+      },
+      "attributes": {
+        "library_type": null,
+        "estimate_of_gb_required": null,
+        "number_of_smrt_cells": null,
+        "cost_code": null,
+        "external_study_id": "d160363e-ba2e-11e7-b4cc-68b599768938",
+        "sample_name": "5049STDY8152830",
+        "barcode": null,
+        "sample_species": "cat",
+        "created_at": "2021/06/03 14:57",
+        "source_identifier": "DN814567Q:B1"
+      }
+    }
+  ]
+}
diff --git a/tests/e2e/fixtures/tractionPacbioPools.json b/tests/e2e/fixtures/tractionPacbioPools.json
new file mode 100644
index 000000000..8d2844cf4
--- /dev/null
+++ b/tests/e2e/fixtures/tractionPacbioPools.json
@@ -0,0 +1,180 @@
+{
+  "data": [
+    {
+      "id": "1",
+      "type": "pools",
+      "links": {
+        "self": "/v1/pacbio/pools/1"
+      },
+      "relationships": {
+        "tube": {
+          "links": {
+            "self": "/v1/pacbio/pools/1/relationships/tube",
+            "related": "/v1/pacbio/pools/1/tube"
+          },
+          "data": {
+            "type": "tubes",
+            "id": "1"
+          }
+        },
+        "libraries": {
+          "links": {
+            "self": "/v1/pacbio/pools/1/relationships/libraries",
+            "related": "/v1/pacbio/pools/1/libraries"
+          },
+          "data": [
+            {
+              "type": "libraries",
+              "id": "1"
+            }
+          ]
+        }
+      }
+    },
+    {
+      "id": "2",
+      "type": "pools",
+      "links": {
+        "self": "/v1/pacbio/pools/2"
+      },
+      "relationships": {
+        "tube": {
+          "links": {
+            "self": "/v1/pacbio/pools/2/relationships/tube",
+            "related": "/v1/pacbio/pools/2/tube"
+          },
+          "data": {
+            "type": "tubes",
+            "id": "2"
+          }
+        },
+        "libraries": {
+          "links": {
+            "self": "/v1/pacbio/pools/2/relationships/libraries",
+            "related": "/v1/pacbio/pools/2/libraries"
+          },
+          "data": [
+            {
+              "type": "libraries",
+              "id": "2"
+            }
+          ]
+        }
+      }
+    }
+  ],
+  "included": [
+    {
+      "id": "1",
+      "type": "tubes",
+      "links": {
+        "self": "/v1/pacbio/tubes/1"
+      },
+      "attributes": {
+        "barcode": "TRAC-2-1"
+      }
+    },
+    {
+      "id": "2",
+      "type": "tubes",
+      "links": {
+        "self": "/v1/pacbio/tubes/2"
+      },
+      "attributes": {
+        "barcode": "TRAC-2-2"
+      }
+    },
+    {
+      "id": "1",
+      "type": "libraries",
+      "links": {
+        "self": "/v1/pacbio/libraries/1"
+      },
+      "relationships": {
+        "request": {
+          "links": {
+            "self": "/v1/pacbio/libraries/1/relationships/request",
+            "related": "/v1/pacbio/libraries/1/request"
+          },
+          "data": {
+            "type": "requests",
+            "id": "1"
+          }
+        },
+        "tag": {
+          "links": {
+            "self": "/v1/pacbio/libraries/1/relationships/tag",
+            "related": "/v1/pacbio/libraries/1/tag"
+          },
+          "data": {
+            "type": "tags",
+            "id": "26"
+          }
+        }
+      }
+    },
+    {
+      "id": "2",
+      "type": "libraries",
+      "links": {
+        "self": "/v1/pacbio/libraries/2"
+      },
+      "relationships": {
+        "request": {
+          "links": {
+            "self": "/v1/pacbio/libraries/2/relationships/request",
+            "related": "/v1/pacbio/libraries/2/request"
+          },
+          "data": {
+            "type": "requests",
+            "id": "2"
+          }
+        },
+        "tag": {
+          "links": {
+            "self": "/v1/pacbio/libraries/2/relationships/tag",
+            "related": "/v1/pacbio/libraries/2/tag"
+          },
+          "data": {
+            "type": "tags",
+            "id": "7"
+          }
+        }
+      }
+    },
+    {
+      "id": "7",
+      "type": "tags",
+      "attributes": {
+        "group_id": "bc1011_BAK8A_OA"
+      }
+    },
+    {
+      "id": "26",
+      "type": "tags",
+      "attributes": {
+        "group_id": "bc1019"
+      }
+    },
+    {
+      "id": "1",
+      "type": "requests",
+      "links": {
+        "self": "/v1/pacbio/requests/1"
+      },
+      "attributes": {
+        "sample_name": "Sample48"
+      }
+    },
+    {
+      "id": "2",
+      "type": "requests",
+      "links": {
+        "self": "/v1/pacbio/requests/2"
+      },
+      "attributes": {
+        "sample_name": "Sample47"
+      }
+    }
+  ]
+}
diff --git a/tests/e2e/fixtures/tractionPacbioRuns.json b/tests/e2e/fixtures/tractionPacbioRuns.json
index 87f61b25b..408257faf 100644
--- a/tests/e2e/fixtures/tractionPacbioRuns.json
+++ b/tests/e2e/fixtures/tractionPacbioRuns.json
@@ -15,7 +15,7 @@
         "created_at": "2021/06/15 10:25",
         "state": "pending",
         "comments": "Sample207",
-        "all_wells_have_libraries": true
+        "all_wells_have_pools": true
       },
       "relationships": {
         "plate": {
@@ -41,7 +41,7 @@
         "created_at": "2021/06/15 10:25",
         "state": "pending",
         "comments": "Sample21",
-        "all_wells_have_libraries": true
+        "all_wells_have_pools": true
       },
       "relationships": {
         "plate": {
@@ -67,7 +67,7 @@
         "created_at": "2021/06/15 10:25",
         "state": "pending",
         "comments": "Sample15",
-        "all_wells_have_libraries": true
+        "all_wells_have_pools": true
       },
       "relationships": {
         "plate": {
@@ -93,7 +93,7 @@
         "created_at": "2021/06/15 10:25",
         "state": "pending",
         "comments": "Sample240",
-        "all_wells_have_libraries": true
+        "all_wells_have_pools": true
       },
       "relationships": {
         "plate": {
@@ -119,7 +119,7 @@
         "created_at": "2021/06/15 10:25",
         "state": "pending",
         "comments": "Sample73",
-        "all_wells_have_libraries": true
+        "all_wells_have_pools": true
       },
       "relationships": {
         "plate": {
diff --git a/tests/e2e/fixtures/tractionPacbioTagSets.json b/tests/e2e/fixtures/tractionPacbioTagSets.json
new file mode 100644
index 000000000..71d21f56b
--- /dev/null
+++ b/tests/e2e/fixtures/tractionPacbioTagSets.json
@@ -0,0 +1,610 @@
+{
+  "data": [
+    {
+      "id": "6",
+      "type": "tag_sets",
+      "links": {
+        "self": "/v1/pacbio/tag_sets/6"
+      },
+      "attributes": {
+        "name": "IsoSeq_v1",
+        "uuid": "0ed94509-779b-4ba8-babc-7240ab6e30fd",
+        "pipeline": "pacbio"
+      },
+      "relationships": {
+        "tags": {
+          "links": {
+            "self": "/v1/pacbio/tag_sets/6/relationships/tags",
+            "related": "/v1/pacbio/tag_sets/6/tags"
+          },
+          "data": [
+            {
+              "type": "tags",
+              "id": "249"
+            },
+            {
+              "type": "tags",
+              "id": "250"
+            },
+            {
+              "type": "tags",
+              "id": "251"
+            },
+            {
+              "type": "tags",
+              "id": "252"
+            },
+            {
+              "type": "tags",
+              "id": "253"
+            },
+            {
+              "type": "tags",
+              "id": "254"
+            },
+            {
+              "type": "tags",
+              "id": "255"
+            },
+            {
+              "type": "tags",
+              "id": "256"
+            },
+            {
+              "type": "tags",
+              "id": "257"
+            },
+            {
+              "type": "tags",
+              "id": "258"
+            },
+            {
+              "type": "tags",
+              "id": "259"
+            },
+            {
+              "type": "tags",
+              "id": "260"
+            }
+          ]
+        }
+      }
+    },
+    {
+      "id": "7",
+      "type": "tag_sets",
+      "links": {
+        "self": "/v1/pacbio/tag_sets/7"
+      },
+      "attributes": {
+        "name": "Sequel_16_barcodes_v3",
+        "uuid": "4d87a8ab-4d16-f0b0-77e5-0f467dba442e",
+        "pipeline": "pacbio"
+      },
+      "relationships": {
+        "tags": {
+          "links": {
+            "self": "/v1/pacbio/tag_sets/7/relationships/tags",
+            "related": "/v1/pacbio/tag_sets/7/tags"
+          },
+          "data": [
+            {
+              "type": "tags",
+              "id": "261"
+            },
+            {
+              "type": "tags",
+              "id": "262"
+            },
+            {
+              "type": "tags",
+              "id": "263"
+            },
+            {
+              "type": "tags",
+              "id": "264"
+            },
+            {
+              "type": "tags",
+              "id": "265"
+            },
+            {
+              "type": "tags",
+              "id": "266"
+            },
+            {
+              "type": "tags",
+              "id": "267"
+            },
+            {
+              "type": "tags",
+              "id": "268"
+            },
+            {
+              "type": "tags",
+              "id": "269"
+            },
+            {
+              "type": "tags",
+              "id": "270"
+            },
+            {
+              "type": "tags",
+              "id": "271"
+            },
+            {
+              "type": "tags",
+              "id": "272"
+            },
+            {
+              "type": "tags",
+              "id": "273"
+            },
+            {
+              "type": "tags",
+              "id": "274"
+            },
+            {
+              "type": "tags",
+              "id": "275"
+            },
+            {
+              "type": "tags",
+              "id": "276"
+            }
+          ]
+        }
+      }
+    }
+  ],
+  "included": [
+    {
+      "id": "249",
+      "type": "tags",
+      "attributes": {
+        "oligo": "CACATATCAGAGTGCG",
+        "group_id": "bc1001"
+      },
+      "relationships": {
+        "tag_set": {
+          "data": {
+            "type": "tag_sets",
+            "id": "6"
+          }
+        }
+      }
+    },
+    {
+      "id": "250",
+      "type": "tags",
+      "attributes": {
+        "oligo": "ACACACAGACTGTGAG",
+        "group_id": "bc1002"
+      },
+      "relationships": {
+        "tag_set": {
+          "data": {
+            "type": "tag_sets",
+            "id": "6"
+          }
+        }
+      }
+    },
+    {
+      "id": "251",
+      "type": "tags",
+      "attributes": {
+        "oligo": "ACACATCTCGTGAGAG",
+        "group_id": "bc1003"
+      },
+      "relationships": {
+        "tag_set": {
+          "data": {
+            "type": "tag_sets",
+            "id": "6"
+          }
+        }
+      }
+    },
+    {
+      "id": "252",
+      "type": "tags",
+      "attributes": {
+        "oligo": "CACGCACACACGCGCG",
+        "group_id": "bc1004"
+      },
+      "relationships": {
+        "tag_set": {
+          "data": {
+            "type": "tag_sets",
+            "id": "6"
+          }
+        }
+      }
+    },
+    {
+      "id": "253",
+      "type": "tags",
+      "attributes": {
+        "oligo": "CACTCGACTCTCGCGT",
+        "group_id": "bc1005"
+      },
+      "relationships": {
+        "tag_set": {
+          "data": {
+            "type": "tag_sets",
+            "id": "6"
+          }
+        }
+      }
+    },
+    {
+      "id": "254",
+      "type": "tags",
+      "attributes": {
+        "oligo": "CATATATATCAGCTGT",
+        "group_id": "bc1006"
+      },
+      "relationships": {
+        "tag_set": {
+          "data": {
+            "type": "tag_sets",
+            "id": "6"
+          }
+        }
+      }
+    },
+    {
+      "id": "255",
+      "type": "tags",
+      "attributes": {
+        "oligo": "ACAGTCGAGCGCTGCG",
+        "group_id": "bc1008"
+      },
+      "relationships": {
+        "tag_set": {
+          "data": {
+            "type": "tag_sets",
+            "id": "6"
+          }
+        }
+      }
+    },
+    {
+      "id": "256",
+      "type": "tags",
+      "attributes": {
+        "oligo": "ACACTAGATCGCGTGT",
+        "group_id": "bc1012"
+      },
+      "relationships": {
+        "tag_set": {
+          "data": {
+            "type": "tag_sets",
+            "id": "6"
+          }
+        }
+      }
+    },
+    {
+      "id": "257",
+      "type": "tags",
+      "attributes": {
+        "oligo": "TCACGTGCTCACTGTG",
+        "group_id": "bc1018"
+      },
+      "relationships": {
+        "tag_set": {
+          "data": {
+            "type": "tag_sets",
+            "id": "6"
+          }
+        }
+      }
+    },
+    {
+      "id": "258",
+      "type": "tags",
+      "attributes": {
+        "oligo": "ACACACTCTATCAGAT",
+        "group_id": "bc1019"
+      },
+      "relationships": {
+        "tag_set": {
+          "data": {
+            "type": "tag_sets",
+            "id": "6"
+          }
+        }
+      }
+    },
+    {
+      "id": "259",
+      "type": "tags",
+      "attributes": {
+        "oligo": "CACGACACGACGATGT",
+        "group_id": "bc1020"
+      },
+      "relationships": {
+        "tag_set": {
+          "data": {
+            "type": "tag_sets",
+            "id": "6"
+          }
+        }
+      }
+    },
+    {
+      "id": "260",
+      "type": "tags",
+      "attributes": {
+        "oligo": "CAGAGAGATATCTCTG",
+        "group_id": "bc1023"
+      },
+      "relationships": {
+        "tag_set": {
+          "data": {
+            "type": "tag_sets",
+            "id": "6"
+          }
+        }
+      }
+    },
+    {
+      "id": "261",
+      "type": "tags",
+      "attributes": {
+        "oligo": "CACATATCAGAGTGCGT",
+        "group_id": "bc1001_BAK8A_OA"
+      },
+      "relationships": {
+        "tag_set": {
+          "data": {
+            "type": "tag_sets",
+            "id": "7"
+          }
+        }
+      }
+    },
+    {
+      "id": "262",
+      "type": "tags",
+      "attributes": {
+        "oligo": "ACACACAGACTGTGAGT",
+        "group_id": "bc1002_BAK8A_OA"
+      },
+      "relationships": {
+        "tag_set": {
+          "data": {
+            "type": "tag_sets",
+            "id": "7"
+          }
+        }
+      }
+    },
+    {
+      "id": "263",
+      "type": "tags",
+      "attributes": {
+        "oligo": "ACACATCTCGTGAGAGT",
+        "group_id": "bc1003_BAK8A_OA"
+      },
+      "relationships": {
+        "tag_set": {
+          "data": {
+            "type": "tag_sets",
+            "id": "7"
+          }
+        }
+      }
+    },
+    {
+      "id": "264",
+      "type": "tags",
+      "attributes": {
+        "oligo": "ACAGTCGAGCGCTGCGT",
+        "group_id": "bc1008_BAK8A_OA"
+      },
+      "relationships": {
+        "tag_set": {
+          "data": {
+            "type": "tag_sets",
+            "id": "7"
+          }
+        }
+      }
+    },
+    {
+      "id": "265",
+      "type": "tags",
+      "attributes": {
+        "oligo": "ACACACGCGAGACAGAT",
+        "group_id": "bc1009_BAK8A_OA"
+      },
+      "relationships": {
+        "tag_set": {
+          "data": {
+            "type": "tag_sets",
+            "id": "7"
+          }
+        }
+      }
+    },
+    {
+      "id": "266",
+      "type": "tags",
+      "attributes": {
+        "oligo": "ACGCGCTATCTCAGAGT",
+        "group_id": "bc1010_BAK8A_OA"
+      },
+      "relationships": {
+        "tag_set": {
+          "data": {
+            "type": "tag_sets",
+            "id": "7"
+          }
+        }
+      }
+    },
+    {
+      "id": "267",
+      "type": "tags",
+      "attributes": {
+        "oligo": "CTATACGTATATCTATT",
+        "group_id": "bc1011_BAK8A_OA"
+      },
+      "relationships": {
+        "tag_set": {
+          "data": {
+            "type": "tag_sets",
+            "id": "7"
+          }
+        }
+      }
+    },
+    {
+      "id": "268",
+      "type": "tags",
+      "attributes": {
+        "oligo": "ACACTAGATCGCGTGTT",
+        "group_id": "bc1012_BAK8A_OA"
+      },
+      "relationships": {
+        "tag_set": {
+          "data": {
+            "type": "tag_sets",
+            "id": "7"
+          }
+        }
+      }
+    },
+    {
+      "id": "269",
+      "type": "tags",
+      "attributes": {
+        "oligo": "CGCATGACACGTGTGTT",
+        "group_id": "bc1015_BAK8B_OA"
+      },
+      "relationships": {
+        "tag_set": {
+          "data": {
+            "type": "tag_sets",
+            "id": "7"
+          }
+        }
+      }
+    },
+    {
+      "id": "270",
+      "type": "tags",
+      "attributes": {
+        "oligo": "CATAGAGAGATAGTATT",
+        "group_id": "bc1016_BAK8B_OA"
+      },
+      "relationships": {
+        "tag_set": {
+          "data": {
+            "type": "tag_sets",
+            "id": "7"
+          }
+        }
+      }
+    },
+    {
+      "id": "271",
+      "type": "tags",
+      "attributes": {
+        "oligo": "CACACGCGCGCTATATT",
+        "group_id": "bc1017_BAK8B_OA"
+      },
+      "relationships": {
+        "tag_set": {
+          "data": {
+            "type": "tag_sets",
+            "id": "7"
+          }
+        }
+      }
+    },
+    {
+      "id": "272",
+      "type": "tags",
+      "attributes": {
+        "oligo": "TCACGTGCTCACTGTGT",
+        "group_id": "bc1018_BAK8B_OA"
+      },
+      "relationships": {
+        "tag_set": {
+          "data": {
+            "type": "tag_sets",
+            "id": "7"
+          }
+        }
+      }
+    },
+    {
+      "id": "273",
+      "type": "tags",
+      "attributes": {
+        "oligo": "ACACACTCTATCAGATT",
+        "group_id": "bc1019_BAK8B_OA"
+      },
+      "relationships": {
+        "tag_set": {
+          "data": {
+            "type": "tag_sets",
+            "id": "7"
+          }
+        }
+      }
+    },
+    {
+      "id": "274",
+      "type": "tags",
+      "attributes": {
+        "oligo": "CACGACACGACGATGTT",
+        "group_id": "bc1020_BAK8B_OA"
+      },
+      "relationships": {
+        "tag_set": {
+          "data": {
+            "type": "tag_sets",
+            "id": "7"
+          }
+        }
+      }
+    },
+    {
+      "id": "275",
+      "type": "tags",
+      "attributes": {
+        "oligo": "CTATACATAGTGATGTT",
+        "group_id": "bc1021_BAK8B_OA"
+      },
+      "relationships": {
+        "tag_set": {
+          "data": {
+            "type": "tag_sets",
+            "id": "7"
+          }
+        }
+      }
+    },
+    {
+      "id": "276",
+      "type": "tags",
+      "attributes": {
+        "oligo": "CACTCACGTGTGATATT",
+        "group_id": "bc1022_BAK8B_OA"
+      },
+      "relationships": {
+        "tag_set": {
+          "data": {
+            "type": "tag_sets",
+            "id": "7"
+          }
+        }
+      }
+    }
+  ]
+}
diff --git a/tests/e2e/specs/pacbio_libraries_view.js b/tests/e2e/specs/pacbio_libraries_view.js
index b508ada2f..e317262cc 100644
--- a/tests/e2e/specs/pacbio_libraries_view.js
+++ b/tests/e2e/specs/pacbio_libraries_view.js
@@ -1,6 +1,6 @@
 describe('Pacbio Libraries view', () => {
   it('Visits the pacbio libraries url', () => {
-    cy.intercept('/v1/pacbio/libraries?include=request,tag.tag_set,tube', {
+    cy.intercept('/v1/pacbio/libraries?include=request,tag,tube', {
       fixture: 'tractionPacbioLibraries.json',
     })
     cy.visit('#/pacbio/libraries')
diff --git a/tests/e2e/specs/pacbio_pool_create.js b/tests/e2e/specs/pacbio_pool_create.js
new file mode 100644
index 000000000..3a5ed8972
--- /dev/null
+++ b/tests/e2e/specs/pacbio_pool_create.js
@@ -0,0 +1,95 @@
+describe('Pacbio Pool Create', () => {
+  beforeEach(() => {
+    cy.intercept('/v1/pacbio/tag_sets?include=tags', {
+      fixture: 'tractionPacbioTagSets.json',
+    })
+
+    cy.intercept('/v1/pacbio/plates?include=wells.requests', {
+      fixture: 'pacbioPlatesRequest.json',
+    })
+  })
+
+  it('Creates a pool successfully', () => {
+    cy.visit('#/pacbio/pool/new')
+    cy.contains('Pool')
+    cy.get('[data-type=labware-list]')
+      .get('button')
+      .first()
+      .click()
+    cy.get('[data-input=labware-find]').type('DN814567Q{enter}')
+
+    cy.get('[data-type=plate-item]').should('have.length', 2)
+
+    cy.get('[data-type=tag-set-list]').select('IsoSeq_v1')
+    cy.get('[data-attribute=group-id]').should('have.length', 12)
+
+    //TODO: add at least one more sample
+    cy.get('[data-type=selected-plate-list]').within(() => {
+      cy.get('[data-type=plate-item]').first()
+      cy.get('ellipse')
+        .first()
+        .click()
+    })
+    cy.get('[data-type=pool-library-edit]').should('have.length', 1)
+    // and samples that have failed qc should not be selectable
+    // TODO: Is this brittle? Need to know the data.
+    cy.get('[data-type=pool-library-edit]').within(() => {
+      cy.get('[data-type=tag-list]').select('bc1001')
+      cy.get('[data-attribute=template-prep-kit-box-barcode]').type('ABC1')
+      cy.get('[data-attribute=volume]').type('1')
+      cy.get('[data-attribute=concentration]').type('10.0')
+      cy.get('[data-attribute=fragment-size]').type('100')
+    })
+    cy.intercept('/v1/pacbio/pools', {
+      statusCode: 201,
+      body: {
+        data: {
+          id: '1',
+        },
+      },
+    })
+    cy.get('[data-action=create-pool').click()
+    cy.contains('[data-type=pool-create-message]', 'Pool successfully created')
+  })
+
+  // TODO: we have a problem with handling api calls that cause errors.
+  it('Will not create a pool if there is an error', () => {
+    cy.visit('#/pacbio/pool/new')
+    cy.contains('Pool')
+    cy.get('[data-type=labware-list]')
+      .get('button')
+      .first()
+      .click()
+    cy.get('[data-input=labware-find]').type('DN814567Q{enter}')
+
+    cy.get('[data-type=plate-item]').should('have.length', 2)
+
+    cy.get('[data-type=tag-set-list]').select('IsoSeq_v1')
+    cy.get('[data-attribute=group-id]').should('have.length', 12)
+
+    cy.get('[data-type=selected-plate-list]').within(() => {
+      cy.get('[data-type=plate-item]').first()
+      cy.get('ellipse')
+        .first()
+        .click()
+    })
+    cy.get('[data-type=pool-library-edit]').should('have.length', 1)
+    cy.get('[data-type=pool-library-edit]').within(() => {
+      cy.get('[data-type=tag-list]').select('bc1001')
+      cy.get('[data-attribute=template-prep-kit-box-barcode]').type('ABC1')
+      cy.get('[data-attribute=volume]').type('1')
+      cy.get('[data-attribute=concentration]').type('10.0')
+      cy.get('[data-attribute=fragment-size]').type('100')
+    })
+    cy.intercept('/v1/pacbio/pools', {
+      statusCode: 422,
+      body: {
+        errors: {
+          error1: ['There was a problem'],
+        },
+      },
+    })
+    cy.get('[data-action=create-pool').click()
+    cy.contains('[data-type=pool-create-message]', 'error1 There was a problem')
+  })
+})
diff --git a/tests/e2e/specs/pacbio_run_create.js b/tests/e2e/specs/pacbio_run_create.js
index be85975aa..7bb6e7388 100644
--- a/tests/e2e/specs/pacbio_run_create.js
+++ b/tests/e2e/specs/pacbio_run_create.js
@@ -2,13 +2,16 @@ describe('Pacbio Run Create view', () => {
   it('Creates a run successfully', () => {
     const dataTransfer = new DataTransfer()
 
-    cy.intercept('/v1/pacbio/runs?include=plate.wells.libraries', {
+    cy.intercept('/v1/pacbio/runs?include=plate.wells.pools.tube', {
       fixture: 'tractionPacbioRuns.json',
     })
     cy.visit('#/pacbio/runs')
-    cy.intercept('/v1/pacbio/libraries?include=request,tag.tag_set,tube', {
-      fixture: 'tractionPacbioLibraries.json',
-    })
+    cy.intercept(
+      '/v1/pacbio/pools?include=tube,libraries.tag,libraries.request&fields[requests]=sample_name&fields[tubes]=barcode&fields[tags]=group_id&fields[libraries]=request,tag',
+      {
+        fixture: 'tractionPacbioPools.json',
+      },
+    )
     cy.get('button')
       .contains('New Run')
       .click()
diff --git a/tests/e2e/specs/pacbio_runs_view.js b/tests/e2e/specs/pacbio_runs_view.js
index 4a243a545..0869d5a46 100644
--- a/tests/e2e/specs/pacbio_runs_view.js
+++ b/tests/e2e/specs/pacbio_runs_view.js
@@ -1,10 +1,15 @@
 describe('Pacbio Runs view', () => {
   it('Visits the pacbio runs url', () => {
-    cy.intercept('/v1/pacbio/runs?include=plate.wells.libraries', {
+    cy.intercept('/v1/pacbio/runs?include=plate.wells.pools.tube', {
       fixture: 'tractionPacbioRuns.json',
     })
     cy.visit('#/pacbio/runs')
     cy.get('#run-index').contains('tr', '5')
+    cy.get('#startRun-7')
+    cy.get('#completeRun-7')
+    cy.get('#editRun-7')
+    cy.get('#cancelRun-7')
+    cy.get('#generate-sample-sheet-7')
     cy.get('.run')
       .first()
       .within(() => {
diff --git a/tests/e2e/specs/test.js b/tests/e2e/specs/visit_home_page.js
similarity index 81%
rename from tests/e2e/specs/test.js
rename to tests/e2e/specs/visit_home_page.js
index 86771066d..9218fd3d8 100644
--- a/tests/e2e/specs/test.js
+++ b/tests/e2e/specs/visit_home_page.js
@@ -3,6 +3,6 @@
 describe('My First Test', () => {
   it('Visits the app root url', () => {
     cy.visit('/')
-    cy.contains('h1', 'Traction')
+    cy.contains('h2', 'Traction')
   })
 })
diff --git a/tests/unit/testHelper.js b/tests/support/testHelper.js
similarity index 50%
rename from tests/unit/testHelper.js
rename to tests/support/testHelper.js
index 9b07b4c88..cdfcae89b 100644
--- a/tests/unit/testHelper.js
+++ b/tests/support/testHelper.js
@@ -1,13 +1,10 @@
 import BootstrapVue from 'bootstrap-vue'
 import { mount, createLocalVue, shallowMount } from '@vue/test-utils'
-import VueRouter from 'vue-router'
-import Vuex from 'vuex'
 import store from '@/store'
-import Data from '../data'
+import Data from '@tests/data'
+import router from '@/router'
 
 const localVue = createLocalVue()
 localVue.use(BootstrapVue)
-localVue.use(VueRouter)
-localVue.use(Vuex)
 
-export { mount, localVue, Vuex, store, Data, shallowMount, VueRouter }
+export { mount, localVue, store, Data, shallowMount, router }
diff --git a/tests/unit/api/JsonApi.spec.js b/tests/unit/api/JsonApi.spec.js
index 8eb7043a8..fad2e979f 100644
--- a/tests/unit/api/JsonApi.spec.js
+++ b/tests/unit/api/JsonApi.spec.js
@@ -1,6 +1,6 @@
 import * as JsonApi from '@/api/JsonApi'
-import TestResponse from '../../data/testResponse'
-import CircularResponse from '../../data/circularResponse'
+import TestResponse from '@tests/data/testResponse'
+import CircularResponse from '@tests/data/circularResponse'
 
 // TODO: create a factory which will build a JSON api response. Doing this manually is crushing me.
 describe('JsonApi', () => {
@@ -161,4 +161,61 @@ describe('JsonApi', () => {
       })
     })
   })
+
+  describe('groupIncludedByResource', () => {
+    it('groups resources from an included array', () => {
+      const included = TestResponse.data.included
+      expect(JsonApi.groupIncludedByResource(included)).toEqual({
+        pickles: included.slice(0, 1),
+        chocolates: included.slice(1, 3),
+        crisps: included.slice(3, 5),
+      })
+    })
+  })
+
+  describe('extractRelationshipsAndGroupById', () => {
+    it('creates a list of relationships by id', () => {
+      const relationships = TestResponse.data.data[0].relationships
+      const extractedRelationships = JsonApi.extractRelationshipsAndGroupById(relationships)
+      expect(Object.keys(extractedRelationships)).toEqual([
+        'bean',
+        'pickle',
+        'chocolates',
+        'peaches',
+        'mojitos',
+      ])
+      expect(extractedRelationships.bean).toEqual('1')
+      expect(extractedRelationships.pickle).toEqual('2')
+      expect(extractedRelationships.chocolates).toEqual(['3'])
+      // If we don't have relationship information, we're undefined
+      expect(extractedRelationships.peaches).toEqual(undefined)
+      // But if we explicitly know whe have no relationship, we're null
+      expect(extractedRelationships.mojitos).toEqual(null)
+    })
+
+    it('returns an empty object if the relationships are undefined', () => {
+      const extractedRelationships = JsonApi.extractRelationshipsAndGroupById()
+      expect(extractedRelationships).toEqual({})
+    })
+  })
+
+  describe('dataToObjectById', () => {
+    it('creates an object with the id as key', () => {
+      const data = TestResponse.data.data
+      const object = JsonApi.dataToObjectById({ data })
+      const keys = Object.keys(object)
+      expect(keys.length).toEqual(data.length)
+      expect(object[keys[0]]).toEqual({ id: data[0].id, type: data[0].type, ...data[0].attributes })
+    })
+
+    it('adds the relationships if requested', () => {
+      const data = TestResponse.data.data
+      const object = JsonApi.dataToObjectById({ data, includeRelationships: true })
+      const item = object['1']
+      const keys = Object.keys(item)
+      expect(keys.includes('bean')).toBeTruthy()
+      expect(keys.includes('pickle')).toBeTruthy()
+      expect(keys.includes('chocolates')).toBeTruthy()
+    })
+  })
 })
diff --git a/tests/unit/api/PacbioRun.spec.js b/tests/unit/api/PacbioRun.spec.js
index 691967324..76c301e25 100644
--- a/tests/unit/api/PacbioRun.spec.js
+++ b/tests/unit/api/PacbioRun.spec.js
@@ -1,5 +1,5 @@
 import Vue from 'vue'
-import { mount, Data } from '../testHelper'
+import { mount, Data } from 'testHelper'
 import Request from '@/api/Request'
 import Response from '@/api/Response'
 import * as Run from '@/api/PacbioRun'
@@ -100,6 +100,7 @@ describe('Run', () => {
       expect(well.insert_size).toEqual('')
       expect(well.on_plate_loading_concentration).toEqual('')
       expect(well.libraries).toEqual([])
+      expect(well.pools).toEqual([])
       expect(well.generate_hifi).toEqual('In SMRT Link')
       expect(well.pre_extension_time).toEqual(2)
       expect(well.ccs_analysis_output).toEqual('Yes')
@@ -120,8 +121,8 @@ describe('Run', () => {
     beforeEach(() => {
       run = Run.build()
       run['name'] = 'run1'
-      run.plate.wells[0] = { position: 'A1', libraries: [{ id: 1 }] }
-      run.plate.wells[1] = { position: 'A2', libraries: [{ id: 2 }] }
+      run.plate.wells[0] = { position: 'A1', pools: [{ id: 1 }] }
+      run.plate.wells[1] = { position: 'A2', pools: [{ id: 2 }] }
 
       api = build({ config: Api.Config, environment: process.env })
       pacbioRequest = api.traction.pacbio
@@ -201,13 +202,13 @@ describe('Run', () => {
       expect(resp).toEqual('title The record identified by 100 could not be found.')
     })
 
-    describe('when a well has no libraries', () => {
+    describe('when a well has no pools', () => {
       beforeEach(() => {
         well1 = new Response(Data.PacbioWells).deserialize.wells[0]
         well2 = new Response(Data.PacbioWells).deserialize.wells[1]
 
-        well1['libraries'] = [{ id: 1 }, { id: 2 }]
-        well2['libraries'] = []
+        well1['pools'] = [{ id: 1 }, { id: 2 }]
+        well2['pools'] = []
 
         run = {
           id: '1',
@@ -292,8 +293,8 @@ describe('Run', () => {
     beforeEach(() => {
       run = Run.build()
 
-      run.plate.wells[0] = { position: 'A1', libraries: [{ id: 1 }, { id: 2 }] }
-      run.plate.wells[1] = { position: 'A2', libraries: [{ id: 2 }] }
+      run.plate.wells[0] = { position: 'A1', pools: [{ id: 1 }, { id: 2 }] }
+      run.plate.wells[1] = { position: 'A2', pools: [{ id: 2 }] }
 
       wells = run.plate.wells
       plateID = 1
@@ -322,23 +323,17 @@ describe('Run', () => {
       )
       expect(result.data.attributes.wells[0].relationships.plate.data.type).toEqual('plates')
       expect(result.data.attributes.wells[0].relationships.plate.data.id).toEqual(plateID)
-      expect(result.data.attributes.wells[0].relationships.libraries.data[0].type).toEqual(
-        'libraries',
+      expect(result.data.attributes.wells[0].relationships.pools.data[0].type).toEqual('pools')
+      expect(result.data.attributes.wells[0].relationships.pools.data[0].id).toEqual(
+        wells[0].pools[0].id,
       )
-      expect(result.data.attributes.wells[0].relationships.libraries.data[0].id).toEqual(
-        wells[0].libraries[0].id,
+      expect(result.data.attributes.wells[0].relationships.pools.data[1].type).toEqual('pools')
+      expect(result.data.attributes.wells[0].relationships.pools.data[1].id).toEqual(
+        wells[0].pools[1].id,
       )
-      expect(result.data.attributes.wells[0].relationships.libraries.data[1].type).toEqual(
-        'libraries',
-      )
-      expect(result.data.attributes.wells[0].relationships.libraries.data[1].id).toEqual(
-        wells[0].libraries[1].id,
-      )
-      expect(result.data.attributes.wells[1].relationships.libraries.data[0].type).toEqual(
-        'libraries',
-      )
-      expect(result.data.attributes.wells[1].relationships.libraries.data[0].id).toEqual(
-        wells[1].libraries[0].id,
+      expect(result.data.attributes.wells[1].relationships.pools.data[0].type).toEqual('pools')
+      expect(result.data.attributes.wells[1].relationships.pools.data[0].id).toEqual(
+        wells[1].pools[0].id,
       )
     })
   })
@@ -350,8 +345,8 @@ describe('Run', () => {
       well1 = new Response(Data.PacbioWells).deserialize.wells[0]
       well2 = new Response(Data.PacbioWells).deserialize.wells[1]
 
-      well1['libraries'] = [{ id: 1 }, { id: 2 }]
-      well2['libraries'] = [{ id: 2 }]
+      well1['pools'] = [{ id: 1 }, { id: 2 }]
+      well2['pools'] = [{ id: 2 }]
 
       run = {
         id: '1',
@@ -400,13 +395,13 @@ describe('Run', () => {
       expect(resp).toEqual(['title The record identified by 100 could not be found.'])
     })
 
-    describe('when a well has no libraries', () => {
+    describe('when a well has no pools', () => {
       beforeEach(() => {
         well1 = new Response(Data.PacbioWells).deserialize.wells[0]
         well2 = new Response(Data.PacbioWells).deserialize.wells[1]
 
-        well1['libraries'] = [{ id: 1 }, { id: 2 }]
-        well2['libraries'] = []
+        well1['pools'] = [{ id: 1 }, { id: 2 }]
+        well2['pools'] = []
 
         run = {
           id: '1',
@@ -481,7 +476,7 @@ describe('Run', () => {
 
     beforeEach(() => {
       well = new Response(Data.PacbioWell).deserialize.wells[0]
-      well.libraries = [{ id: 1 }]
+      well.pools = [{ id: 1 }]
     })
 
     it('return run payload', async () => {
@@ -500,8 +495,8 @@ describe('Run', () => {
       expect(result.data.attributes.ccs_analysis_output).toEqual(well.ccs_analysis_output)
       expect(result.data.attributes.pre_extension_time).toEqual(well.pre_extension_time)
       expect(result.data.attributes.ccs_analysis_output).toEqual(well.ccs_analysis_output)
-      expect(result.data.relationships.libraries.data[0].type).toEqual('libraries')
-      expect(result.data.relationships.libraries.data[0].id).toEqual(well.libraries[0].id)
+      expect(result.data.relationships.pools.data[0].type).toEqual('pools')
+      expect(result.data.relationships.pools.data[0].id).toEqual(well.pools[0].id)
     })
   })
 
diff --git a/tests/unit/api/PrintJobRequests.spec.js b/tests/unit/api/PrintJobRequests.spec.js
index 0ebdb99b9..2e6f9e138 100644
--- a/tests/unit/api/PrintJobRequests.spec.js
+++ b/tests/unit/api/PrintJobRequests.spec.js
@@ -1,6 +1,6 @@
 import * as PrintJobRequests from '@/api/PrintJobRequests'
 import moment from 'moment'
-import { store } from '../testHelper'
+import { store } from 'testHelper'
 import Response from '@/api/Response'
 import * as consts from '@/consts/consts'
 
diff --git a/tests/unit/api/Request.spec.js b/tests/unit/api/Request.spec.js
index adbc1efad..6aad67be5 100644
--- a/tests/unit/api/Request.spec.js
+++ b/tests/unit/api/Request.spec.js
@@ -1,5 +1,5 @@
 import Vue from 'vue'
-import { mount } from '../testHelper'
+import { mount } from 'testHelper'
 import Request from '@/api/Request'
 
 const cmp = Vue.extend({
diff --git a/tests/unit/api/ResponseHelper.spec.js b/tests/unit/api/ResponseHelper.spec.js
new file mode 100644
index 000000000..041096e80
--- /dev/null
+++ b/tests/unit/api/ResponseHelper.spec.js
@@ -0,0 +1,142 @@
+import { handleResponse, newResponse } from '@/api/ResponseHelper'
+
+describe('ResponseHelper', () => {
+  describe('createResponse', () => {
+    describe('successful', () => {
+      const rawResponse = {
+        success: true,
+        data: {
+          data: {
+            id: 1,
+            type: 'nice',
+          },
+          status: 200,
+          statusText: 'OK',
+        },
+      }
+
+      it('success', () => {
+        const response = newResponse(rawResponse)
+        expect(response.success).toBeTruthy
+      })
+
+      it('data', () => {
+        const response = newResponse(rawResponse)
+        expect(response.data).toEqual(rawResponse.data)
+      })
+
+      it('errors', () => {
+        const response = newResponse(rawResponse)
+        expect(response.errors).toBeUndefined()
+      })
+    })
+
+    describe('failure with response errors - 422', () => {
+      const rawResponse = {
+        success: false,
+        data: {
+          errors: {
+            error1: ['nasty'],
+            error2: ['broken', 'crushed'],
+          },
+          status: 422,
+          statusText: 'Unprocessible entity',
+        },
+      }
+
+      it('success', () => {
+        const response = newResponse(rawResponse)
+        expect(response.success).toBeFalsy()
+      })
+
+      it('data', () => {
+        const response = newResponse(rawResponse)
+        expect(response.data).toEqual(rawResponse.data)
+      })
+
+      it('errors', () => {
+        const response = newResponse(rawResponse)
+        expect(response.errors).toEqual('error1 nasty, error2 broken, error2 crushed')
+      })
+    })
+
+    describe('failure with response and no errors - 400-500', () => {
+      const rawResponse = {
+        success: false,
+        data: 'There was a serious problem',
+        status: 500,
+        statusText: 'Internal Server Error',
+      }
+
+      it('success', () => {
+        const response = newResponse(rawResponse)
+        expect(response.success).toBeFalsy()
+      })
+
+      it('data', () => {
+        const response = newResponse(rawResponse)
+        expect(response.data).toEqual(rawResponse.data)
+      })
+
+      it('errors', () => {
+        const response = newResponse(rawResponse)
+        expect(response.errors).toEqual('There was a serious problem')
+      })
+    })
+
+    describe('failure without response', () => {
+      const rawResponse = {
+        success: false,
+        error: 'Network error',
+      }
+
+      it('success', () => {
+        const response = newResponse(rawResponse)
+        expect(response.success).toBeFalsy()
+      })
+
+      it('data', () => {
+        const response = newResponse(rawResponse)
+        expect(response.data).toBeUndefined()
+      })
+
+      it('errors', () => {
+        const response = newResponse(rawResponse)
+        expect(response.errors).toEqual('Network error')
+      })
+    })
+  })
+
+  describe('handleResponse', () => {
+    it('successful', async () => {
+      const mockResponse = {
+        data: { data: { id: 1, type: 'love' } },
+        status: 200,
+        statusText: 'OK',
+      }
+      const promise = Promise.resolve(mockResponse)
+      const response = await handleResponse(promise)
+      expect(response.success).toBeTruthy()
+      expect(response.data).toEqual(mockResponse.data)
+    })
+
+    it('failure with response', async () => {
+      const mockResponse = {
+        response: { data: { errors: { error1: ['is', 'a'] } }, status: 422, statusText: 'OK' },
+      }
+      const promise = Promise.reject(mockResponse)
+      const expectedResponse = newResponse({ ...mockResponse.response, success: false })
+      const response = await handleResponse(promise)
+      expect(response.success).toBeFalsy()
+      expect(response.errors).toEqual(expectedResponse.errors)
+    })
+
+    it('failure no response and error', async () => {
+      const error = new Error('rollercoaster')
+      const promise = Promise.reject(error)
+      const response = await handleResponse(promise)
+      expect(response.success).toBeFalsy()
+      expect(response.errors).toEqual(error)
+    })
+  })
+})
diff --git a/tests/unit/api/Run.spec.js b/tests/unit/api/Run.spec.js
index 8d1fe92d2..4657d7b19 100644
--- a/tests/unit/api/Run.spec.js
+++ b/tests/unit/api/Run.spec.js
@@ -1,5 +1,5 @@
 import Vue from 'vue'
-import { mount, Data } from '../testHelper'
+import { mount, Data } from 'testHelper'
 import Request from '@/api/Request'
 import Response from '@/api/Response'
 import * as Run from '@/api/SaphyrRun'
diff --git a/tests/unit/components/Alert.spec.js b/tests/unit/components/Alert.spec.js
index a90a19da2..ea5dc199a 100644
--- a/tests/unit/components/Alert.spec.js
+++ b/tests/unit/components/Alert.spec.js
@@ -1,4 +1,4 @@
-import { mount, localVue } from '../testHelper'
+import { mount, localVue } from 'testHelper'
 import Alert from '@/components/Alert'
 
 describe('Alert.vue', () => {
diff --git a/tests/unit/components/InfoFooter.spec.js b/tests/unit/components/InfoFooter.spec.js
index aa72c3ec9..67e4b6885 100644
--- a/tests/unit/components/InfoFooter.spec.js
+++ b/tests/unit/components/InfoFooter.spec.js
@@ -1,5 +1,5 @@
 import InfoFooter from '@/components/InfoFooter'
-import { localVue, mount } from '../testHelper'
+import { localVue, mount } from 'testHelper'
 
 describe('InfoFooter.vue', () => {
   let wrapper
diff --git a/tests/unit/components/PrinterModal.spec.js b/tests/unit/components/PrinterModal.spec.js
index 257e17606..d2676f9dc 100644
--- a/tests/unit/components/PrinterModal.spec.js
+++ b/tests/unit/components/PrinterModal.spec.js
@@ -1,4 +1,4 @@
-import { mount, localVue, store } from '../testHelper'
+import { mount, localVue, store } from 'testHelper'
 import PrinterModal from '@/components/PrinterModal'
 
 describe('Modal.vue', () => {
diff --git a/tests/unit/components/ont/OntFlowcell.spec.js b/tests/unit/components/ont/OntFlowcell.spec.js
index ae733b956..4a086ce56 100644
--- a/tests/unit/components/ont/OntFlowcell.spec.js
+++ b/tests/unit/components/ont/OntFlowcell.spec.js
@@ -1,5 +1,5 @@
 import OntFlowcell from '@/components/ont/OntFlowcell'
-import { localVue, mount } from '../../testHelper'
+import { localVue, mount } from 'testHelper'
 
 describe('OntFlowcell.vue', () => {
   let flowcell, wrapper, props, mutate
diff --git a/tests/unit/components/ont/OntPlate.spec.js b/tests/unit/components/ont/OntPlate.spec.js
index 81f9f30e1..339f18697 100644
--- a/tests/unit/components/ont/OntPlate.spec.js
+++ b/tests/unit/components/ont/OntPlate.spec.js
@@ -1,6 +1,6 @@
 import OntPlate from '@/components/ont/OntPlate'
 import PlateMap from '@/config/PlateMap'
-import { localVue, mount } from '../../testHelper'
+import { localVue, mount } from 'testHelper'
 
 describe('OntPlate.vue', () => {
   let wrapper, plate, wellsData, mutate
@@ -57,7 +57,7 @@ describe('OntPlate.vue', () => {
   describe('methods', () => {
     describe('#getWellAt', () => {
       it('gets the well at the given position', () => {
-        let expected = wellsData.filter((w) => w.position == 'A1')[0]
+        let expected = wellsData.find((w) => w.position == 'A1')
         expect(plate.getWellAt('A1')).toEqual(expected)
       })
 
diff --git a/tests/unit/components/ont/OntRunLibrariesList.spec.js b/tests/unit/components/ont/OntRunLibrariesList.spec.js
index 320927413..9f3e1ba8e 100644
--- a/tests/unit/components/ont/OntRunLibrariesList.spec.js
+++ b/tests/unit/components/ont/OntRunLibrariesList.spec.js
@@ -1,5 +1,5 @@
 import OntRunLibrariesList from '@/components/ont/OntRunLibrariesList'
-import { localVue, mount } from '../../testHelper'
+import { localVue, mount } from 'testHelper'
 
 describe('OntLibraries.vue', () => {
   let wrapper, librariesData, props, librariesList, query, mutate
diff --git a/tests/unit/components/ont/OntTube.spec.js b/tests/unit/components/ont/OntTube.spec.js
index 1f86e9c30..66793cb55 100644
--- a/tests/unit/components/ont/OntTube.spec.js
+++ b/tests/unit/components/ont/OntTube.spec.js
@@ -1,4 +1,4 @@
-import { mount, localVue } from '../../testHelper'
+import { mount, localVue } from 'testHelper'
 import OntTube from '@/components/ont/OntTube'
 
 describe('OntTube.vue', () => {
diff --git a/tests/unit/components/ont/OntWell.spec.js b/tests/unit/components/ont/OntWell.spec.js
index 4d676047b..7d1199559 100644
--- a/tests/unit/components/ont/OntWell.spec.js
+++ b/tests/unit/components/ont/OntWell.spec.js
@@ -1,5 +1,5 @@
 import OntWell from '@/components/ont/OntWell'
-import { mount } from '../../testHelper'
+import { mount } from 'testHelper'
 
 describe('OntWell.vue', () => {
   let well, wrapper, props
diff --git a/tests/unit/components/pacbio/PacbioLabwareFind.spec.js b/tests/unit/components/pacbio/PacbioLabwareFind.spec.js
new file mode 100644
index 000000000..49d544a5b
--- /dev/null
+++ b/tests/unit/components/pacbio/PacbioLabwareFind.spec.js
@@ -0,0 +1,53 @@
+import { mount, localVue, store, Data } from 'testHelper'
+import PacbioLabwareFind from '@/components/pacbio/PacbioLabwareFind'
+import Response from '@/api/Response'
+
+describe('PacbioLabwareFind', () => {
+  let wrapper, mockPlates
+
+  beforeEach(() => {
+    mockPlates = new Response(Data.PacbioPlates)._body.data
+    store.commit('traction/pacbio/poolCreate/populatePlates', mockPlates)
+
+    wrapper = mount(PacbioLabwareFind, {
+      localVue,
+      store,
+    })
+  })
+
+  it('will have a form', () => {
+    expect(wrapper.find('.labware-list')).toBeDefined()
+  })
+
+  it('contains the correct data', () => {
+    expect(wrapper.find('.list-group').findAll('.list-group-item').length).toEqual(2)
+  })
+
+  it('filters the list when the input is entered', () => {
+    wrapper.vm.enteredLabware = 'DN1'
+    wrapper.vm.$nextTick(() => {
+      expect(wrapper.find('.list-group').findAll('.list-group-item').length).toEqual(1)
+    })
+  })
+
+  describe('Handle submit', () => {
+    it('handleSubmit calls mutation when enteredLabware is an existing plate barcode', () => {
+      wrapper.vm.toggleSelected = jest.fn()
+      wrapper.setData({ enteredLabware: 'DN1' })
+      wrapper.vm.handleSubmit()
+      expect(wrapper.vm.toggleSelected).toBeCalled()
+    })
+
+    it('handleSubmit calls mutation when enteredLabware is an existing plate barcode', () => {
+      wrapper.vm.setSelected = jest.fn()
+      wrapper.vm.showAlert = jest.fn()
+      wrapper.setData({ enteredLabware: 'Not a plate Barcode' })
+      wrapper.vm.handleSubmit()
+      expect(wrapper.vm.setSelected).not.toBeCalled()
+      expect(wrapper.vm.showAlert).toBeCalledWith(
+        'Unable to find a plate with the barcode: Not a plate Barcode',
+        'danger',
+      )
+    })
+  })
+})
diff --git a/tests/unit/components/pacbio/PacbioLabwareSelectedList.spec.js b/tests/unit/components/pacbio/PacbioLabwareSelectedList.spec.js
new file mode 100644
index 000000000..b413d84da
--- /dev/null
+++ b/tests/unit/components/pacbio/PacbioLabwareSelectedList.spec.js
@@ -0,0 +1,61 @@
+import { mount, localVue, store, Data } from 'testHelper'
+import PacbioLabwareSelectedList from '@/components/pacbio/PacbioLabwareSelectedList'
+import Response from '@/api/Response'
+
+describe('PacbioLabwareSelectedList', () => {
+  let wrapper, mockPlates
+
+  beforeEach(() => {
+    const responseBody = new Response(Data.PacbioPlatesRequest)._body
+    mockPlates = responseBody.data
+    const mockWells = responseBody.included.slice(0, 4)
+    store.commit('traction/pacbio/poolCreate/populatePlates', mockPlates)
+    store.commit('traction/pacbio/poolCreate/populateWells', mockWells)
+
+    wrapper = mount(PacbioLabwareSelectedList, {
+      localVue,
+
+      store,
+      stubs: {
+        Plate: true,
+      },
+    })
+  })
+
+  it('will have a form', () => {
+    expect(wrapper.find('.selected-list-group')).toBeDefined()
+  })
+
+  it('contains only a no plates selected item when no plates have been selected', () => {
+    expect(wrapper.find('[data-type=warning-message]').text()).toEqual('No plates selected')
+    expect(wrapper.findAll('[data-type=warning-message]').length).toEqual(1)
+  })
+
+  describe('Plate selection', () => {
+    beforeEach(() => {
+      let selectPlate = { id: '61', selected: true }
+      store.commit('traction/pacbio/poolCreate/selectPlate', selectPlate)
+    })
+
+    it('contains the selected plate', () => {
+      expect(wrapper.find('[data-type=selected-plate-item]').text()).toContain('DN814327C')
+      expect(wrapper.findAll('plate-stub').length).toEqual(1)
+    })
+  })
+
+  describe('Plate@clickWell', () => {
+    beforeEach(() => {
+      let selectPlate = { id: '61', selected: true }
+      store.commit('traction/pacbio/poolCreate/selectPlate', selectPlate)
+    })
+
+    it('selects the requests associated with the well', async () => {
+      const dispatch = jest.fn()
+      store.dispatch = dispatch
+      const plate = wrapper.find('plate-stub')
+      await plate.vm.$emit('clickWell', '1')
+
+      expect(dispatch).toHaveBeenCalledWith('traction/pacbio/poolCreate/selectWellRequests', '1')
+    })
+  })
+})
diff --git a/tests/unit/components/pacbio/PacbioLibraryCreate.spec.js b/tests/unit/components/pacbio/PacbioLibraryCreate.spec.js
index 5d486a267..543785aad 100644
--- a/tests/unit/components/pacbio/PacbioLibraryCreate.spec.js
+++ b/tests/unit/components/pacbio/PacbioLibraryCreate.spec.js
@@ -1,4 +1,4 @@
-import { mount, localVue, store, Data } from '../../testHelper'
+import { mount, localVue, store, Data } from 'testHelper'
 import PacbioLibraryCreate from '@/components/pacbio/PacbioLibraryCreate'
 import Response from '@/api/Response'
 import * as consts from '@/consts/consts'
diff --git a/tests/unit/components/pacbio/PacbioLibraryEdit.spec.js b/tests/unit/components/pacbio/PacbioLibraryEdit.spec.js
index b1b03a0d9..6c3f0ea2d 100644
--- a/tests/unit/components/pacbio/PacbioLibraryEdit.spec.js
+++ b/tests/unit/components/pacbio/PacbioLibraryEdit.spec.js
@@ -1,6 +1,6 @@
 import Response from '@/api/Response'
 import PacbioLibraryEdit from '@/components/pacbio/PacbioLibraryEdit'
-import { Data, localVue, mount, store } from '../../testHelper'
+import { Data, localVue, mount, store } from 'testHelper'
 
 describe('PacbioLibraryEdit.vue', () => {
   let wrapper, modal, props, mockLibrary
diff --git a/tests/unit/components/pacbio/PacbioLibraryList.spec.js b/tests/unit/components/pacbio/PacbioLibraryList.spec.js
deleted file mode 100644
index 696c3ca25..000000000
--- a/tests/unit/components/pacbio/PacbioLibraryList.spec.js
+++ /dev/null
@@ -1,27 +0,0 @@
-import { mount, localVue } from '../../testHelper'
-import PacbioLibraryList from '@/components/pacbio/PacbioLibraryList'
-import storeLibraries from '../../../data/StoreLibraries'
-import store from '@/store'
-
-describe('PacbioLibraryList', () => {
-  let wrapper, libraries
-
-  beforeEach(() => {
-    libraries = storeLibraries
-
-    store.commit('traction/pacbio/libraries/setLibraries', libraries)
-
-    wrapper = mount(PacbioLibraryList, {
-      localVue,
-      store,
-    })
-  })
-
-  it('will have a table', () => {
-    expect(wrapper.find('.libraries')).toBeDefined()
-  })
-
-  it('contains the correct data', () => {
-    expect(wrapper.find('.list-group').findAll('.list-group-item').length).toEqual(5)
-  })
-})
diff --git a/tests/unit/components/pacbio/PacbioLibraryTagEdit.spec.js b/tests/unit/components/pacbio/PacbioLibraryTagEdit.spec.js
index 6e0054112..a3fc6d13d 100644
--- a/tests/unit/components/pacbio/PacbioLibraryTagEdit.spec.js
+++ b/tests/unit/components/pacbio/PacbioLibraryTagEdit.spec.js
@@ -1,4 +1,4 @@
-import { mount, localVue, store } from '../../testHelper'
+import { mount, localVue, store } from 'testHelper'
 import PacbioLibraryTagEdit from '@/components/pacbio/PacbioLibraryTagEdit'
 
 describe('PacbioLibraryTagEdit.vue', () => {
diff --git a/tests/unit/components/pacbio/PacbioLibraryTubeItem.spec.js b/tests/unit/components/pacbio/PacbioLibraryTubeItem.spec.js
deleted file mode 100644
index 78a6e995a..000000000
--- a/tests/unit/components/pacbio/PacbioLibraryTubeItem.spec.js
+++ /dev/null
@@ -1,32 +0,0 @@
-import Tube from '@/components/pacbio/PacbioLibraryTubeItem'
-import { localVue, mount } from '../../testHelper'
-
-describe('LibraryTubeItem.vue', () => {
-  let tube, wrapper, props
-
-  beforeEach(() => {
-    props = { barcode: 'TRAC-1', sample_name: 'Sample1', tag_group_id: '1' }
-
-    wrapper = mount(Tube, {
-      localVue,
-      propsData: props,
-    })
-
-    tube = wrapper.vm
-  })
-
-  it('must have a barcode', () => {
-    expect(tube.barcode).toEqual(props.barcode)
-    expect(wrapper.find('.barcode').text()).toEqual(props.barcode)
-  })
-
-  it('must have some sample names', () => {
-    expect(tube.sample_name).toEqual(props.sample_name)
-    expect(wrapper.find('.sample_name').text()).toEqual(props.sample_name)
-  })
-
-  it('must have some tag group ids', () => {
-    expect(tube.tag_group_id).toEqual(props.tag_group_id)
-    expect(wrapper.find('.tag_group_id').text()).toEqual(props.tag_group_id)
-  })
-})
diff --git a/tests/unit/components/pacbio/PacbioPlateItem.spec.js b/tests/unit/components/pacbio/PacbioPlateItem.spec.js
new file mode 100644
index 000000000..8e37a8e17
--- /dev/null
+++ b/tests/unit/components/pacbio/PacbioPlateItem.spec.js
@@ -0,0 +1,92 @@
+import Plate from '@/components/pacbio/PacbioPlateItem'
+import { localVue, mount, store } from 'testHelper'
+
+const plates = {
+  '1': {
+    barcode: 'DN1',
+    id: '1',
+    type: 'plates',
+    wells: ['1', '2', '3'],
+  },
+}
+
+const wells = {
+  '1': { id: '1', position: 'A1' },
+  '2': { id: '2', position: 'B1' },
+  '3': { id: '3', position: 'C1' },
+  '4': { id: '4', position: 'D1' },
+  '5': { id: '5', position: 'E1' },
+}
+
+describe('Plate.vue', () => {
+  let wrapper, plate
+
+  beforeEach(() => {
+    store.state.traction.pacbio.poolCreate.resources.plates = plates
+    store.state.traction.pacbio.poolCreate.resources.wells = wells
+
+    wrapper = mount(Plate, {
+      localVue,
+      propsData: { ...plates['1'] },
+      store,
+      stubs: {
+        Plate96SVG: true,
+        Well: true,
+      },
+    })
+
+    plate = wrapper.vm
+  })
+
+  it('will be passed a plate id as a prop', () => {
+    expect(plate.id).toBeDefined()
+  })
+
+  it('will have a plate map', () => {
+    expect(plate.plateMap).toBeDefined()
+  })
+
+  it('will have some well data', () => {
+    expect(plate.wellData).toEqual([wells[1], wells[2], wells[3]])
+  })
+
+  describe('methods', () => {
+    describe('#getWellAt', () => {
+      it('merges mapWell and well at the given position ', () => {
+        const mapWell = plate.plateMap.wells['A1']
+        expect(plate.getWellAt(mapWell, 'A1').id).toEqual('1')
+      })
+
+      it('returns just the mapWell if no well has the positiion', () => {
+        const mapWell = plate.plateMap.wells['A10']
+        expect(plate.getWellAt(mapWell, 'A10')).toEqual(mapWell)
+      })
+    })
+  })
+
+  describe('components', () => {
+    it('has a Well component', () => {
+      expect(wrapper.findComponent({ ref: 'well' })).toBeTruthy()
+    })
+
+    it('has a Plate96SVG component', () => {
+      expect(wrapper.findComponent({ ref: 'plate96Svg' })).toBeTruthy()
+    })
+  })
+
+  describe('SVG wells', () => {
+    it('has the correct number of wells', () => {
+      let ellipses = wrapper.findAllComponents({ ref: 'well' })
+      expect(ellipses.length).toEqual(Object.keys(store.state.plateMap.wells).length)
+    })
+  })
+
+  describe('well@click', () => {
+    it('emits a clickWell event with the well id', async () => {
+      const well = wrapper.find('well-stub')
+      await well.vm.$emit('click')
+      expect(wrapper.emitted().clickWell.length).toBe(1)
+      expect(wrapper.emitted().clickWell[0]).toEqual(['1'])
+    })
+  })
+})
diff --git a/tests/unit/components/pacbio/PacbioPoolLibraryEdit.spec.js b/tests/unit/components/pacbio/PacbioPoolLibraryEdit.spec.js
new file mode 100644
index 000000000..67815a7b6
--- /dev/null
+++ b/tests/unit/components/pacbio/PacbioPoolLibraryEdit.spec.js
@@ -0,0 +1,197 @@
+import PacbioPoolLibraryEdit from '@/components/pacbio/PacbioPoolLibraryEdit'
+import { mount, store, localVue } from 'testHelper'
+import { newLibrary } from '@/store/traction/pacbio/poolCreate/libraries.js'
+
+const request = {
+  id: '1',
+  sample_name: 'Sample1',
+  source_identifier: 'DN1:A1',
+}
+
+const tagSet = {
+  id: '1',
+  name: 'TagSet1',
+  tags: ['1', '2', '3'],
+}
+
+const tags = {
+  1: { id: '1', group_id: 'tag1' },
+  2: { id: '2', group_id: 'tag2' },
+  3: { id: '3', group_id: 'tag3' },
+}
+
+const library = newLibrary({ pacbio_request_id: '1' })
+
+// TODO: The tag list would probably better done using a separate component and an emit
+// but that is a bigger job
+describe('PacbioPoolLibraryEdit.vue', () => {
+  let wrapper
+
+  beforeEach(() => {
+    store.state.traction.pacbio.poolCreate.resources.tagSets = { 1: tagSet }
+    store.state.traction.pacbio.poolCreate.resources.tags = tags
+    store.state.traction.pacbio.poolCreate.selected.tagSet = { id: tagSet.id }
+  })
+
+  describe('valid', () => {
+    beforeEach(() => {
+      store.state.traction.pacbio.poolCreate.libraries = { _1: library }
+
+      wrapper = mount(PacbioPoolLibraryEdit, {
+        store,
+        localVue,
+        propsData: {
+          id: 1,
+          request,
+        },
+      })
+    })
+
+    it('will have a request', () => {
+      expect(wrapper.vm.request).toEqual(request)
+    })
+
+    it('will have a sample name', () => {
+      expect(wrapper.find('[data-attribute=request-sample-name]').text()).toEqual('Sample1')
+    })
+
+    it('will have a source identifier', () => {
+      expect(wrapper.find('[data-attribute=request-source-identifier]').text()).toEqual('DN1:A1')
+    })
+
+    it('will have an id', () => {
+      expect(wrapper.vm.id).toEqual(1)
+    })
+
+    it('will have a list of tags', () => {
+      expect(wrapper.find('[data-type=tag-list]').findAll('option').length).toEqual(
+        // will also include null value
+        tagSet.tags.length + 1,
+      )
+    })
+
+    it('each tag option will have some text', () => {
+      expect(wrapper.vm.tagListOptions[1].text).not.toBeNull()
+    })
+
+    describe('when the user selects a tag', () => {
+      it('will updated the tag_id', async () => {
+        const options = wrapper.find('[data-type=tag-list]').findAll('option')
+        await options.at(1).setSelected()
+        // expect(wrapper.vm.tag_id).toEqual('1')
+        expect(store.state.traction.pacbio.poolCreate.libraries['_1'].tag_id).toEqual('1')
+      })
+    })
+
+    describe('update', () => {
+      it('will update the library', () => {})
+    })
+
+    describe('input', () => {
+      it('template prep kit box barcode id', async () => {
+        const input = wrapper.find('[data-attribute=template-prep-kit-box-barcode]')
+        await input.setValue('017865101789500022821')
+        expect(
+          store.state.traction.pacbio.poolCreate.libraries['_1'].template_prep_kit_box_barcode,
+        ).toEqual('017865101789500022821')
+      })
+
+      it('volume', async () => {
+        const input = wrapper.find('[data-attribute=volume]')
+        await input.setValue('10.0')
+        expect(store.state.traction.pacbio.poolCreate.libraries['_1'].volume).toEqual('10.0')
+      })
+
+      it('concentration', async () => {
+        const input = wrapper.find('[data-attribute=concentration]')
+        await input.setValue('2.4')
+        expect(store.state.traction.pacbio.poolCreate.libraries['_1'].concentration).toEqual('2.4')
+      })
+
+      it('fragment size', async () => {
+        const input = wrapper.find('[data-attribute=fragment-size]')
+        await input.setValue('100')
+        expect(store.state.traction.pacbio.poolCreate.libraries['_1'].fragment_size).toEqual('100')
+      })
+    })
+  })
+
+  describe('invalid', () => {
+    const propsData = {
+      id: 1,
+      request,
+    }
+
+    it('tag id', () => {
+      store.state.traction.pacbio.poolCreate.libraries = {
+        _1: { ...library, errors: { tag_id: 'must be present' } },
+      }
+
+      wrapper = mount(PacbioPoolLibraryEdit, {
+        store,
+        localVue,
+        propsData,
+      })
+
+      expect(wrapper.find('[data-attribute=tag-id-error]').text()).toEqual('must be present')
+    })
+
+    it('template prep kit box barcode id', () => {
+      store.state.traction.pacbio.poolCreate.libraries = {
+        _1: { ...library, errors: { template_prep_kit_box_barcode: 'must be present' } },
+      }
+
+      wrapper = mount(PacbioPoolLibraryEdit, {
+        store,
+        localVue,
+        propsData,
+      })
+
+      expect(wrapper.find('[data-attribute=template-prep-kit-box-barcode-error]').text()).toEqual(
+        'must be present',
+      )
+    })
+
+    it('volume', () => {
+      store.state.traction.pacbio.poolCreate.libraries = {
+        _1: { ...library, errors: { volume: 'must be present' } },
+      }
+
+      wrapper = mount(PacbioPoolLibraryEdit, {
+        store,
+        localVue,
+        propsData,
+      })
+
+      expect(wrapper.find('[data-attribute=volume-error]').text()).toEqual('must be present')
+    })
+
+    it('concentration', () => {
+      store.state.traction.pacbio.poolCreate.libraries = {
+        _1: { ...library, errors: { concentration: 'must be present' } },
+      }
+
+      wrapper = mount(PacbioPoolLibraryEdit, {
+        store,
+        localVue,
+        propsData,
+      })
+
+      expect(wrapper.find('[data-attribute=concentration-error]').text()).toEqual('must be present')
+    })
+
+    it('fragment size', () => {
+      store.state.traction.pacbio.poolCreate.libraries = {
+        _1: { ...library, errors: { fragment_size: 'must be present' } },
+      }
+
+      wrapper = mount(PacbioPoolLibraryEdit, {
+        store,
+        localVue,
+        propsData,
+      })
+
+      expect(wrapper.find('[data-attribute=fragment-size-error]').text()).toEqual('must be present')
+    })
+  })
+})
diff --git a/tests/unit/components/pacbio/PacbioPoolLibraryList.spec.js b/tests/unit/components/pacbio/PacbioPoolLibraryList.spec.js
new file mode 100644
index 000000000..8a85f4a20
--- /dev/null
+++ b/tests/unit/components/pacbio/PacbioPoolLibraryList.spec.js
@@ -0,0 +1,103 @@
+import PacbioPoolLibraryList from '@/components/pacbio/PacbioPoolLibraryList'
+import { mount, store, localVue } from 'testHelper'
+
+const libraryAttributes = {
+  template_prep_kit_box_barcode: 'ABC1',
+  tag_id: '1',
+  volume: '1.0',
+  concentration: '10.0',
+  fragment_size: '100',
+}
+
+const requests = {
+  '1': { id: 1 },
+  '2': { id: 2 },
+  '3': { id: 3 },
+}
+
+const libraries = {
+  _1: { pacbio_request_id: '1', ...libraryAttributes },
+  _2: { pacbio_request_id: '2', ...libraryAttributes, tag_id: '2' },
+  _3: { pacbio_request_id: '3', ...libraryAttributes, tag_id: '3' },
+}
+
+// TODO: This is a definite smell. We should not need this here.
+const tagSet = {
+  id: '1',
+  name: 'TagSet1',
+  tags: ['1', '2', '3'],
+}
+
+const tags = {
+  1: { id: '1', name: 'tag1' },
+  2: { id: '2', name: 'tag2' },
+  3: { id: '3', name: 'tag3' },
+}
+
+store.state.traction.pacbio.poolCreate.selected.tagSet = tagSet
+store.state.traction.pacbio.poolCreate.resources.tagSets = { 1: tagSet }
+store.state.traction.pacbio.poolCreate.resources.tags = tags
+store.state.traction.pacbio.poolCreate.resources.requests = requests
+
+describe('PacbioPoolLibraryList.vue', () => {
+  it('should have a list of libraries', () => {
+    store.state.traction.pacbio.poolCreate.libraries = libraries
+    const wrapper = mount(PacbioPoolLibraryList, {
+      store,
+      localVue,
+    })
+    expect(wrapper.findAll('[data-type=pool-library-edit]').length).toEqual(
+      Object.values(libraries).length,
+    )
+  })
+
+  describe('pooling message', () => {
+    describe('when pool creation is successful', () => {
+      const result = { success: true, message: 'Pool successfully created' }
+
+      it('message', () => {
+        store.state.traction.pacbio.poolCreate.result = result
+        const wrapper = mount(PacbioPoolLibraryList, {
+          store,
+          localVue,
+        })
+        const message = wrapper.find('[data-type=pool-create-message]')
+        expect(message.text()).toMatch('Pool successfully created')
+      })
+
+      it('alert variant', () => {
+        store.state.traction.pacbio.poolCreate.result = result
+        const wrapper = mount(PacbioPoolLibraryList, {
+          store,
+          localVue,
+        })
+        const message = wrapper.find('[data-type=pool-create-message]')
+        expect(message.html()).toMatch('alert-success')
+      })
+    })
+
+    describe('when pool creation fails', () => {
+      const result = { success: false, message: 'There was a problem' }
+
+      it('message', () => {
+        store.state.traction.pacbio.poolCreate.result = result
+        const wrapper = mount(PacbioPoolLibraryList, {
+          store,
+          localVue,
+        })
+        const message = wrapper.find('[data-type=pool-create-message]')
+        expect(message.text()).toMatch('There was a problem')
+      })
+
+      it('alert variant', () => {
+        store.state.traction.pacbio.poolCreate.result = result
+        const wrapper = mount(PacbioPoolLibraryList, {
+          store,
+          localVue,
+        })
+        const message = wrapper.find('[data-type=pool-create-message]')
+        expect(message.html()).toMatch('alert-danger')
+      })
+    })
+  })
+})
diff --git a/tests/unit/components/pacbio/PacbioPoolList.spec.js b/tests/unit/components/pacbio/PacbioPoolList.spec.js
new file mode 100644
index 000000000..2137bf077
--- /dev/null
+++ b/tests/unit/components/pacbio/PacbioPoolList.spec.js
@@ -0,0 +1,35 @@
+import { mount, localVue, store } from 'testHelper'
+import pacbioPoolList from '@/components/pacbio/PacbioPoolList'
+import storePools from '@tests/data/StorePools'
+
+describe('pacbioPoolList', () => {
+  let wrapper
+
+  beforeEach(() => {
+    store.state.traction.pacbio.pools = storePools
+
+    wrapper = mount(pacbioPoolList, {
+      localVue,
+      store,
+    })
+  })
+
+  it('will have a table', () => {
+    expect(wrapper.find('.pools')).toBeDefined()
+  })
+
+  it('contains the correct data', () => {
+    expect(wrapper.find('.list-group').findAll('.list-group-item').length).toEqual(2)
+  })
+
+  describe('when there is an error', () => {
+    beforeEach(() => {
+      wrapper.vm.showAlert('Bad stuff happened', 'danger')
+    })
+
+    it('should show an appropriate message', () => {
+      const errorMessage = wrapper.find('[data-type=error-message]')
+      expect(errorMessage.text()).toMatch('Bad stuff happened')
+    })
+  })
+})
diff --git a/tests/unit/components/pacbio/PacbioPoolTubeItem.spec.js b/tests/unit/components/pacbio/PacbioPoolTubeItem.spec.js
new file mode 100644
index 000000000..baf94df62
--- /dev/null
+++ b/tests/unit/components/pacbio/PacbioPoolTubeItem.spec.js
@@ -0,0 +1,29 @@
+import Tube from '@/components/pacbio/PacbioPoolTubeItem'
+import { localVue, mount } from 'testHelper'
+
+describe('LibraryTubeItem.vue', () => {
+  let tube, wrapper, props
+
+  beforeEach(() => {
+    props = {
+      barcode: 'TRAC-1',
+      libraries: [{ id: '1', sample_name: 'Sample1', group_id: 'TAG_1' }],
+    }
+
+    wrapper = mount(Tube, {
+      localVue,
+      propsData: props,
+    })
+
+    tube = wrapper.vm
+  })
+
+  it('must have a barcode', () => {
+    expect(tube.barcode).toEqual(props.barcode)
+    expect(wrapper.find('.barcode').text()).toContain(props.barcode)
+  })
+
+  it('must have some libraries', () => {
+    expect(tube.libraries).toEqual(props.libraries)
+  })
+})
diff --git a/tests/unit/components/pacbio/PacbioRunInfoEdit.spec.js b/tests/unit/components/pacbio/PacbioRunInfoEdit.spec.js
index cdc8c82a8..7fe807363 100644
--- a/tests/unit/components/pacbio/PacbioRunInfoEdit.spec.js
+++ b/tests/unit/components/pacbio/PacbioRunInfoEdit.spec.js
@@ -1,6 +1,6 @@
 import * as Run from '@/api/PacbioRun'
 import PacbioRunInfoEdit from '@/components/pacbio/PacbioRunInfoEdit'
-import { localVue, mount, store } from '../../testHelper'
+import { localVue, mount, store } from 'testHelper'
 
 describe('PacbioRunInfoEdit', () => {
   let wrapper, runInfo, run
diff --git a/tests/unit/components/pacbio/PacbioRunPlateItem.spec.js b/tests/unit/components/pacbio/PacbioRunPlateItem.spec.js
index 320e331ea..05c90c4e3 100644
--- a/tests/unit/components/pacbio/PacbioRunPlateItem.spec.js
+++ b/tests/unit/components/pacbio/PacbioRunPlateItem.spec.js
@@ -1,4 +1,4 @@
-import { mount, localVue, store } from '../../testHelper'
+import { mount, localVue, store } from 'testHelper'
 import Plate from '@/components/pacbio/PacbioRunPlateItem'
 import * as Run from '@/api/PacbioRun'
 import PlateMap from '@/config/PlateMap'
diff --git a/tests/unit/components/pacbio/PacbioRunWellEdit.spec.js b/tests/unit/components/pacbio/PacbioRunWellEdit.spec.js
index 5b837949e..21351636c 100644
--- a/tests/unit/components/pacbio/PacbioRunWellEdit.spec.js
+++ b/tests/unit/components/pacbio/PacbioRunWellEdit.spec.js
@@ -1,5 +1,6 @@
-import { mount, localVue, store } from '../../testHelper'
+import { mount, localVue, store } from 'testHelper'
 import WellEdit from '@/components/pacbio/PacbioRunWellEdit'
+import storePools from '@tests/data/StorePools'
 import * as Run from '@/api/PacbioRun'
 
 describe('PacbioWellModal', () => {
@@ -9,7 +10,7 @@ describe('PacbioWellModal', () => {
     props = { row: 'A', column: '1', position: 'A1' }
 
     storeWell = Run.buildWell(props.row, props.column, 'In SMRT Link')
-    storeWell.libraries = [{ tube: { barcode: 'TRAC-0' } }]
+    storeWell.pools = [{ id: 1, barcode: 'TRAC-0' }]
 
     run = Run.build()
     run.plate.wells[0] = storeWell
@@ -64,7 +65,7 @@ describe('PacbioWellModal', () => {
     expect(modal.insertSize).toBeDefined()
     expect(modal.onPlateLoadingConc).toBeDefined()
     expect(modal.movieTime).toBeDefined()
-    expect(modal.wellLibraries).toBeDefined()
+    expect(modal.wellPools).toBeDefined()
     expect(modal.generateHiFi).toBeDefined()
     expect(modal.ccsAnalysisOutput).toBeDefined()
     expect(modal.preExtensionTime).toBeDefined()
@@ -77,8 +78,8 @@ describe('PacbioWellModal', () => {
 
   // TODO: check below tests are they are buggy and return ErrorWrapper
   describe('form inputs', () => {
-    it('has a Library Barcode input', () => {
-      expect(wrapper.find('.libraryBarcode')).toBeDefined()
+    it('has a Pool Barcode input', () => {
+      expect(wrapper.find('.poolBarcode')).toBeDefined()
     })
     it('has a Movie Time input', () => {
       expect(wrapper.find('.movieTime')).toBeDefined()
@@ -95,8 +96,8 @@ describe('PacbioWellModal', () => {
     it('has a CCS Analysis Output input', () => {
       expect(wrapper.find('.ccsAnalysisOutput')).toBeDefined()
     })
-    it('has a table of well libraries', () => {
-      expect(wrapper.find('#wellLibraries')).toBeDefined()
+    it('has a table of well pools', () => {
+      expect(wrapper.find('#wellPools')).toBeDefined()
     })
     it('has a pre-extension time input', () => {
       expect(wrapper.find('.preExtensionTime')).toBeDefined()
@@ -193,39 +194,39 @@ describe('PacbioWellModal', () => {
       })
     })
 
-    describe('updateLibraryBarcode', () => {
-      let newBarcode, row, anIndex, library
+    describe('updatePoolBarcode', () => {
+      let newBarcode, row, anIndex, poolId
 
       beforeEach(() => {
-        newBarcode = 'TRAC-1'
+        newBarcode = 'TRAC-2-1'
         anIndex = 1
         row = { index: anIndex }
         modal.showAlert = jest.fn()
-        modal.isLibraryBarcodeValid = jest.fn()
-        modal.addLibraryToWell = jest.fn()
-        library = { id: 1, tube: { barcode: newBarcode } }
-        store.commit('traction/pacbio/libraries/setLibraries', [library])
+        modal.isPoolBarcodeValid = jest.fn()
+        modal.addPoolToWell = jest.fn()
+        poolId = '1'
+        store.state.traction.pacbio.pools = storePools
       })
 
       it('successful when barcode is valid', async () => {
-        modal.isLibraryBarcodeValid.mockReturnValue(true)
+        modal.isPoolBarcodeValid.mockReturnValue(true)
 
-        await modal.updateLibraryBarcode(row, newBarcode)
+        await modal.updatePoolBarcode(row, newBarcode)
 
-        expect(modal.addLibraryToWell).toBeCalledWith({
+        expect(modal.addPoolToWell).toBeCalledWith({
           index: anIndex,
           position: props.position,
-          with: { id: library.id, barcode: library.tube.barcode },
+          with: { id: poolId, barcode: newBarcode },
         })
-        expect(modal.showAlert).toBeCalledWith('Library is valid', 'success')
+        expect(modal.showAlert).toBeCalledWith('Pool is valid', 'success')
       })
 
       it('is unsuccessful when barcode is not valid', async () => {
-        modal.isLibraryBarcodeValid.mockReturnValue(false)
+        modal.isPoolBarcodeValid.mockReturnValue(false)
 
-        await modal.updateLibraryBarcode(newBarcode)
-        expect(modal.addLibraryToWell).not.toBeCalled()
-        expect(modal.showAlert).toBeCalledWith('Library is not valid', 'danger')
+        await modal.updatePoolBarcode(newBarcode)
+        expect(modal.addPoolToWell).not.toBeCalled()
+        expect(modal.showAlert).toBeCalledWith('Pool is not valid', 'danger')
       })
     })
 
diff --git a/tests/unit/components/pacbio/PacbioRunWellItem.spec.js b/tests/unit/components/pacbio/PacbioRunWellItem.spec.js
index b99cde9ff..9b5fee15c 100644
--- a/tests/unit/components/pacbio/PacbioRunWellItem.spec.js
+++ b/tests/unit/components/pacbio/PacbioRunWellItem.spec.js
@@ -1,6 +1,6 @@
 import * as Run from '@/api/PacbioRun'
 import Well from '@/components/pacbio/PacbioRunWellItem'
-import { localVue, mount, store } from '../../testHelper'
+import { localVue, mount, store } from 'testHelper'
 
 describe('Well.vue', () => {
   let well, wrapper, props, storeWell, run
@@ -16,9 +16,9 @@ describe('Well.vue', () => {
     }
 
     storeWell = Run.buildWell(props.row, props.column, 'In SMRT Link', '2', '')
-    storeWell.libraries = [
-      { id: 1, tube: { barcode: 'TRAC-1' } },
-      { id: 2, tube: { barcode: 'TRAC-2' } },
+    storeWell.pools = [
+      { id: 1, barcode: 'TRAC-1' },
+      { id: 2, barcode: 'TRAC-2' },
     ]
     storeWell.movie_time = '15'
     storeWell.insert_size = 123
@@ -111,8 +111,8 @@ describe('Well.vue', () => {
       expect(ellipse.attributes('class')).toEqual('filled')
     })
 
-    it('will be invalid if there are no libraries in the store', () => {
-      storeWell.libraries = []
+    it('will be invalid if there are no pools in the store', () => {
+      storeWell.pools = []
       wrapper = mount(Well, {
         localVue,
         store,
@@ -125,12 +125,6 @@ describe('Well.vue', () => {
       expect(ellipse.attributes('class')).toEqual('filled')
     })
 
-    it('will be invalid if there is one or more libraries without a barcode', () => {
-      storeWell.libraries[0].barcode = ''
-      let ellipse = wrapper.find('ellipse')
-      expect(ellipse.attributes('class')).toEqual('complete')
-    })
-
     it('will be valid if pre extension time is present', () => {
       wrapper = mount(Well, {
         localVue,
@@ -144,8 +138,8 @@ describe('Well.vue', () => {
       expect(ellipse.attributes('class')).toEqual('complete')
     })
 
-    it('will be empty if there are no libraries or metadata', () => {
-      storeWell.libraries = []
+    it('will be empty if there are no pools or metadata', () => {
+      storeWell.pools = []
       storeWell.movie_time = ''
       storeWell.generate_hifi = ''
       storeWell.ccs_analysis_output = ''
@@ -168,29 +162,36 @@ describe('Well.vue', () => {
   })
 
   // TODO: same as well modal - refactor baby!
-  describe('updateLibraryBarcode', () => {
-    let newBarcode, library
+  describe('updatePoolBarcode', () => {
+    let newBarcode, pool1, pool2, tubes
 
     beforeEach(() => {
       newBarcode = 'TRAC-1'
-      well.addLibraryToWell = jest.fn()
-      library = { id: 1, tube: { barcode: newBarcode } }
-      store.commit('traction/pacbio/libraries/setLibraries', [library])
+      well.addPoolToWell = jest.fn()
+      pool1 = { id: '1', libraries: [], tube: '1', barcode: 'TRAC-1', type: 'pools' }
+      pool2 = { id: '2', libraries: [], tube: '2', barcode: 'TRAC-2', type: 'pools' }
+      tubes = {
+        '1': { barcode: 'TRAC-1', id: '1', type: 'tubes' },
+        '2': { barcode: 'TRAC-2', id: '2', type: 'tubes' },
+      }
+
+      store.state.traction.pacbio.pools.pools = { '1': pool1, '2': pool2 }
+      store.state.traction.pacbio.pools.tubes = tubes
     })
 
-    it('adds the library to the well', async () => {
-      await well.updateLibraryBarcode(newBarcode)
-      expect(well.addLibraryToWell).toBeCalledWith({
+    it('adds the pool to the well', async () => {
+      await well.updatePoolBarcode(newBarcode)
+      expect(well.addPoolToWell).toBeCalledWith({
         position: well.position,
-        with: { id: library.id, barcode: library.tube.barcode },
+        with: { id: pool1.id, barcode: pool1.barcode },
       })
     })
   })
 
   describe('tooltip', () => {
-    it('will only be visible if there are some libraries', () => {
+    it('will only be visible if there are some pools', () => {
       let title = wrapper.find('title')
-      let expected = storeWell.libraries.map((l) => l.barcode).join(',')
+      let expected = storeWell.pools.map((p) => p.barcode).join(',')
       expect(title.text()).toEqual(expected)
     })
   })
@@ -208,12 +209,12 @@ describe('Well.vue', () => {
         },
         preventDefault: jest.fn(),
       }
-      well.updateLibraryBarcode = jest.fn()
+      well.updatePoolBarcode = jest.fn()
     })
 
     it('will update the barcode', async () => {
       well.drop(mockEvent)
-      expect(well.updateLibraryBarcode).toBeCalledWith(newBarcode)
+      expect(well.updatePoolBarcode).toBeCalledWith(newBarcode)
     })
   })
 })
diff --git a/tests/unit/components/pacbio/PacbioSampleMetadataEdit.spec.js b/tests/unit/components/pacbio/PacbioSampleMetadataEdit.spec.js
index 01cc0d1a4..c5e4891e4 100644
--- a/tests/unit/components/pacbio/PacbioSampleMetadataEdit.spec.js
+++ b/tests/unit/components/pacbio/PacbioSampleMetadataEdit.spec.js
@@ -1,4 +1,4 @@
-import { mount, localVue, Data, store } from '../../testHelper'
+import { mount, localVue, Data, store } from 'testHelper'
 import PacbioSampleMetadataEdit from '@/components/pacbio/PacbioSampleMetadataEdit'
 import Response from '@/api/Response'
 
diff --git a/tests/unit/components/pacbio/PacbioTagSetItem.spec.js b/tests/unit/components/pacbio/PacbioTagSetItem.spec.js
new file mode 100644
index 000000000..bf7da0018
--- /dev/null
+++ b/tests/unit/components/pacbio/PacbioTagSetItem.spec.js
@@ -0,0 +1,93 @@
+import PacbioTagSetItem from '@/components/pacbio/PacbioTagSetItem'
+import { localVue, mount, store } from 'testHelper'
+
+const tagSets = {
+  '1': { id: '1', name: 'TagSet1', tags: ['1', '2', '3', '4', '5', '6'] },
+  '2': { id: '2', name: 'TagSet2' },
+  '3': { id: '3', name: 'TagSet3' },
+}
+
+// is this the best way to do this??
+store.state.traction.pacbio.poolCreate.resources.tagSets = tagSets
+
+const tags = {
+  '1': { id: '1', group_id: 'Tag1' },
+  '2': { id: '2', group_id: 'Tag2' },
+  '3': { id: '3', group_id: 'Tag3' },
+  '4': { id: '4', group_id: 'Tag4' },
+  '5': { id: '5', group_id: 'Tag5' },
+  '6': { id: '6', group_id: 'Tag6' },
+  '7': { id: '7', group_id: 'Tag7' },
+  '8': { id: '8', group_id: 'Tag8' },
+  '9': { id: '9', group_id: 'Tag9' },
+  '10': { id: '10', group_id: 'Tag10' },
+  '11': { id: '11', group_id: 'Tag11' },
+  '12': { id: '12', group_id: 'Tag12' },
+}
+
+const expectedTagSet = { ...tagSets['1'], tags: Object.values(tags).slice(0, 6) }
+
+store.state.traction.pacbio.poolCreate.resources.tags = tags
+
+describe('PacbioTagSetItem', () => {
+  let wrapper
+
+  describe('when there is a selected tag list', () => {
+    beforeEach(() => {
+      store.commit('traction/pacbio/poolCreate/selectTagSet', { id: '1' })
+
+      wrapper = mount(PacbioTagSetItem, {
+        localVue,
+        store,
+      })
+    })
+
+    it('has the selected tag set', () => {
+      expect(wrapper.vm.selectedTagSet).toEqual(expectedTagSet)
+    })
+
+    it('shows the tag set name', () => {
+      const name = wrapper.find('[data-attribute=tag-set-name]')
+      expect(name.text()).toMatch(tagSets['1'].name)
+    })
+
+    it('shows a list of tags', () => {
+      expect(
+        wrapper.find('[data-type=tag-set-item]').findAll('[data-attribute=group-id]').length,
+      ).toEqual(tagSets['1'].tags.length)
+    })
+
+    it('shows the group id', () => {
+      const groupIds = wrapper.findAll('[data-attribute=group-id]')
+      expect(groupIds.at(0).text()).toEqual(tags['1'].group_id)
+    })
+
+    it('click on tag selects it', async () => {
+      const groupIds = wrapper.findAll('[data-attribute=group-id]')
+      await groupIds.at(0).trigger('click')
+      await groupIds.at(1).trigger('click')
+
+      const selected = wrapper.vm.selected
+      expect(selected).toEqual(['1', '2'])
+    })
+  })
+
+  describe('when there is no selected tag list', () => {
+    beforeEach(() => {
+      store.state.traction.pacbio.poolCreate.selected.tagSet = {}
+
+      wrapper = mount(PacbioTagSetItem, {
+        localVue,
+        store,
+      })
+    })
+
+    it('wont show the the tags', () => {
+      expect(wrapper.find('[data-type=tag-set-item]').exists()).toBeFalsy()
+    })
+    it('should show an appropriate message', () => {
+      const message = wrapper.find('[data-attribute=tag-set-name]')
+      expect(message.text()).toMatch('No tag set selected')
+    })
+  })
+})
diff --git a/tests/unit/components/pacbio/PacbioTagSetList.spec.js b/tests/unit/components/pacbio/PacbioTagSetList.spec.js
new file mode 100644
index 000000000..c2c74d4c5
--- /dev/null
+++ b/tests/unit/components/pacbio/PacbioTagSetList.spec.js
@@ -0,0 +1,71 @@
+import PacbioTagSetList from '@/components/pacbio/PacbioTagSetList'
+import { localVue, mount, store } from 'testHelper'
+
+const tagSets = {
+  '1': { id: '1', name: 'TagSet1' },
+  '2': { id: '2', name: 'TagSet2' },
+  '3': { id: '3', name: 'TagSet3' },
+}
+
+describe('PacbioTagSetList', () => {
+  let wrapper
+
+  describe('when there are some tag sets to show', () => {
+    beforeEach(() => {
+      store.state.traction.pacbio.poolCreate.resources.tagSets = tagSets
+
+      wrapper = mount(PacbioTagSetList, {
+        localVue,
+        store,
+      })
+    })
+
+    it('shows a list of tag sets', () => {
+      expect(wrapper.find('[data-type=tag-set-list]').findAll('option').length).toEqual(
+        // will also include null value
+        Object.keys(tagSets).length + 1,
+      )
+    })
+
+    it('allows the user to select a tag set', async () => {
+      const options = wrapper.find('[data-type=tag-set-list]').findAll('option')
+      // bizarrely if you try to select the first option it returns null
+      await options.at(1).setSelected()
+      expect(wrapper.vm.selected).toEqual('1')
+      expect(store.state.traction.pacbio.poolCreate.selected.tagSet.id).toEqual(tagSets['1'].id)
+    })
+  })
+
+  describe('when there are no tag sets to show', () => {
+    beforeEach(() => {
+      store.state.traction.pacbio.poolCreate.resources.tagSets = {}
+
+      wrapper = mount(PacbioTagSetList, {
+        localVue,
+        store,
+      })
+    })
+
+    it('wont show the list', () => {
+      expect(wrapper.find('[data-type=tag-set-list]').exists()).toBeFalsy()
+    })
+  })
+
+  describe('when there is an error', () => {
+    beforeEach(() => {
+      store.state.traction.pacbio.poolCreate.resources.tagSets = {}
+
+      wrapper = mount(PacbioTagSetList, {
+        localVue,
+        store,
+      })
+
+      wrapper.vm.showAlert('Bad stuff happened', 'danger')
+    })
+
+    it('should show an appropriate message', () => {
+      const errorMessage = wrapper.find('[data-type=error-message]')
+      expect(errorMessage.text()).toMatch('Bad stuff happened')
+    })
+  })
+})
diff --git a/tests/unit/components/pacbio/PacbioWellItem.spec.js b/tests/unit/components/pacbio/PacbioWellItem.spec.js
new file mode 100644
index 000000000..997174b19
--- /dev/null
+++ b/tests/unit/components/pacbio/PacbioWellItem.spec.js
@@ -0,0 +1,110 @@
+import Well from '@/components/pacbio/PacbioWellItem'
+import { mount, store } from 'testHelper'
+
+const requests = {
+  '1': {
+    sample_name: 'Sample1',
+    cost_code: '12345',
+    source_identifier: 'DN1:A1',
+    external_study_id: '1',
+  },
+}
+
+describe('Well.vue', () => {
+  let well, wrapper, props
+
+  beforeEach(() => {
+    props = {
+      row: 'A',
+      column: '1',
+      cx: '60.440327',
+      cy: '75.818642',
+      rx: '10.906492',
+      ry: '11.032985',
+      requests: ['1'],
+    }
+
+    store.state.traction.pacbio.poolCreate.resources.requests = requests
+
+    wrapper = mount(Well, {
+      propsData: props,
+      store,
+    })
+
+    well = wrapper.vm
+  })
+
+  describe('props', () => {
+    it('must have a row', () => {
+      expect(well.row).toEqual(props.row)
+    })
+
+    it('must have a column', () => {
+      expect(well.column).toEqual(props.column)
+    })
+
+    it('must have a cx', () => {
+      expect(well.cx).toEqual(props.cx)
+    })
+
+    it('must have a cy', () => {
+      expect(well.cy).toEqual(props.cy)
+    })
+
+    it('must have a rx', () => {
+      expect(well.rx).toEqual(props.rx)
+    })
+
+    it('must have a ry', () => {
+      expect(well.ry).toEqual(props.ry)
+    })
+
+    it('will have requests', () => {
+      expect(well.requests).toEqual(props.requests)
+    })
+  })
+
+  it('will have an ellipse with the correct attributes', () => {
+    let ellipse = wrapper.find('ellipse')
+    expect(ellipse.exists()).toBeTruthy()
+    expect(ellipse.attributes('cx')).toEqual(well.cx)
+    expect(ellipse.attributes('cy')).toEqual(well.cy)
+    expect(ellipse.attributes('rx')).toEqual(well.rx)
+    expect(ellipse.attributes('ry')).toEqual(well.ry)
+  })
+
+  describe('#status', () => {
+    it('will be filled if the well has a request', () => {
+      let ellipse = wrapper.find('ellipse')
+      expect(ellipse.attributes('class')).toContain('filled')
+    })
+
+    it('will be empty when the well does not have a request', () => {
+      props['requests'] = []
+
+      wrapper = mount(Well, {
+        propsData: props,
+        store,
+      })
+
+      let ellipse = wrapper.find('ellipse')
+      expect(ellipse.attributes('class')).toContain('empty')
+    })
+  })
+
+  describe('#tooltip', () => {
+    it('will display the materials requests name', () => {
+      let title = wrapper.find('title')
+      let expected = 'Sample1'
+      expect(title.text()).toEqual(expected)
+    })
+  })
+
+  describe('@click', () => {
+    it('emits a click event', async () => {
+      const ellipse = wrapper.find('ellipse')
+      await ellipse.trigger('click')
+      expect(wrapper.emitted().click).toBeTruthy()
+    })
+  })
+})
diff --git a/tests/unit/components/plates/PlateItem.spec.js b/tests/unit/components/plates/PlateItem.spec.js
index 49ac8de72..99aa542e7 100644
--- a/tests/unit/components/plates/PlateItem.spec.js
+++ b/tests/unit/components/plates/PlateItem.spec.js
@@ -1,7 +1,7 @@
 import Plate from '@/components/plates/PlateItem'
 import PlateMap from '@/config/PlateMap'
 import Response from '@/api/Response'
-import { localVue, mount, Data } from '../../testHelper'
+import { localVue, mount, Data } from 'testHelper'
 
 describe('Plate.vue', () => {
   let wrapper, plate, mockPlate
@@ -12,10 +12,6 @@ describe('Plate.vue', () => {
     wrapper = mount(Plate, {
       localVue,
       propsData: { plate: mockPlate },
-      stubs: {
-        Plate96SVG: true,
-        Well: true,
-      },
     })
 
     plate = wrapper.vm
@@ -29,7 +25,7 @@ describe('Plate.vue', () => {
   describe('methods', () => {
     describe('#getWellAt', () => {
       it('gets the well at the given position when it exists and has material', () => {
-        let expected = plate.wells.filter((w) => w.position == 'A1')[0]
+        let expected = plate.wells.find((w) => w.position == 'A1')
         expect(plate.getWellAt('A1')).toEqual(expected)
       })
 
diff --git a/tests/unit/components/plates/WellItem.spec.js b/tests/unit/components/plates/WellItem.spec.js
index e5f931f2f..7ca70e513 100644
--- a/tests/unit/components/plates/WellItem.spec.js
+++ b/tests/unit/components/plates/WellItem.spec.js
@@ -1,5 +1,5 @@
 import Well from '@/components/plates/WellItem'
-import { mount } from '../../testHelper'
+import { mount } from 'testHelper'
 
 describe('Well.vue', () => {
   let well, wrapper, props
diff --git a/tests/unit/components/saphyr/SaphyrChip.spec.js b/tests/unit/components/saphyr/SaphyrChip.spec.js
index e19f8635c..ab20c8acb 100644
--- a/tests/unit/components/saphyr/SaphyrChip.spec.js
+++ b/tests/unit/components/saphyr/SaphyrChip.spec.js
@@ -1,4 +1,4 @@
-import { mount, localVue, store } from '../../testHelper'
+import { mount, localVue, store } from 'testHelper'
 import Chip from '@/components/saphyr/SaphyrChip'
 import * as Run from '@/api/SaphyrRun'
 
diff --git a/tests/unit/components/saphyr/SaphyrEnzymeModal.spec.js b/tests/unit/components/saphyr/SaphyrEnzymeModal.spec.js
index 4997e655e..f9e58eeaf 100644
--- a/tests/unit/components/saphyr/SaphyrEnzymeModal.spec.js
+++ b/tests/unit/components/saphyr/SaphyrEnzymeModal.spec.js
@@ -1,8 +1,8 @@
 import Response from '@/api/Response'
 import EnzymeModal from '@/components/saphyr/SaphyrEnzymeModal'
 import flushPromises from 'flush-promises'
-import EnzymesJson from '../../../data/enzymes'
-import { localVue, mount, store } from '../../testHelper'
+import EnzymesJson from '@tests/data/enzymes'
+import { localVue, mount, store } from 'testHelper'
 
 describe('SaphyrEnzymeModal.vue', () => {
   let wrapper, enzymeModal
diff --git a/tests/unit/components/saphyr/SaphyrFlowcell.spec.js b/tests/unit/components/saphyr/SaphyrFlowcell.spec.js
index 840c44072..8362a4f07 100644
--- a/tests/unit/components/saphyr/SaphyrFlowcell.spec.js
+++ b/tests/unit/components/saphyr/SaphyrFlowcell.spec.js
@@ -1,37 +1,21 @@
-import { mount, localVue, Vuex, Data } from '../../testHelper'
+import { mount, localVue, Data, store } from 'testHelper'
 import Flowcell from '@/components/saphyr/SaphyrFlowcell'
 import * as Run from '@/api/SaphyrRun'
 import Response from '@/api/Response'
 
 describe('Flowcell', () => {
-  let wrapper, flowcell, props, run
+  let wrapper, flowcell, props
 
   beforeEach(() => {
-    run = Run.build()
-
-    let store = new Vuex.Store({
-      modules: {
+    const {
+      state: {
         traction: {
-          namespaced: true,
-          modules: {
-            saphyr: {
-              namespaced: true,
-              modules: {
-                runs: {
-                  namespaced: true,
-                  state: {
-                    currentRun: run,
-                  },
-                  getters: {
-                    currentRun: (state) => state.currentRun,
-                  },
-                },
-              },
-            },
-          },
+          saphyr: { runs: saphyrRuns },
         },
       },
-    })
+    } = store
+
+    saphyrRuns.currentRun = Run.build()
 
     props = { index: 0, position: 1 }
 
diff --git a/tests/unit/components/svg/Plate96SVG.spec.js b/tests/unit/components/svg/Plate96SVG.spec.js
index f431a3635..e8ee88130 100644
--- a/tests/unit/components/svg/Plate96SVG.spec.js
+++ b/tests/unit/components/svg/Plate96SVG.spec.js
@@ -1,4 +1,4 @@
-import { mount } from '../../testHelper'
+import { mount } from 'testHelper'
 import Plate96SVG from '@/components/svg/Plate96SVG'
 import PlateMap from '@/config/PlateMap'
 
diff --git a/tests/unit/mixins/Api.spec.js b/tests/unit/mixins/Api.spec.js
index 9536a6289..6655a020c 100644
--- a/tests/unit/mixins/Api.spec.js
+++ b/tests/unit/mixins/Api.spec.js
@@ -1,7 +1,7 @@
 import ApiMixin from '@/mixins/Api'
 import build from '@/api/ApiBuilder'
 import config from '@/api/Config'
-import { mount, localVue, store } from '../testHelper'
+import { mount, localVue, store } from 'testHelper'
 
 const Cmp = {
   template: '<div class="say-my-name"></div>',
diff --git a/tests/unit/mixins/DragHelper.spec.js b/tests/unit/mixins/DragHelper.spec.js
index e055d508c..d48e2e62d 100644
--- a/tests/unit/mixins/DragHelper.spec.js
+++ b/tests/unit/mixins/DragHelper.spec.js
@@ -1,5 +1,5 @@
 import DragHelper from '@/mixins/DragHelper'
-import { localVue, mount } from '../testHelper'
+import { localVue, mount } from 'testHelper'
 
 describe('DragHelper', () => {
   let dragHelper, wrapper
diff --git a/tests/unit/mixins/Helper.spec.js b/tests/unit/mixins/Helper.spec.js
index ada19b4bc..a7a91ecff 100644
--- a/tests/unit/mixins/Helper.spec.js
+++ b/tests/unit/mixins/Helper.spec.js
@@ -1,5 +1,5 @@
 import Helper from '@/mixins/Helper'
-import { localVue, mount } from '../testHelper'
+import { localVue, mount } from 'testHelper'
 
 // TODO: added tests as a mimimum but these functions
 // should be available anywhere not via a mixin
diff --git a/tests/unit/services/Sequencescape.spec.js b/tests/unit/services/Sequencescape.spec.js
index d8dcf08f4..a9afd058a 100644
--- a/tests/unit/services/Sequencescape.spec.js
+++ b/tests/unit/services/Sequencescape.spec.js
@@ -1,5 +1,5 @@
 import { getPlates, transformPlates, OntSample, PacbioSample } from '@/services/Sequencescape'
-import { Data } from '../testHelper'
+import { Data } from 'testHelper'
 import Response from '@/api/Response'
 
 const plates = [
diff --git a/tests/unit/services/traction/Pacbio.spec.js b/tests/unit/services/traction/Pacbio.spec.js
index aa9fcda78..41cabfbe5 100644
--- a/tests/unit/services/traction/Pacbio.spec.js
+++ b/tests/unit/services/traction/Pacbio.spec.js
@@ -1,5 +1,5 @@
 import { createPlates } from '@/services/traction/Pacbio'
-import { Data } from '../../testHelper'
+import { Data } from 'testHelper'
 
 const failedResponse = {
   status: 422,
diff --git a/tests/unit/store/index.spec.js b/tests/unit/store/index.spec.js
index 75856b03b..d40fd96d4 100644
--- a/tests/unit/store/index.spec.js
+++ b/tests/unit/store/index.spec.js
@@ -1,4 +1,5 @@
 import Store from '@/store/index'
+import PlateMap from '@/config/PlateMap'
 
 describe('index', () => {
   describe('state', () => {
@@ -16,6 +17,14 @@ describe('index', () => {
         expect(Store.state.api.printMyBarcode).toBeDefined()
       })
     })
+
+    it('has a plate map', () => {
+      const plateMap = Store.state.plateMap
+      expect(plateMap).toBeDefined()
+      expect(plateMap.rows).toBeDefined()
+      expect(plateMap.columns).toBeDefined()
+      expect(plateMap.wells).toBeDefined()
+    })
   })
 
   describe('getters', () => {
@@ -26,5 +35,9 @@ describe('index', () => {
     it('printers', () => {
       expect(Store.getters.printers).toBeDefined()
     })
+
+    it('PlateMap', () => {
+      expect(Store.getters.plateMap).toEqual(PlateMap)
+    })
   })
 })
diff --git a/tests/unit/store/sampleExtraction/actions.spec.js b/tests/unit/store/sampleExtraction/actions.spec.js
index ccd6bf3b4..1da56650d 100644
--- a/tests/unit/store/sampleExtraction/actions.spec.js
+++ b/tests/unit/store/sampleExtraction/actions.spec.js
@@ -1,5 +1,5 @@
 import * as Actions from '@/store/sampleExtraction/actions'
-import { Data } from '../../testHelper'
+import { Data } from 'testHelper'
 import Response from '@/api/Response'
 
 describe('#getSampleExtractionTubesForBarcodes', () => {
diff --git a/tests/unit/store/traction/actions.spec.js b/tests/unit/store/traction/actions.spec.js
index 435e30953..cf2cb9852 100644
--- a/tests/unit/store/traction/actions.spec.js
+++ b/tests/unit/store/traction/actions.spec.js
@@ -1,6 +1,6 @@
 import Response from '@/api/Response'
 import * as Actions from '@/store/traction/actions'
-import { Data } from '../../testHelper'
+import { Data } from 'testHelper'
 
 describe('#startRun', () => {
   let dispatch, id, payload
diff --git a/tests/unit/store/traction/getters.spec.js b/tests/unit/store/traction/getters.spec.js
index 44703d12b..7af905149 100644
--- a/tests/unit/store/traction/getters.spec.js
+++ b/tests/unit/store/traction/getters.spec.js
@@ -1,5 +1,5 @@
 import Response from '@/api/Response'
-import { Data } from '../../testHelper'
+import { Data } from 'testHelper'
 import getters from '@/store/traction/getters'
 
 let tractionTags
diff --git a/tests/unit/store/traction/mutations.spec.js b/tests/unit/store/traction/mutations.spec.js
index 170042f15..9b2ab9e16 100644
--- a/tests/unit/store/traction/mutations.spec.js
+++ b/tests/unit/store/traction/mutations.spec.js
@@ -1,5 +1,5 @@
 import Response from '@/api/Response'
-import { Data } from '../../testHelper'
+import { Data } from 'testHelper'
 import mutations from '@/store/traction/mutations'
 
 let tractionTags
@@ -37,7 +37,7 @@ describe('updateRun', () => {
 
   it('updates the given run in the states runs', () => {
     mutations.updateRun(state, updatedRun)
-    let recievedRun = state.pacbio.runs.runs.filter((r) => r.id === updatedRun.id)[0]
+    let recievedRun = state.pacbio.runs.runs.find((r) => r.id === updatedRun.id)
     expect(recievedRun.state).toEqual(updatedRun.state)
   })
 })
diff --git a/tests/unit/store/traction/pacbio/libraries/actions.spec.js b/tests/unit/store/traction/pacbio/libraries/actions.spec.js
index 2eaabe1b2..c916060d4 100644
--- a/tests/unit/store/traction/pacbio/libraries/actions.spec.js
+++ b/tests/unit/store/traction/pacbio/libraries/actions.spec.js
@@ -1,4 +1,4 @@
-import { Data } from '../../../../testHelper'
+import { Data } from 'testHelper'
 import Response from '@/api/Response'
 import * as Actions from '@/store/traction/pacbio/libraries/actions'
 
diff --git a/tests/unit/store/traction/pacbio/libraries/getters.spec.js b/tests/unit/store/traction/pacbio/libraries/getters.spec.js
index 37d69268f..1505dc91e 100644
--- a/tests/unit/store/traction/pacbio/libraries/getters.spec.js
+++ b/tests/unit/store/traction/pacbio/libraries/getters.spec.js
@@ -1,5 +1,5 @@
 import Response from '@/api/Response'
-import { Data } from '../../../../testHelper'
+import { Data } from 'testHelper'
 import getters from '@/store/traction/pacbio/libraries/getters'
 
 let libraries
diff --git a/tests/unit/store/traction/pacbio/libraries/mutations.spec.js b/tests/unit/store/traction/pacbio/libraries/mutations.spec.js
index 89049e576..d956dfe10 100644
--- a/tests/unit/store/traction/pacbio/libraries/mutations.spec.js
+++ b/tests/unit/store/traction/pacbio/libraries/mutations.spec.js
@@ -1,5 +1,5 @@
 import Response from '@/api/Response'
-import { Data } from '../../../../testHelper'
+import { Data } from 'testHelper'
 import mutations from '@/store/traction/pacbio/libraries/mutations'
 
 let library, libraries, state
diff --git a/tests/unit/store/traction/pacbio/plates/actions.spec.js b/tests/unit/store/traction/pacbio/plates/actions.spec.js
index a6b18ea97..f9bdf4750 100644
--- a/tests/unit/store/traction/pacbio/plates/actions.spec.js
+++ b/tests/unit/store/traction/pacbio/plates/actions.spec.js
@@ -1,4 +1,4 @@
-import { Data } from '../../../../testHelper'
+import { Data } from 'testHelper'
 import Response from '@/api/Response'
 import * as Actions from '@/store/traction/pacbio/plates/actions'
 
diff --git a/tests/unit/store/traction/pacbio/plates/getters.spec.js b/tests/unit/store/traction/pacbio/plates/getters.spec.js
index 819fcb119..8c982058a 100644
--- a/tests/unit/store/traction/pacbio/plates/getters.spec.js
+++ b/tests/unit/store/traction/pacbio/plates/getters.spec.js
@@ -1,5 +1,5 @@
 import Response from '@/api/Response'
-import { Data } from '../../../../testHelper'
+import { Data } from 'testHelper'
 import getters from '@/store/traction/pacbio/plates/getters'
 
 let plates
diff --git a/tests/unit/store/traction/pacbio/plates/mutations.spec.js b/tests/unit/store/traction/pacbio/plates/mutations.spec.js
index b1521c0b4..d6fde84fa 100644
--- a/tests/unit/store/traction/pacbio/plates/mutations.spec.js
+++ b/tests/unit/store/traction/pacbio/plates/mutations.spec.js
@@ -1,5 +1,5 @@
 import Response from '@/api/Response'
-import { Data } from '../../../../testHelper'
+import { Data } from 'testHelper'
 import mutations from '@/store/traction/pacbio/plates/mutations'
 
 let plates
diff --git a/tests/unit/store/traction/pacbio/poolCreate/actions.spec.js b/tests/unit/store/traction/pacbio/poolCreate/actions.spec.js
new file mode 100644
index 000000000..4e3992933
--- /dev/null
+++ b/tests/unit/store/traction/pacbio/poolCreate/actions.spec.js
@@ -0,0 +1,221 @@
+import { Data } from 'testHelper'
+import actions from '@/store/traction/pacbio/poolCreate/actions'
+import defaultState from '@/store/traction/pacbio/poolCreate/state'
+import { newResponse } from '@/api/ResponseHelper'
+
+describe('actions.js', () => {
+  const {
+    fetchPacbioPlates,
+    fetchPacbioTagSets,
+    selectWellRequests,
+    deselectPlateAndContents,
+    createPool,
+  } = actions
+
+  describe('fetchPacbioPlates', () => {
+    it('handles success', async () => {
+      // mock commit
+      const commit = jest.fn()
+      // mock dependencies
+      const get = jest.fn()
+      const rootState = { api: { traction: { pacbio: { plates: { get } } } } }
+      get.mockResolvedValue(Data.PacbioPlatesRequest)
+      // apply action
+      const { success } = await fetchPacbioPlates({ commit, rootState })
+      // assert result (Might make sense to pull these into separate tests)
+      expect(commit).toHaveBeenCalledWith('populatePlates', Data.PacbioPlatesRequest.data.data)
+      expect(commit).toHaveBeenCalledWith(
+        'populateWells',
+        Data.PacbioPlatesRequest.data.included.slice(0, 4),
+      )
+      expect(commit).toHaveBeenCalledWith(
+        'populateRequests',
+        Data.PacbioPlatesRequest.data.included.slice(4, 8),
+      )
+      expect(success).toEqual(true)
+    })
+
+    it('handles failure', async () => {
+      // mock commit
+      const commit = jest.fn()
+      // mock dependencies
+      const get = jest.fn()
+      const rootState = { api: { traction: { pacbio: { plates: { get } } } } }
+      get.mockRejectedValue({
+        data: { data: [] },
+        status: 500,
+        statusText: 'Internal Server Error',
+      })
+      // apply action
+      const { success } = await fetchPacbioPlates({ commit, rootState })
+      // assert result (Might make sense to pull these into separate tests)
+      expect(commit).not.toHaveBeenCalled()
+      expect(success).toEqual(false)
+    })
+  })
+
+  describe('fetchPacbioTagSets', () => {
+    it('handles success', async () => {
+      // mock commit
+      const commit = jest.fn()
+      // mock dependencies
+      const get = jest.fn()
+      const rootState = { api: { traction: { pacbio: { tag_sets: { get } } } } }
+      get.mockRejectedValue({
+        data: { data: [] },
+        status: 500,
+        statusText: 'Internal Server Error',
+      })
+      // apply action
+      const { success } = await fetchPacbioTagSets({ commit, rootState })
+      // assert result
+      expect(commit).not.toHaveBeenCalled()
+      expect(success).toEqual(false)
+    })
+
+    it('handles failure', async () => {
+      // mock commit
+      const commit = jest.fn()
+      // mock dependencies
+      const get = jest.fn()
+      const rootState = { api: { traction: { pacbio: { tag_sets: { get } } } } }
+      get.mockResolvedValue(Data.PacbioTagSets)
+      // apply action
+      const { success } = await fetchPacbioTagSets({ commit, rootState })
+      // assert result
+      expect(commit).toHaveBeenCalledWith('populateTagSets', Data.PacbioTagSets.data.data)
+      expect(commit).toHaveBeenCalledWith('populateTags', Data.PacbioTagSets.data.included)
+      expect(success).toEqual(true)
+    })
+  })
+
+  describe('selectWellRequests', () => {
+    it('selects requests if unselected', async () => {
+      // mock commit
+      const commit = jest.fn()
+      // mock dependencies
+      const defaultStateObject = defaultState()
+      const state = {
+        ...defaultStateObject,
+        resources: {
+          ...defaultStateObject.resources,
+          wells: {
+            1: { id: '1', type: 'wells', position: 'A1', requests: ['2'] },
+          },
+        },
+      }
+      // apply action
+      await selectWellRequests({ commit, state }, '1')
+      // assert result
+      expect(commit).toHaveBeenCalledWith('selectRequest', { id: '2', selected: true })
+    })
+
+    it('deselects requests if selected', async () => {
+      // mock commit
+      const commit = jest.fn()
+      // mock dependencies
+      const defaultStateObject = defaultState()
+      const state = {
+        ...defaultStateObject,
+        resources: {
+          ...defaultStateObject.resources,
+          wells: {
+            1: { id: '1', type: 'wells', position: 'A1', requests: ['2'] },
+          },
+        },
+        libraries: {
+          _2: { pacbio_request_id: '2' },
+        },
+      }
+      // apply action
+      await selectWellRequests({ commit, state }, '1')
+      // assert result
+      expect(commit).toHaveBeenCalledWith('selectRequest', { id: '2', selected: false })
+    })
+  })
+
+  describe('deselectPlateAndContents', () => {
+    it('selects requests if unselected', async () => {
+      // mock commit
+      const commit = jest.fn()
+      // mock dependencies
+      const defaultStateObject = defaultState()
+      const state = {
+        ...defaultStateObject,
+        resources: {
+          ...defaultStateObject.resources,
+          plates: {
+            1: { id: 1, wells: ['10', '20'] },
+          },
+          wells: {
+            10: { id: '1', type: 'wells', position: 'A1', requests: ['100', '300'] },
+            20: { id: '1', type: 'wells', position: 'A1', requests: ['200', '400'] },
+          },
+        },
+        selected: {
+          ...defaultStateObject.selected,
+          requests: {
+            _100: { id: '100', selected: true },
+            _300: { id: '300', selected: true },
+          },
+        },
+      }
+      // apply action
+      await deselectPlateAndContents({ commit, state }, '1')
+      // assert result
+      expect(commit).toHaveBeenCalledWith('selectPlate', { id: '1', selected: false })
+      expect(commit).toHaveBeenCalledWith('selectRequest', { id: '100', selected: false })
+      expect(commit).toHaveBeenCalledWith('selectRequest', { id: '300', selected: false })
+      // We don't want to select any unselected requests
+      expect(commit).not.toHaveBeenCalledWith('selectRequest', { id: '200', selected: true })
+    })
+  })
+
+  describe('createPool', async () => {
+    const library1 = {
+      pacbio_request_id: '1',
+      tag_id: '1',
+      template_prep_kit_box_barcode: 'ABC1',
+      volume: 1,
+      concentration: 1,
+      fragment_size: 100,
+    }
+
+    const library2 = {
+      pacbio_request_id: '2',
+      tag_id: '2',
+      template_prep_kit_box_barcode: 'ABC1',
+      volume: 1,
+      concentration: 1,
+      fragment_size: 100,
+    }
+
+    // pool should be successfully created
+    // for now: create a pool state with a simple success message
+    it('when the pool is valid', async () => {
+      const mockResponse = { status: '201', data: { data: { id: 1 } } }
+      const commit = jest.fn()
+      const create = jest.fn()
+      const rootState = { api: { traction: { pacbio: { pools: { create } } } } }
+      const libraries = { _1: library1, _2: library2 }
+      create.mockResolvedValue(mockResponse)
+      const response = newResponse({ ...mockResponse, success: true })
+      await createPool({ commit, rootState, state: { libraries } })
+      expect(commit).toHaveBeenCalledWith('populateResult', response)
+    })
+
+    it('when there is an error', () => {})
+
+    // validate libraries fails
+    // request is not sent
+    // commit is not called
+    it('when the pool is invalid', async () => {
+      const commit = jest.fn()
+      const create = jest.fn()
+      const rootState = { api: { traction: { pacbio: { pools: { create } } } } }
+      const libraries = { _1: library1, _2: { ...library2, tag_id: '' } }
+      await createPool({ commit, rootState, state: { libraries } })
+      expect(commit).not.toHaveBeenCalledWith('populateResult')
+    })
+  })
+})
diff --git a/tests/unit/store/traction/pacbio/poolCreate/getters.spec.js b/tests/unit/store/traction/pacbio/poolCreate/getters.spec.js
new file mode 100644
index 000000000..096e5b68e
--- /dev/null
+++ b/tests/unit/store/traction/pacbio/poolCreate/getters.spec.js
@@ -0,0 +1,263 @@
+import getters from '@/store/traction/pacbio/poolCreate/getters'
+import defaultState from '@/store/traction/pacbio/poolCreate/state'
+import { Data } from 'testHelper'
+import { dataToObjectById } from '@/api/JsonApi'
+
+describe('getters.js', () => {
+  const state = defaultState()
+  const {
+    labwareList,
+    tagSetList,
+    selectedTagSet,
+    selectedPlates,
+    selectedRequests,
+    tagList,
+    wellList,
+    requestList,
+    libraryItem,
+    result,
+  } = getters
+
+  const tagSets = {
+    '1': {
+      id: '1',
+      name: 'tagSet1',
+      uuid: 'uuid1',
+      pipeline: 'pipeline1',
+      tags: [],
+    },
+    '2': {
+      id: '2',
+      name: 'tagSet2',
+      uuid: 'uuid2',
+      pipeline: 'pipeline1',
+      tags: [],
+    },
+  }
+
+  describe('labwareList', () => {
+    it('returns a list of labware resources', () => {
+      const plates = {
+        '1': {
+          barcode: 'DN1',
+          id: '1',
+          type: 'plates',
+          wells: [],
+        },
+        '2': {
+          barcode: 'DN2',
+          id: '2',
+          type: 'plates',
+          wells: [],
+        },
+      }
+      const expected = [
+        {
+          barcode: 'DN1',
+          id: '1',
+          type: 'plates',
+          wells: [],
+          selected: true,
+        },
+        {
+          barcode: 'DN2',
+          id: '2',
+          type: 'plates',
+          wells: [],
+        },
+      ]
+      state.resources.plates = plates
+      state.selected.plates = { _1: { id: '1', selected: true } }
+      expect(labwareList(state)).toEqual(expected)
+    })
+  })
+
+  describe('tagSetList', () => {
+    it('returns what it does', () => {
+      state.resources.tagSets = tagSets
+      expect(tagSetList(state)).toEqual(Object.values(tagSets))
+    })
+  })
+
+  describe('tagList', () => {
+    const tags = {
+      '1': { id: '1', name: 'tag1' },
+      '2': { id: '2', name: 'tag2' },
+      '3': { id: '3', name: 'tag3' },
+      '4': { id: '4', name: 'tag4' },
+      '5': { id: '5', name: 'tag5' },
+    }
+
+    it('returns what it does', () => {
+      state.resources.tags = tags
+      expect(tagList(state)()).toEqual(tags.values)
+    })
+
+    it('when ids are included', () => {
+      state.resources.tags = tags
+      const ids = ['1', '2', '3']
+      expect(tagList(state)(ids).length).toEqual(ids.length)
+    })
+  })
+
+  describe('selectedTagSet', () => {
+    it('returns the selected tag set', () => {
+      const tagSet = { id: '1' }
+      state.selected.tagSet = tagSet
+      state.resources.tagSets = tagSets
+      expect(selectedTagSet(state)).toEqual(tagSets['1'])
+    })
+  })
+
+  describe('selectedPlates', () => {
+    it('returns what it does', () => {
+      const plates = {
+        '1': {
+          barcode: 'DN1',
+          id: '1',
+          type: 'plates',
+          wells: [],
+        },
+      }
+      state.selected.plates = plates
+      expect(selectedPlates(state)).toEqual(Object.values(plates))
+    })
+  })
+
+  describe('selectedRequests', () => {
+    const defaultStateObject = defaultState()
+    const requestResources = Data.PacbioPlatesRequest.data.included.slice(4, 8)
+    const requests = dataToObjectById({ data: requestResources, includeRelationships: false })
+
+    // When selecting a request with append the id with an underscore. This ensures
+    // keys are maintained in insertion order, not numeric order. This allow our requests
+    // to maintain the order in which they were selected
+    const libraries = {
+      _136: {
+        pacbio_request_id: '136',
+        tagId: null,
+        volume: null,
+        concentration: null,
+        fragmentSize: null,
+      }, // A selected request
+      _40: {
+        pacbio_request_id: '40',
+        tagId: null,
+        volume: null,
+        concentration: null,
+        fragmentSize: null,
+      }, // A selected request
+    }
+
+    const state = {
+      ...defaultStateObject,
+      resources: { ...defaultStateObject.resources, requests },
+      libraries,
+    }
+
+    it('returns an array of request resources that have been selected', () => {
+      expect(selectedRequests(state)).toEqual([
+        { ...requests['136'], selected: true },
+        { ...requests['40'], selected: true },
+      ])
+    })
+  })
+
+  describe('wellList', () => {
+    const wells = {
+      '1': { id: '1', position: 'A1' },
+      '2': { id: '2', position: 'B1' },
+      '3': { id: '3', position: 'C1' },
+      '4': { id: '4', position: 'D1' },
+      '5': { id: '5', position: 'E1' },
+    }
+
+    it('returns what it does', () => {
+      state.resources.wells = wells
+      expect(wellList(state)()).toEqual(wells.values)
+    })
+
+    it('when ids are included', () => {
+      state.resources.wells = wells
+      const ids = ['1', '2', '3']
+      expect(wellList(state)(ids).length).toEqual(ids.length)
+    })
+  })
+
+  describe('requestList', () => {
+    const requests = {
+      '1': { id: '1', name: 'request1' },
+      '2': { id: '2', name: 'request2' },
+      '3': { id: '3', name: 'request3' },
+      '4': { id: '4', name: 'request4' },
+      '5': { id: '5', name: 'request5' },
+    }
+    const libraries = {
+      _3: {
+        pacbio_request_id: '3',
+        tagId: null,
+        volume: null,
+        concentration: null,
+        fragmentSize: null,
+      },
+      _4: {
+        pacbio_request_id: '4',
+        tagId: null,
+        volume: null,
+        concentration: null,
+        fragmentSize: null,
+      },
+    }
+    const mergedRequests = [
+      { id: '1', name: 'request1', selected: false },
+      { id: '2', name: 'request2', selected: false },
+      { id: '3', name: 'request3', selected: true },
+      { id: '4', name: 'request4', selected: true },
+      { id: '5', name: 'request5', selected: false },
+    ]
+
+    it('returns what it does', () => {
+      state.resources.requests = requests
+      state.libraries = libraries
+      expect(requestList(state)()).toEqual(mergedRequests)
+    })
+
+    it('when ids are included', () => {
+      state.resources.requests = requests
+      state.libraries = libraries
+      const ids = ['1', '2', '3']
+      expect(requestList(state)(ids).length).toEqual(ids.length)
+    })
+  })
+
+  describe('libraryItem', () => {
+    const libraries = {
+      _3: {
+        pacbio_request_id: '3',
+        tagId: null,
+        volume: null,
+        concentration: null,
+        fragmentSize: null,
+      },
+      _4: {
+        pacbio_request_id: '4',
+        tagId: null,
+        volume: null,
+        concentration: null,
+        fragmentSize: null,
+      },
+    }
+    it('will return the correct library', () => {
+      state.libraries = libraries
+      expect(libraryItem(state)('3')).toEqual(libraries['_3'])
+    })
+  })
+
+  describe('resultItem', () => {
+    it('returns what it does', () => {
+      const newResult = { state: 'success', message: 'help' }
+      state.result = newResult
+      expect(result(state)).toEqual(newResult)
+    })
+  })
+})
diff --git a/tests/unit/store/traction/pacbio/poolCreate/libraries.spec.js b/tests/unit/store/traction/pacbio/poolCreate/libraries.spec.js
new file mode 100644
index 000000000..b9da02b33
--- /dev/null
+++ b/tests/unit/store/traction/pacbio/poolCreate/libraries.spec.js
@@ -0,0 +1,150 @@
+import defaultState from '@/store/traction/pacbio/poolCreate/state'
+import { validate, valid, payload } from '@/store/traction/pacbio/poolCreate/libraries'
+
+const library1 = {
+  pacbio_request_id: '1',
+  tag_id: '1',
+  template_prep_kit_box_barcode: 'ABC1',
+  volume: 1,
+  concentration: 1,
+  fragment_size: 100,
+}
+
+const library2 = {
+  pacbio_request_id: '2',
+  tag_id: '2',
+  template_prep_kit_box_barcode: 'ABC1',
+  volume: 1,
+  concentration: 1,
+  fragment_size: 100,
+}
+
+const library3 = {
+  pacbio_request_id: '3',
+  tag_id: '3',
+  template_prep_kit_box_barcode: 'ABC1',
+  volume: 1,
+  concentration: 1,
+  fragment_size: 100,
+}
+
+describe('libraries.js', () => {
+  describe('validate', () => {
+    it('when the tag id is not present', () => {
+      const libraries = { _1: library1, _2: library2, _3: { ...library3, tag_id: '' } }
+      const state = defaultState()
+      state.libraries = { ...libraries }
+      validate(state)
+      expect(state.libraries['_3'].errors).toEqual({ tag_id: 'must be present' })
+    })
+
+    it('when the template prep kit box barcode is not present', () => {
+      const libraries = {
+        _1: library1,
+        _2: library2,
+        _3: { ...library3, template_prep_kit_box_barcode: '' },
+      }
+      const state = defaultState()
+      state.libraries = { ...libraries }
+      validate(state)
+      expect(state.libraries['_3'].errors).toEqual({
+        template_prep_kit_box_barcode: 'must be present',
+      })
+    })
+
+    it('when the volume is not present', () => {
+      const libraries = { _1: library1, _2: library2, _3: { ...library3, volume: '' } }
+      const state = defaultState()
+      state.libraries = { ...libraries }
+      validate(state)
+      expect(state.libraries['_3'].errors).toEqual({ volume: 'must be present' })
+    })
+
+    it('when the concentration is not present', () => {
+      const libraries = { _1: library1, _2: library2, _3: { ...library3, concentration: '' } }
+      const state = defaultState()
+      state.libraries = { ...libraries }
+      validate(state)
+      expect(state.libraries['_3'].errors).toEqual({ concentration: 'must be present' })
+    })
+
+    it('when the fragment size is not present', () => {
+      const libraries = { _1: library1, _2: library2, _3: { ...library3, fragment_size: '' } }
+      const state = defaultState()
+      state.libraries = { ...libraries }
+      validate(state)
+      expect(state.libraries['_3'].errors).toEqual({ fragment_size: 'must be present' })
+    })
+
+    it('when multiple fields are not valid', () => {
+      const libraries = {
+        _1: library1,
+        _2: library2,
+        _3: { ...library3, fragment_size: '', concentration: '', volume: '' },
+      }
+      const state = defaultState()
+      state.libraries = { ...libraries }
+      validate(state)
+      expect(state.libraries['_3'].errors).toEqual({
+        fragment_size: 'must be present',
+        concentration: 'must be present',
+        volume: 'must be present',
+      })
+    })
+
+    it('when multiple records are not valid', () => {
+      const libraries = {
+        _1: library1,
+        _2: { ...library2, concentration: '' },
+        _3: { ...library3, fragment_size: '' },
+      }
+      const state = defaultState()
+      state.libraries = { ...libraries }
+      validate(state)
+      expect(state.libraries['_3'].errors).toEqual({ fragment_size: 'must be present' })
+      expect(state.libraries['_2'].errors).toEqual({ concentration: 'must be present' })
+    })
+
+    it('tag clashes', () => {
+      const libraries = { _1: library1, _2: library2, _3: { ...library3, tag_id: library1.tag_id } }
+      const state = defaultState()
+      state.libraries = { ...libraries }
+      validate(state)
+      expect(state.libraries['_1'].errors).toEqual({ tag_id: 'duplicated' })
+      expect(state.libraries['_3'].errors).toEqual({ tag_id: 'duplicated' })
+    })
+
+    it('when all of the libraries are valid', () => {
+      const libraries = { _1: library1, _2: library2, _3: library3 }
+      const state = defaultState()
+      state.libraries = { ...libraries }
+      validate(state)
+      expect(
+        Object.values(state.libraries).every((library) => Object.keys(library.errors).length === 0),
+      ).toBeTruthy()
+    })
+  })
+
+  describe('valid', () => {
+    it('no errors', () => {
+      const libraries = { _1: library1, _2: library2, _3: library3 }
+      expect(valid({ libraries })).toBeTruthy()
+    })
+
+    it('with errors', () => {
+      const libraries = {
+        _1: library1,
+        _2: library2,
+        _3: { ...library3, errors: { a: 'error', b: 'error' } },
+      }
+      expect(valid({ libraries })).toBeFalsy()
+    })
+  })
+
+  it('payload', () => {
+    const libraries = { _1: library1, _2: library2, _3: library3 }
+    expect(payload({ libraries })).toEqual({
+      data: { attributes: { libraries: [library1, library2, library3] } },
+    })
+  })
+})
diff --git a/tests/unit/store/traction/pacbio/poolCreate/mutations.spec.js b/tests/unit/store/traction/pacbio/poolCreate/mutations.spec.js
new file mode 100644
index 000000000..310d332d4
--- /dev/null
+++ b/tests/unit/store/traction/pacbio/poolCreate/mutations.spec.js
@@ -0,0 +1,259 @@
+import mutations from '@/store/traction/pacbio/poolCreate/mutations'
+import defaultState from '@/store/traction/pacbio/poolCreate/state'
+import { Data } from 'testHelper'
+import { dataToObjectById } from '@/api/JsonApi'
+
+describe('mutations.js', () => {
+  const {
+    selectPlate,
+    selectTagSet,
+    selectRequest,
+    populatePlates,
+    populateWells,
+    populateRequests,
+    populateTagSets,
+    populateTags,
+    populateResult,
+  } = mutations
+
+  describe('selectPlate', () => {
+    it('selects a plate by default', () => {
+      // mock state
+      const defaultStateObject = defaultState()
+      const state = {
+        ...defaultStateObject,
+        selected: {
+          ...defaultStateObject.selected,
+          plates: {
+            _2: { id: '2', selected: true },
+          },
+        },
+      }
+      // apply mutation
+      selectPlate(state, { id: '1' })
+      // assert result
+      // We expect the plate to be recorded in the selected plates it should:
+      // - Prefix the key with an _ to maintain insert order
+      // - Not disrupt other plates in the store
+      expect(state.selected.plates).toEqual({
+        _2: { id: '2', selected: true },
+        _1: { id: '1', selected: true },
+      })
+    })
+  })
+
+  describe('selectTagSet', () => {
+    it('updates the state', () => {
+      const tagSets = {
+        '1': {
+          'id:': '1',
+          name: 'tagSet1',
+          tags: ['1', '2'],
+        },
+        '2': {
+          'id:': '2',
+          name: 'tagSet2',
+        },
+      }
+
+      const tags = {
+        '1': {
+          id: '1',
+          name: 'tag1',
+        },
+        '2': {
+          id: '2',
+          name: 'tag2',
+        },
+        '3': {
+          id: '3',
+          name: 'tag3',
+        },
+        '4': {
+          id: '4',
+          name: 'tag4',
+        },
+      }
+      // mock state
+      const state = defaultState()
+      state.resources.tagSets = tagSets
+      state.resources.tags = tags
+      // apply mutation
+      selectTagSet(state, { id: '1' })
+      // assert result
+      expect(state.selected.tagSet).toEqual({ id: '1' })
+    })
+  })
+  describe('selectRequest', () => {
+    it('sets a library with the selected request by default', () => {
+      // mock state
+      const defaultStateObject = defaultState()
+      const state = {
+        ...defaultStateObject,
+        libraries: {
+          _2: {
+            pacbio_request_id: '2',
+            tag_id: null,
+            volume: null,
+            concentration: null,
+            fragment_size: null,
+            template_prep_kit_box_barcode: null,
+          },
+        },
+      }
+      // apply mutation
+      selectRequest(state, { id: '1' })
+      // We expect the request to be recorded in the selected requests it should:
+      // - Prefix the key with an _ to maintain insert order
+      // - Not disrupt other requests in the store
+      expect(state.libraries).toEqual({
+        _2: {
+          pacbio_request_id: '2',
+          tag_id: null,
+          volume: null,
+          concentration: null,
+          fragment_size: null,
+          template_prep_kit_box_barcode: null,
+        },
+        _1: {
+          pacbio_request_id: '1',
+          tag_id: null,
+          volume: null,
+          concentration: null,
+          fragment_size: null,
+          template_prep_kit_box_barcode: null,
+        },
+      })
+    })
+
+    it('can deselect a request', () => {
+      // mock state
+      const defaultStateObject = defaultState()
+      const state = {
+        ...defaultStateObject,
+        libraries: {
+          _2: {
+            pacbio_request_id: '2',
+            tag_id: null,
+            volume: null,
+            concentration: null,
+            fragment_size: null,
+          },
+          _1: {
+            pacbio_request_id: '1',
+            tag_id: null,
+            volume: null,
+            concentration: null,
+            fragment_size: null,
+          },
+        },
+      }
+      // apply mutation
+      selectRequest(state, { id: '1', selected: false })
+      // We expect the request to be recorded in the selected requests it should:
+      // - Prefix the key with an _ to maintain insert order
+      // - Not disrupt other requests in the store
+      expect(state.libraries).toEqual({
+        _2: {
+          pacbio_request_id: '2',
+          tag_id: null,
+          volume: null,
+          concentration: null,
+          fragment_size: null,
+        },
+      })
+    })
+  })
+
+  describe('populatePlates', () => {
+    it('updates the state', () => {
+      // mock state
+      const plates = Data.PacbioPlatesRequest.data.data
+      const state = defaultState()
+      // apply mutation
+      populatePlates(state, plates)
+      // assert result
+      expect(state.resources.plates).toEqual(
+        dataToObjectById({ data: plates, includeRelationships: true }),
+      )
+    })
+  })
+
+  describe('populateWells', () => {
+    it('updates the state', () => {
+      // mock state
+      const wells = Data.PacbioPlatesRequest.data.included.slice(0, 4)
+      const state = defaultState()
+      // apply mutation
+      populateWells(state, wells)
+      // assert result
+      expect(state.resources.wells).toEqual(
+        dataToObjectById({ data: wells, includeRelationships: true }),
+      )
+    })
+  })
+
+  describe('populateRequests', () => {
+    it('updates the state', () => {
+      // mock state
+      const requests = Data.PacbioPlatesRequest.data.included.slice(4, 8)
+
+      const state = defaultState()
+      // apply mutation
+      populateRequests(state, requests)
+      // assert result
+      expect(state.resources.requests).toEqual(
+        dataToObjectById({ data: requests, includeRelationships: false }),
+      )
+    })
+  })
+
+  describe('populateTagSets', () => {
+    it('updates the state', () => {
+      // mock state
+      const tagSets = Data.PacbioTagSets.data.data
+      const state = defaultState()
+      // apply mutation
+      populateTagSets(state, tagSets)
+      // assert result
+      expect(state.resources.tagSets).toEqual(
+        dataToObjectById({ data: tagSets, includeRelationships: true }),
+      )
+    })
+  })
+
+  describe('populateTags', () => {
+    it('updates the state', () => {
+      // mock state
+      const tags = Data.PacbioTagSets.data.included
+      const state = defaultState()
+      // apply mutation
+      populateTags(state, tags)
+      // assert result
+      expect(state.resources.tags).toEqual(
+        dataToObjectById({ data: tags, includeRelationships: false }),
+      )
+    })
+  })
+
+  describe('populateResult', () => {
+    it('with a successful response', () => {
+      const response = {
+        success: true,
+      }
+      const state = defaultState()
+      populateResult(state, response)
+      expect(state.result).toEqual({ success: true, message: 'Pool successfully created' })
+    })
+
+    it('with an unsuccessful response', () => {
+      const response = {
+        success: false,
+        errors: 'error1: error1, error2: error2',
+      }
+      const state = defaultState()
+      populateResult(state, response)
+      expect(state.result).toEqual({ success: false, message: 'error1: error1, error2: error2' })
+    })
+  })
+})
diff --git a/tests/unit/store/traction/pacbio/pools/actions.spec.js b/tests/unit/store/traction/pacbio/pools/actions.spec.js
new file mode 100644
index 000000000..98e0faed2
--- /dev/null
+++ b/tests/unit/store/traction/pacbio/pools/actions.spec.js
@@ -0,0 +1,46 @@
+import { Data } from 'testHelper'
+import * as Actions from '@/store/traction/pacbio/pools/actions'
+
+describe('#setPools', () => {
+  let commit, get, getters, failedResponse
+
+  beforeEach(() => {
+    commit = jest.fn()
+    get = jest.fn()
+    getters = { poolRequest: { get: get } }
+
+    failedResponse = { data: { data: [] }, status: 500, statusText: 'Internal Server Error' }
+  })
+
+  it('successfully', async () => {
+    const response = Data.TractionPacbioPools
+    const { data: pools, included } = response.data
+    get.mockResolvedValue(response)
+
+    await Actions.setPools({ commit, getters })
+
+    expect(commit).toHaveBeenCalledWith('setPools', pools)
+    expect(commit).toHaveBeenCalledWith('setTubes', included.slice(0, 2))
+    expect(commit).toHaveBeenCalledWith('setLibraries', included.slice(2, 4))
+    expect(commit).toHaveBeenCalledWith('setTags', included.slice(4, 6))
+    expect(commit).toHaveBeenCalledWith('setRequests', included.slice(6, 8))
+  })
+
+  it('when the pool has no libraries', async () => {
+    const response = Data.TractionPacbioPoolsNoRelationships
+    const { data: pools } = response.data
+    get.mockResolvedValue(response)
+
+    await Actions.setPools({ commit, getters })
+
+    expect(commit).toHaveBeenCalledWith('setPools', pools)
+  })
+
+  it('unsuccessfully', async () => {
+    get.mockRejectedValue(failedResponse)
+
+    await Actions.setPools({ commit, getters })
+
+    expect(commit).not.toHaveBeenCalled()
+  })
+})
diff --git a/tests/unit/store/traction/pacbio/pools/getters.spec.js b/tests/unit/store/traction/pacbio/pools/getters.spec.js
new file mode 100644
index 000000000..1ace01a13
--- /dev/null
+++ b/tests/unit/store/traction/pacbio/pools/getters.spec.js
@@ -0,0 +1,33 @@
+import getters from '@/store/traction/pacbio/pools/getters'
+import storePools from '@tests/data/StorePools'
+
+const state = storePools
+
+const pools = [
+  {
+    id: '1',
+    type: 'pools',
+    barcode: 'TRAC-2-1',
+    libraries: [{ id: '1', sample_name: 'Sample48', group_id: 'bc1019', type: 'libraries' }],
+  },
+  {
+    id: '2',
+    type: 'pools',
+    barcode: 'TRAC-2-2',
+    libraries: [
+      { id: '2', sample_name: 'Sample47', group_id: 'bc1011_BAK8A_OA', type: 'libraries' },
+    ],
+  },
+]
+
+describe('getters', () => {
+  it('"pools" returns denormalized pools from "state.pools"', () => {
+    const actual = getters.pools(state)
+    expect(actual).toEqual(pools)
+  })
+
+  it('"poolByBarcode" returns the pool with the specified barcode from "state.pools"', () => {
+    const actual = getters.poolByBarcode(state, { pools: getters.pools(state) })('TRAC-2-1')
+    expect(actual).toEqual(pools[0])
+  })
+})
diff --git a/tests/unit/store/traction/pacbio/pools/mutations.spec.js b/tests/unit/store/traction/pacbio/pools/mutations.spec.js
new file mode 100644
index 000000000..80ad869c0
--- /dev/null
+++ b/tests/unit/store/traction/pacbio/pools/mutations.spec.js
@@ -0,0 +1,53 @@
+import { Data } from 'testHelper'
+import mutations from '@/store/traction/pacbio/pools/mutations'
+import storePools from '@tests/data/StorePools'
+
+let state
+
+const { data: pools, included } = Data.TractionPacbioPools.data
+const tubes = included.slice(0, 2)
+const libraries = included.slice(2, 4)
+const tags = included.slice(4, 6)
+const requests = included.slice(6, 8)
+
+describe('mutations', () => {
+  it('"setPools" sets "state.pools" to the given pools', () => {
+    state = {
+      pools: {},
+    }
+    mutations.setPools(state, pools)
+    expect(state.pools).toEqual(storePools.pools)
+  })
+
+  it('"setTubes" sets "state.tubes" to the given tubes', () => {
+    state = {
+      tubes: {},
+    }
+    mutations.setTubes(state, tubes)
+    expect(state.tubes).toEqual(storePools.tubes)
+  })
+
+  it('"setLibraries" sets "state.libraries" to the given libraries', () => {
+    state = {
+      libraries: {},
+    }
+    mutations.setLibraries(state, libraries)
+    expect(state.libraries).toEqual(storePools.libraries)
+  })
+
+  it('"setTags" sets "state.tags" to the given tags', () => {
+    state = {
+      tags: {},
+    }
+    mutations.setTags(state, tags)
+    expect(state.tags).toEqual(storePools.tags)
+  })
+
+  it('"setRequests" sets "state.requests" to the given requests', () => {
+    state = {
+      requests: {},
+    }
+    mutations.setRequests(state, requests)
+    expect(state.requests).toEqual(storePools.requests)
+  })
+})
diff --git a/tests/unit/store/traction/pacbio/requests/actions.spec.js b/tests/unit/store/traction/pacbio/requests/actions.spec.js
index 3cc2d5e9a..518e0b2ed 100644
--- a/tests/unit/store/traction/pacbio/requests/actions.spec.js
+++ b/tests/unit/store/traction/pacbio/requests/actions.spec.js
@@ -1,6 +1,6 @@
 import Response from '@/api/Response'
 import * as Actions from '@/store/traction/pacbio/requests/actions'
-import { Data } from '../../../../testHelper'
+import { Data } from 'testHelper'
 
 let requests, failedResponse
 
diff --git a/tests/unit/store/traction/pacbio/requests/getters.spec.js b/tests/unit/store/traction/pacbio/requests/getters.spec.js
index 4cbc7c2d4..92b8d4d72 100644
--- a/tests/unit/store/traction/pacbio/requests/getters.spec.js
+++ b/tests/unit/store/traction/pacbio/requests/getters.spec.js
@@ -1,5 +1,5 @@
 import Response from '@/api/Response'
-import { Data } from '../../../../testHelper'
+import { Data } from 'testHelper'
 import getters from '@/store/traction/pacbio/requests/getters'
 
 let requests
diff --git a/tests/unit/store/traction/pacbio/requests/mutations.spec.js b/tests/unit/store/traction/pacbio/requests/mutations.spec.js
index 0e4573ace..ccef45865 100644
--- a/tests/unit/store/traction/pacbio/requests/mutations.spec.js
+++ b/tests/unit/store/traction/pacbio/requests/mutations.spec.js
@@ -1,5 +1,5 @@
 import Response from '@/api/Response'
-import { Data } from '../../../../testHelper'
+import { Data } from 'testHelper'
 import mutations from '@/store/traction/pacbio/requests/mutations'
 
 let requests
diff --git a/tests/unit/store/traction/pacbio/runs/actions.spec.js b/tests/unit/store/traction/pacbio/runs/actions.spec.js
index 44ceabd53..97067ee0f 100644
--- a/tests/unit/store/traction/pacbio/runs/actions.spec.js
+++ b/tests/unit/store/traction/pacbio/runs/actions.spec.js
@@ -1,6 +1,6 @@
 import Response from '@/api/Response'
 import * as Actions from '@/store/traction/pacbio/runs/actions'
-import { Data } from '../../../../testHelper'
+import { Data } from 'testHelper'
 import * as Run from '@/api/PacbioRun'
 
 describe('#setRuns', () => {
@@ -83,6 +83,15 @@ describe('#editRun', () => {
     commit = jest.fn()
   })
 
+  it('sets the well pools to have a barcode attribute', async () => {
+    mockRun.plate.wells.forEach((well) => {
+      well.pools.forEach((pool) => (pool.barcode = pool.tube.barcode))
+    })
+    find.mockReturnValue(Data.PacbioRun)
+    await Actions.editRun({ commit, getters }, mockRun.id)
+    expect(commit).toHaveBeenCalledWith('setCurrentRun', mockRun)
+  })
+
   it('successfully', async () => {
     find.mockReturnValue(Data.PacbioRun)
     await Actions.editRun({ commit, getters }, mockRun.id)
diff --git a/tests/unit/store/traction/pacbio/runs/getters.spec.js b/tests/unit/store/traction/pacbio/runs/getters.spec.js
index ba1972f94..5c0bea075 100644
--- a/tests/unit/store/traction/pacbio/runs/getters.spec.js
+++ b/tests/unit/store/traction/pacbio/runs/getters.spec.js
@@ -1,5 +1,5 @@
 import Response from '@/api/Response'
-import { Data } from '../../../../testHelper'
+import { Data } from 'testHelper'
 import getters from '@/store/traction/pacbio/runs/getters'
 
 let runs
diff --git a/tests/unit/store/traction/pacbio/runs/mutations.spec.js b/tests/unit/store/traction/pacbio/runs/mutations.spec.js
index 2231b2316..75ae563d0 100644
--- a/tests/unit/store/traction/pacbio/runs/mutations.spec.js
+++ b/tests/unit/store/traction/pacbio/runs/mutations.spec.js
@@ -1,6 +1,6 @@
-import * as Mutations from '@/store/traction/pacbio/runs/mutations'
+import Mutations from '@/store/traction/pacbio/runs/mutations'
 import * as Run from '@/api/PacbioRun'
-import { Data } from '../../../../testHelper'
+import { Data } from 'testHelper'
 import Response from '@/api/Response'
 
 describe('mutate', () => {
@@ -12,7 +12,7 @@ describe('mutate', () => {
   })
 
   it('can update the mutate the state, e.g setRuns', () => {
-    Mutations.default.setRuns(state, runs)
+    Mutations.setRuns(state, runs)
     expect(state.runs.length).toEqual(runs.length)
   })
 })
@@ -27,7 +27,7 @@ describe('mutateRun', () => {
 
   it('can update the mutate the state, e.g setSystemName', () => {
     let systemName = 'System 1'
-    Mutations.default.setSystemName(state, systemName)
+    Mutations.setSystemName(state, systemName)
     expect(state.currentRun.system_name).toEqual(systemName)
   })
 })
@@ -45,9 +45,9 @@ describe('createWell', () => {
   describe('when well does not exist', () => {
     it('creates the well', () => {
       position = 'A10'
-      Mutations.default.createWell(state, position)
+      Mutations.createWell(state, position)
 
-      let well = state.currentRun.plate.wells.filter((well) => well.position === position)[0]
+      let well = state.currentRun.plate.wells.find((well) => well.position === position)
       expect(well).toBeDefined()
       expect(well.position).toEqual(position)
       expect(well.generate_hifi).toEqual('In SMRT Link')
@@ -66,9 +66,9 @@ describe('mutateWell', () => {
   it('mutates the well, e.g. generate_hifi', () => {
     position = 'A10'
     let payload = { position: position, property: 'generate_hifi', with: 'generateHiFi' }
-    Mutations.default.mutateWell(state, payload)
+    Mutations.mutateWell(state, payload)
 
-    let well = state.currentRun.plate.wells.filter((well) => well.position === position)[0]
+    let well = state.currentRun.plate.wells.find((well) => well.position === position)
     expect(well.generate_hifi).toEqual('generateHiFi')
   })
 })
@@ -83,8 +83,8 @@ describe('addEmptyLibraryToWell', () => {
   })
 
   it('adds a library object to the given well', () => {
-    Mutations.default.addEmptyLibraryToWell(state, position)
-    let well = state.currentRun.plate.wells.filter((well) => well.position === position)[0]
+    Mutations.addEmptyLibraryToWell(state, position)
+    let well = state.currentRun.plate.wells.find((well) => well.position === position)
     expect(well.libraries.length).toEqual(1)
   })
 })
@@ -100,9 +100,9 @@ describe('removeLibraryFromWell', () => {
   })
 
   it('adds a library object to the given well', () => {
-    Mutations.default.addEmptyLibraryToWell(state, position)
-    Mutations.default.removeLibraryFromWell(state, payload)
-    let well = state.currentRun.plate.wells.filter((well) => well.position === position)[0]
+    Mutations.addEmptyLibraryToWell(state, position)
+    Mutations.removeLibraryFromWell(state, payload)
+    let well = state.currentRun.plate.wells.find((well) => well.position === position)
     expect(well.libraries.length).toEqual(0)
   })
 })
@@ -119,9 +119,9 @@ describe('addLibraryToWell', () => {
   })
 
   it('adds a library object to the given well', () => {
-    Mutations.default.addEmptyLibraryToWell(state, position)
-    Mutations.default.addLibraryToWell(state, payload)
-    let well = state.currentRun.plate.wells.filter((well) => well.position === position)[0]
+    Mutations.addEmptyLibraryToWell(state, position)
+    Mutations.addLibraryToWell(state, payload)
+    let well = state.currentRun.plate.wells.find((well) => well.position === position)
     expect(well.libraries[0]).toEqual(library1)
   })
 
@@ -129,10 +129,10 @@ describe('addLibraryToWell', () => {
     let library2 = { id: 2, barcode: 'TRAC-2' }
     let payload2 = { position: position, index: 1, with: library2 }
 
-    Mutations.default.addEmptyLibraryToWell(state, position)
-    Mutations.default.addLibraryToWell(state, payload)
-    Mutations.default.addLibraryToWell(state, payload2)
-    let well = state.currentRun.plate.wells.filter((well) => well.position === position)[0]
+    Mutations.addEmptyLibraryToWell(state, position)
+    Mutations.addLibraryToWell(state, payload)
+    Mutations.addLibraryToWell(state, payload2)
+    let well = state.currentRun.plate.wells.find((well) => well.position === position)
     expect(well.libraries.length).toEqual(2)
     expect(well.libraries[0]).toEqual(library1)
     expect(well.libraries[1]).toEqual(library2)
@@ -140,8 +140,81 @@ describe('addLibraryToWell', () => {
 
   it('can add a library to the given well without an index', () => {
     payload = { position: position, with: library1 }
-    Mutations.default.addLibraryToWell(state, payload)
-    let well = state.currentRun.plate.wells.filter((well) => well.position === position)[0]
+    Mutations.addLibraryToWell(state, payload)
+    let well = state.currentRun.plate.wells.find((well) => well.position === position)
     expect(well.libraries[0]).toEqual(library1)
   })
 })
+
+describe('addEmptyPoolToWell', () => {
+  let run, position, state
+
+  beforeEach(() => {
+    run = Run.build()
+    state = { currentRun: run }
+    position = 'F1'
+  })
+
+  it('adds a pool object to the given well', () => {
+    Mutations.addEmptyPoolToWell(state, position)
+    let well = state.currentRun.plate.wells.find((well) => well.position === position)
+    expect(well.pools.length).toEqual(1)
+  })
+})
+
+describe('removePoolFromWell', () => {
+  let run, payload, state, position
+
+  beforeEach(() => {
+    run = Run.build()
+    state = { currentRun: run }
+    position = 'A1'
+    payload = { index: 0, position: position }
+  })
+
+  it('removes a pool object to the given well', () => {
+    Mutations.addEmptyPoolToWell(state, position)
+    Mutations.removePoolFromWell(state, payload)
+    let well = state.currentRun.plate.wells.find((well) => well.position === position)
+    expect(well.pools.length).toEqual(0)
+  })
+})
+
+describe('addPoolToWell', () => {
+  let payload, state, position, pool1
+
+  beforeEach(() => {
+    let run = Run.build()
+    state = { currentRun: run }
+    position = 'A1'
+    pool1 = { id: 1, barcode: 'TRAC-1', type: 'pools', libraries: [] }
+    payload = { position: position, index: 0, with: pool1 }
+  })
+
+  it('adds a pool object to the given well', () => {
+    Mutations.addEmptyPoolToWell(state, position)
+    Mutations.addPoolToWell(state, payload)
+    let well = state.currentRun.plate.wells.find((well) => well.position === position)
+    expect(well.pools[0]).toEqual(pool1)
+  })
+
+  it('can add multiple pool objects to the given well', () => {
+    let pool2 = { id: 2, barcode: 'TRAC-2', type: 'pools', libraries: [] }
+    let payload2 = { position: position, index: 1, with: pool2 }
+
+    Mutations.addEmptyPoolToWell(state, position)
+    Mutations.addPoolToWell(state, payload)
+    Mutations.addPoolToWell(state, payload2)
+    let well = state.currentRun.plate.wells.find((well) => well.position === position)
+    expect(well.pools.length).toEqual(2)
+    expect(well.pools[0]).toEqual(pool1)
+    expect(well.pools[1]).toEqual(pool2)
+  })
+
+  it('can add a pool to the given well without an index', () => {
+    payload = { position: position, with: pool1 }
+    Mutations.addPoolToWell(state, payload)
+    let well = state.currentRun.plate.wells.find((well) => well.position === position)
+    expect(well.pools[0]).toEqual(pool1)
+  })
+})
diff --git a/tests/unit/store/traction/pacbio/tubes/actions.spec.js b/tests/unit/store/traction/pacbio/tubes/actions.spec.js
index 61e386271..12e1a84bb 100644
--- a/tests/unit/store/traction/pacbio/tubes/actions.spec.js
+++ b/tests/unit/store/traction/pacbio/tubes/actions.spec.js
@@ -1,4 +1,4 @@
-import { Data } from '../../../../testHelper'
+import { Data } from 'testHelper'
 import Response from '@/api/Response'
 import * as Actions from '@/store/traction/pacbio/tubes/actions'
 
diff --git a/tests/unit/store/traction/saphyr/requests/actions.spec.js b/tests/unit/store/traction/saphyr/requests/actions.spec.js
index 8af2560d8..0ad440f2f 100644
--- a/tests/unit/store/traction/saphyr/requests/actions.spec.js
+++ b/tests/unit/store/traction/saphyr/requests/actions.spec.js
@@ -1,6 +1,6 @@
 import Response from '@/api/Response'
 import * as Actions from '@/store/traction/saphyr/requests/actions'
-import { Data } from '../../../../testHelper'
+import { Data } from 'testHelper'
 
 let requests
 
diff --git a/tests/unit/store/traction/saphyr/requests/getters.spec.js b/tests/unit/store/traction/saphyr/requests/getters.spec.js
index e5c8930c0..ec8b2f6c2 100644
--- a/tests/unit/store/traction/saphyr/requests/getters.spec.js
+++ b/tests/unit/store/traction/saphyr/requests/getters.spec.js
@@ -1,5 +1,5 @@
 import Response from '@/api/Response'
-import { Data } from '../../../../testHelper'
+import { Data } from 'testHelper'
 import getters from '@/store/traction/saphyr/requests/getters'
 
 let requests
diff --git a/tests/unit/store/traction/saphyr/requests/mutations.spec.js b/tests/unit/store/traction/saphyr/requests/mutations.spec.js
index 1e17a2fc0..1972e0eaf 100644
--- a/tests/unit/store/traction/saphyr/requests/mutations.spec.js
+++ b/tests/unit/store/traction/saphyr/requests/mutations.spec.js
@@ -1,5 +1,5 @@
 import Response from '@/api/Response'
-import { Data } from '../../../../testHelper'
+import { Data } from 'testHelper'
 import mutations from '@/store/traction/saphyr/requests/mutations'
 
 let requests
diff --git a/tests/unit/store/traction/saphyr/runs/actions.spec.js b/tests/unit/store/traction/saphyr/runs/actions.spec.js
index 40899f4c9..e3f2b4f77 100644
--- a/tests/unit/store/traction/saphyr/runs/actions.spec.js
+++ b/tests/unit/store/traction/saphyr/runs/actions.spec.js
@@ -1,6 +1,6 @@
 import Response from '@/api/Response'
 import * as Actions from '@/store/traction/saphyr/runs/actions'
-import { Data } from '../../../../testHelper'
+import { Data } from 'testHelper'
 import * as Run from '@/api/SaphyrRun'
 
 describe('#setRuns', () => {
diff --git a/tests/unit/store/traction/saphyr/tubes/actions.spec.js b/tests/unit/store/traction/saphyr/tubes/actions.spec.js
index f3ab0875b..300095b37 100644
--- a/tests/unit/store/traction/saphyr/tubes/actions.spec.js
+++ b/tests/unit/store/traction/saphyr/tubes/actions.spec.js
@@ -1,4 +1,4 @@
-import { Data } from '../../../../testHelper'
+import { Data } from 'testHelper'
 import Response from '@/api/Response'
 import * as Actions from '@/store/traction/saphyr/tubes/actions'
 
diff --git a/tests/unit/views/Dashboard.spec.js b/tests/unit/views/Dashboard.spec.js
index 207567c90..aa7267436 100644
--- a/tests/unit/views/Dashboard.spec.js
+++ b/tests/unit/views/Dashboard.spec.js
@@ -1,18 +1,10 @@
 import Dashboard from '@/views/Dashboard'
-import { mount, localVue, store } from '../testHelper'
-import VueRouter from 'vue-router'
+import { mount, localVue, store, router } from 'testHelper'
 
 describe('Dashboard.vue', () => {
-  let wrapper, router, box, dashboard
+  let wrapper, box, dashboard
 
   beforeEach(() => {
-    router = new VueRouter({
-      routes: [
-        { path: '/saphyr', name: 'Saphyr' },
-        { path: '/pacbio', name: 'Pacbio' },
-        { path: '/ont', name: 'ONT' },
-      ],
-    })
     wrapper = mount(Dashboard, { router, localVue, store })
     dashboard = wrapper.vm
   })
diff --git a/tests/unit/views/PageNotFound.spec.js b/tests/unit/views/PageNotFound.spec.js
index f71e2f73f..5e839b739 100644
--- a/tests/unit/views/PageNotFound.spec.js
+++ b/tests/unit/views/PageNotFound.spec.js
@@ -1,6 +1,5 @@
 import PageNotFound from '@/views/PageNotFound'
-import { mount, localVue } from '../testHelper'
-import VueRouter from 'vue-router'
+import { mount, localVue, router } from 'testHelper'
 
 /*
 Add this to router
@@ -14,16 +13,9 @@ it('will redirect to page not found if invalid path', () => {
 })
 */
 describe('PageNotFound.vue', () => {
-  let wrapper, router
+  let wrapper
 
   beforeEach(() => {
-    router = new VueRouter({
-      routes: [
-        { path: '/dashboard', name: 'Dashboard' },
-        { path: '/saphyr/runs', name: 'SaphyrRuns' },
-        { path: '/pacbio/runs', name: 'PacbioRunIndex' },
-      ],
-    })
     wrapper = mount(PageNotFound, { router, localVue })
   })
 
diff --git a/tests/unit/views/PipelineView.spec.js b/tests/unit/views/PipelineView.spec.js
index 6cea60078..443ef4646 100644
--- a/tests/unit/views/PipelineView.spec.js
+++ b/tests/unit/views/PipelineView.spec.js
@@ -1,19 +1,10 @@
-import { mount, localVue } from '../testHelper'
+import { mount, localVue, router } from 'testHelper'
 import PipelineView from '@/views/PipelineView'
-import VueRouter from 'vue-router'
 
 describe('PipelineView', () => {
-  let wrapper, pipelineView, router, store
+  let wrapper, pipelineView, store
 
   beforeEach(() => {
-    router = new VueRouter({
-      routes: [
-        { path: '/dashboard', name: 'Dashboard' },
-        { path: '/saphyr/runs', name: 'SaphyrRuns' },
-        { path: '/pacbio/runs', name: 'PacbioRuns' },
-      ],
-    })
-
     localStorage.setItem('pipeline', 'pacbio')
 
     wrapper = mount(PipelineView, { store, localVue, router })
diff --git a/tests/unit/views/ont/OntHeronRun.spec.js b/tests/unit/views/ont/OntHeronRun.spec.js
index 15a739ae4..a5c7eb23a 100644
--- a/tests/unit/views/ont/OntHeronRun.spec.js
+++ b/tests/unit/views/ont/OntHeronRun.spec.js
@@ -1,5 +1,5 @@
 import OntHeronRun from '@/views/ont/OntHeronRun'
-import { localVue, mount } from '../../testHelper'
+import { localVue, mount } from 'testHelper'
 
 describe('OntHeronRun.vue', () => {
   let wrapper, run, mutate, query, props
diff --git a/tests/unit/views/ont/OntHeronRuns.spec.js b/tests/unit/views/ont/OntHeronRuns.spec.js
index 9cc06aaeb..90569cd12 100644
--- a/tests/unit/views/ont/OntHeronRuns.spec.js
+++ b/tests/unit/views/ont/OntHeronRuns.spec.js
@@ -1,5 +1,5 @@
 import OntHeronRuns from '@/views/ont/OntHeronRuns'
-import { localVue, mount } from '../../testHelper'
+import { localVue, mount } from 'testHelper'
 
 describe('OntHeronRuns.vue', () => {
   let wrapper, runs, runsData
diff --git a/tests/unit/views/ont/OntLibraries.spec.js b/tests/unit/views/ont/OntLibraries.spec.js
index a87296e98..3fff74d5e 100644
--- a/tests/unit/views/ont/OntLibraries.spec.js
+++ b/tests/unit/views/ont/OntLibraries.spec.js
@@ -1,5 +1,5 @@
 import OntLibraries from '@/views/ont/OntLibraries'
-import { localVue, mount } from '../../testHelper'
+import { localVue, mount } from 'testHelper'
 
 describe('OntLibraries.vue', () => {
   let wrapper, libraries, librariesData, mutate, mockApollo //, refetchLibraries
diff --git a/tests/unit/views/ont/OntPlates.spec.js b/tests/unit/views/ont/OntPlates.spec.js
index 2138669fe..3d4d78c71 100644
--- a/tests/unit/views/ont/OntPlates.spec.js
+++ b/tests/unit/views/ont/OntPlates.spec.js
@@ -1,5 +1,5 @@
 import OntPlates from '@/views/ont/OntPlates'
-import { localVue, mount } from '../../testHelper'
+import { localVue, mount } from 'testHelper'
 
 describe('OntPlates.vue', () => {
   let wrapper, plates, platesData
diff --git a/tests/unit/views/ont/OntReception.spec.js b/tests/unit/views/ont/OntReception.spec.js
index 99bd6d492..1e086fd52 100644
--- a/tests/unit/views/ont/OntReception.spec.js
+++ b/tests/unit/views/ont/OntReception.spec.js
@@ -1,7 +1,6 @@
 import Reception from '@/views/ont/OntReception'
-import { mount, localVue, Data } from '../../testHelper'
+import { mount, localVue, Data, store } from 'testHelper'
 import Response from '@/api/Response'
-import store from '@/store'
 import { transformPlates, OntSample } from '@/services/Sequencescape'
 import flushPromises from 'flush-promises'
 
diff --git a/tests/unit/views/pacbio/PacbioLibraryIndex.spec.js b/tests/unit/views/pacbio/PacbioLibraryIndex.spec.js
index 381c85c30..29fb4ef65 100644
--- a/tests/unit/views/pacbio/PacbioLibraryIndex.spec.js
+++ b/tests/unit/views/pacbio/PacbioLibraryIndex.spec.js
@@ -1,11 +1,10 @@
 import Libraries from '@/views/pacbio/PacbioLibraryIndex'
-import { mount, localVue, Data, store } from '../../testHelper'
+import { mount, localVue, Data, store, router } from 'testHelper'
 import * as consts from '@/consts/consts'
-import VueRouter from 'vue-router'
 import Response from '@/api/Response'
 
 describe('Libraries.vue', () => {
-  let wrapper, libraries, mockLibraries, router
+  let wrapper, libraries, mockLibraries
 
   beforeEach(() => {
     mockLibraries = [
@@ -23,6 +22,10 @@ describe('Libraries.vue', () => {
           fragment_size: 100,
           created_at: '03/12/2019 11:49',
         },
+        pool: {
+          id: '1',
+          type: 'pools',
+        },
       },
       {
         id: 2,
@@ -38,22 +41,15 @@ describe('Libraries.vue', () => {
           fragment_size: 100,
           created_at: '03/12/2019 11:49',
         },
+        pool: {
+          id: '1',
+          type: 'pools',
+        },
       },
     ]
 
     store.commit('traction/pacbio/libraries/setLibraries', mockLibraries)
 
-    router = new VueRouter({
-      routes: [
-        {
-          path: '/pacbio/libraries',
-          name: 'PacbioLibraries',
-          component: Libraries,
-          props: true,
-        },
-      ],
-    })
-
     wrapper = mount(Libraries, {
       store,
       router,
@@ -154,15 +150,6 @@ describe('Libraries.vue', () => {
     })
   })
 
-  describe('Details button', () => {
-    let button
-
-    it('is present for each sample', () => {
-      button = wrapper.find('#details-btn-1')
-      expect(button.text()).toEqual('Show Details')
-    })
-  })
-
   describe('Edit button', () => {
     let button
 
diff --git a/tests/unit/views/pacbio/PacbioPlateIndex.spec.js b/tests/unit/views/pacbio/PacbioPlateIndex.spec.js
index ec9be5253..1ace4e225 100644
--- a/tests/unit/views/pacbio/PacbioPlateIndex.spec.js
+++ b/tests/unit/views/pacbio/PacbioPlateIndex.spec.js
@@ -1,25 +1,14 @@
 import PacbioPlates from '@/views/pacbio/PacbioPlateIndex'
-import { mount, localVue, store, Data } from '../../testHelper'
+import { mount, localVue, store, Data, router } from 'testHelper'
 import Response from '@/api/Response'
-import VueRouter from 'vue-router'
 
 describe('PacbioPlates.vue', () => {
-  let wrapper, plates, mockPlates, router
+  let wrapper, plates, mockPlates
 
   beforeEach(() => {
     mockPlates = new Response(Data.PacbioPlates).deserialize.plates
     store.commit('traction/pacbio/plates/setPlates', mockPlates)
 
-    router = new VueRouter({
-      routes: [
-        {
-          path: '/pacbio/plates',
-          name: 'PacbioPlates',
-          component: PacbioPlates,
-        },
-      ],
-    })
-
     wrapper = mount(PacbioPlates, {
       store,
       router,
diff --git a/tests/unit/views/pacbio/PacbioPoolCreate.spec.js b/tests/unit/views/pacbio/PacbioPoolCreate.spec.js
new file mode 100644
index 000000000..b9cbf372c
--- /dev/null
+++ b/tests/unit/views/pacbio/PacbioPoolCreate.spec.js
@@ -0,0 +1,43 @@
+import PacbioPoolCreate from '@/views/pacbio/PacbioPoolCreate'
+import { mount, localVue, store, Data } from 'testHelper'
+import flushPromises from 'flush-promises'
+
+describe('PacbioPoolCreate', () => {
+  it('will fetch all of the data', async () => {
+    const {
+      state: {
+        api: {
+          traction: {
+            pacbio: { plates: platesRequest, tag_sets: tagSetsRequest },
+          },
+        },
+      },
+    } = store
+
+    platesRequest.get = jest.fn(() => Data.PacbioPlatesRequest)
+    tagSetsRequest.get = jest.fn(() => Data.PacbioTagSets)
+
+    mount(PacbioPoolCreate, {
+      localVue,
+      store,
+    })
+
+    await flushPromises()
+
+    const {
+      state: {
+        traction: {
+          pacbio: {
+            poolCreate: {
+              resources: { plates, tagSets },
+            },
+          },
+        },
+      },
+    } = store
+
+    // TODO: implement fetchPacbioPlates
+    expect(Object.keys(plates).length).toBeGreaterThan(0)
+    expect(Object.keys(tagSets).length).toBeGreaterThan(0)
+  })
+})
diff --git a/tests/unit/views/pacbio/PacbioReceptionTube.spec.js b/tests/unit/views/pacbio/PacbioReceptionTube.spec.js
index 309ae7f76..14252bd70 100644
--- a/tests/unit/views/pacbio/PacbioReceptionTube.spec.js
+++ b/tests/unit/views/pacbio/PacbioReceptionTube.spec.js
@@ -1,21 +1,11 @@
 import Reception from '@/views/pacbio/PacbioReceptionTube'
-import { mount, localVue, store, Data } from '../../testHelper'
+import { mount, localVue, store, Data, router } from 'testHelper'
 import Response from '@/api/Response'
-import Samples from '@/views/pacbio/PacbioSampleIndex'
-import Libraries from '@/views/pacbio/PacbioLibraryIndex'
-import VueRouter from 'vue-router'
 
 describe('Reception', () => {
-  let wrapper, reception, barcodes, barcode, input, router
+  let wrapper, reception, barcodes, barcode, input
 
   beforeEach(() => {
-    router = new VueRouter({
-      routes: [
-        { path: '/pacbio/samples', name: 'PacbioSamples', component: Samples, props: true },
-        { path: '/pacbio/libraries', name: 'PacbioLibraries', component: Libraries, props: true },
-      ],
-    })
-
     barcodes = 'TRAC-1\nTRAC-2\nTRAC-3\nTRAC-4\nTRAC-5'
     wrapper = mount(Reception, { localVue, router })
     reception = wrapper.vm
diff --git a/tests/unit/views/pacbio/PacbioRunIndex.spec.js b/tests/unit/views/pacbio/PacbioRunIndex.spec.js
index fc7f937c8..e92415402 100644
--- a/tests/unit/views/pacbio/PacbioRunIndex.spec.js
+++ b/tests/unit/views/pacbio/PacbioRunIndex.spec.js
@@ -1,26 +1,13 @@
 import PacbioRuns from '@/views/pacbio/PacbioRunIndex'
-import PacbioRun from '@/views/pacbio/PacbioRunShow'
-import { mount, localVue, store, Data } from '../../testHelper'
+import { mount, localVue, store, Data, router } from 'testHelper'
 import Response from '@/api/Response'
-import VueRouter from 'vue-router'
 
 describe('Runs.vue', () => {
-  let wrapper, runs, mockRuns, router
+  let wrapper, runs, mockRuns
 
   beforeEach(() => {
     mockRuns = new Response(Data.PacbioRuns).deserialize.runs
 
-    router = new VueRouter({
-      routes: [
-        {
-          path: '/pacbio/runs/:id',
-          name: 'PacbioRun',
-          component: PacbioRun,
-          props: true,
-        },
-      ],
-    })
-
     store.commit('traction/pacbio/runs/setRuns', mockRuns)
 
     wrapper = mount(PacbioRuns, { store, router, localVue })
@@ -173,6 +160,30 @@ describe('Runs.vue', () => {
     })
   })
 
+  describe('generate sample sheet button', () => {
+    let button
+
+    it('it exists when the run has wells with pools', () => {
+      button = wrapper.find('#generate-sample-sheet-1')
+      expect(button.isVisible()).toBe(true) // button is shown
+    })
+
+    it('it does not exist when the run has wells without pools', () => {
+      mockRuns[0].all_wells_have_pools = false
+      store.commit('traction/pacbio/runs/setRuns', mockRuns)
+      wrapper = mount(PacbioRuns, { store, router, localVue })
+
+      button = wrapper.find('#generate-sample-sheet-1')
+      expect(button.isVisible()).toBe(false) // button is hidden
+    })
+
+    it('on click generateSampleSheetPath is called', () => {
+      button = wrapper.find('#generate-sample-sheet-1')
+
+      expect(button.attributes('href')).toEqual(runs.generateSampleSheetPath(1))
+    })
+  })
+
   describe('sorting', () => {
     it('will sort the runs by created at', () => {
       expect(
diff --git a/tests/unit/views/pacbio/PacbioRunShow.spec.js b/tests/unit/views/pacbio/PacbioRunShow.spec.js
index c4aa61c0a..97daa881a 100644
--- a/tests/unit/views/pacbio/PacbioRunShow.spec.js
+++ b/tests/unit/views/pacbio/PacbioRunShow.spec.js
@@ -1,19 +1,10 @@
 import PacbioRun from '@/views/pacbio/PacbioRunShow'
-import PacbioRuns from '@/views/pacbio/PacbioRunIndex'
-import VueRouter from 'vue-router'
-import { localVue, mount, store } from '../../testHelper'
+import { localVue, mount, store, router } from 'testHelper'
 
 describe('Run.vue', () => {
-  let wrapper, mockRun, router, pacbioRun
+  let wrapper, mockRun, pacbioRun
 
   beforeEach(() => {
-    router = new VueRouter({
-      routes: [
-        { path: '/run/:id', name: 'PacbioRunShow', component: PacbioRun },
-        { path: '/runs', name: 'PacbioRunIndex', component: PacbioRuns },
-      ],
-    })
-
     mockRun = {
       id: '1',
       name: '',
@@ -40,7 +31,7 @@ describe('Run.vue', () => {
       localVue,
       stubs: {
         Plate: true,
-        PacbioLibraryList: true,
+        pacbioPoolList: true,
         PacbioRunInfoEdit: true,
       },
       propsData: { id: 'new' },
@@ -62,7 +53,7 @@ describe('Run.vue', () => {
 
   describe('Pacbio Libraries Table', () => {
     it('dispays the pacbio library table', () => {
-      expect(wrapper.findComponent({ ref: 'PacbioLibraryList' })).toBeTruthy()
+      expect(wrapper.findComponent({ ref: 'pacbioPoolList' })).toBeTruthy()
     })
   })
 
@@ -73,10 +64,11 @@ describe('Run.vue', () => {
   })
 
   describe('Back button', () => {
+    // TODO: not sure this is needed anymore?
     it('will always show', () => {
       expect(wrapper.find('#backToRunsButton').exists()).toBeTruthy()
       wrapper.find('#backToRunsButton').trigger('click')
-      expect(wrapper.vm.$route.path).toBe('/runs')
+      expect(wrapper.vm.$route.path).toBe('/pacbio/runs')
     })
   })
 
@@ -137,7 +129,7 @@ describe('Run.vue', () => {
         propsData: { id: 1 },
         stubs: {
           Plate: true,
-          PacbioLibraryList: true,
+          pacbioPoolList: true,
           PacbioRunInfoEdit: true,
         },
       })
diff --git a/tests/unit/views/pacbio/PacbioSampleIndex.spec.js b/tests/unit/views/pacbio/PacbioSampleIndex.spec.js
index 48885ad1d..aa582d0f7 100644
--- a/tests/unit/views/pacbio/PacbioSampleIndex.spec.js
+++ b/tests/unit/views/pacbio/PacbioSampleIndex.spec.js
@@ -1,27 +1,15 @@
 import Samples from '@/views/pacbio/PacbioSampleIndex'
-import { mount, localVue, store, Data } from '../../testHelper'
-import VueRouter from 'vue-router'
+import { mount, localVue, store, Data, router } from 'testHelper'
 import Response from '@/api/Response'
 
 // TODO: why do we need to set sortDesc to false? I think we also need to isolate tests
 describe('Samples.vue', () => {
-  let wrapper, samples, mockSamples, router
+  let wrapper, samples, mockSamples
 
   beforeEach(() => {
     mockSamples = new Response(Data.TractionPacbioSamples).deserialize.requests
     store.commit('traction/pacbio/requests/setRequests', mockSamples)
 
-    router = new VueRouter({
-      routes: [
-        {
-          path: '/pacbio/samples',
-          name: 'PacbioSamples',
-          component: Samples,
-          props: true,
-        },
-      ],
-    })
-
     wrapper = mount(Samples, {
       store,
       router,
diff --git a/tests/unit/views/saphyr/SaphyrLibraries.spec.js b/tests/unit/views/saphyr/SaphyrLibraries.spec.js
index b785ceed4..49656b03e 100644
--- a/tests/unit/views/saphyr/SaphyrLibraries.spec.js
+++ b/tests/unit/views/saphyr/SaphyrLibraries.spec.js
@@ -1,5 +1,5 @@
 import Libraries from '@/views/saphyr/SaphyrLibraries'
-import { mount, localVue, store, Data } from '../../testHelper'
+import { mount, localVue, store, Data } from 'testHelper'
 import Alert from '@/components/Alert'
 import * as consts from '@/consts/consts'
 import VueRouter from 'vue-router'
diff --git a/tests/unit/views/saphyr/SaphyrReception.spec.js b/tests/unit/views/saphyr/SaphyrReception.spec.js
index 73e1e844f..939728d00 100644
--- a/tests/unit/views/saphyr/SaphyrReception.spec.js
+++ b/tests/unit/views/saphyr/SaphyrReception.spec.js
@@ -1,5 +1,5 @@
 import Reception from '@/views/saphyr/SaphyrReception'
-import { mount, localVue, store, Data } from '../../testHelper'
+import { mount, localVue, store, Data } from 'testHelper'
 import Response from '@/api/Response'
 
 describe('Reception', () => {
diff --git a/tests/unit/views/saphyr/SaphyrRun.spec.js b/tests/unit/views/saphyr/SaphyrRun.spec.js
index 80c18f936..181db9b18 100644
--- a/tests/unit/views/saphyr/SaphyrRun.spec.js
+++ b/tests/unit/views/saphyr/SaphyrRun.spec.js
@@ -1,6 +1,6 @@
 import SaphyrRun from '@/views/saphyr/SaphyrRun'
 import VueRouter from 'vue-router'
-import { localVue, mount, store } from '../../testHelper'
+import { localVue, mount, store } from 'testHelper'
 
 describe('Run.vue', () => {
   let wrapper, mockRun, saphyrRun, router, props
diff --git a/tests/unit/views/saphyr/SaphyrRuns.spec.js b/tests/unit/views/saphyr/SaphyrRuns.spec.js
index ffe8f2bdf..9a36b028f 100644
--- a/tests/unit/views/saphyr/SaphyrRuns.spec.js
+++ b/tests/unit/views/saphyr/SaphyrRuns.spec.js
@@ -1,26 +1,13 @@
 import Runs from '@/views/saphyr/SaphyrRuns'
-import { mount, localVue, store, Data } from '../../testHelper'
+import { mount, localVue, store, Data, router } from 'testHelper'
 import Response from '@/api/Response'
-import SaphyrRun from '@/views/saphyr/SaphyrRun'
-import VueRouter from 'vue-router'
 
 describe('Runs.vue', () => {
-  let wrapper, runs, mockRuns, router
+  let wrapper, runs, mockRuns
 
   beforeEach(() => {
     mockRuns = new Response(Data.Runs).deserialize.runs
 
-    router = new VueRouter({
-      routes: [
-        {
-          path: '/saphyr/runs/:id',
-          name: 'saphyr',
-          component: SaphyrRun,
-          props: true,
-        },
-      ],
-    })
-
     store.commit('traction/saphyr/runs/setRuns', mockRuns)
 
     wrapper = mount(Runs, { store, localVue, router })
diff --git a/tests/unit/views/saphyr/SaphyrSamples.spec.js b/tests/unit/views/saphyr/SaphyrSamples.spec.js
index cd2c8d86c..3fa6587da 100644
--- a/tests/unit/views/saphyr/SaphyrSamples.spec.js
+++ b/tests/unit/views/saphyr/SaphyrSamples.spec.js
@@ -1,24 +1,16 @@
 import Samples from '@/views/saphyr/SaphyrSamples'
-import { mount, localVue, store, Data } from '../../testHelper'
-import Libraries from '@/views/saphyr/SaphyrLibraries'
-import VueRouter from 'vue-router'
+import { mount, localVue, store, Data, router } from 'testHelper'
 import Alert from '@/components/Alert'
 import * as consts from '@/consts/consts'
 import Response from '@/api/Response'
 
 describe('Samples.vue', () => {
-  let wrapper, samples, router, mockSamples
+  let wrapper, samples, mockSamples
 
   beforeEach(() => {
     mockSamples = new Response(Data.TractionSaphyrRequests).deserialize.requests
     store.commit('traction/saphyr/requests/setRequests', mockSamples)
 
-    router = new VueRouter({
-      routes: [
-        { path: '/saphyr/libraries', name: 'SaphyrLibraries', component: Libraries, props: true },
-      ],
-    })
-
     wrapper = mount(Samples, {
       localVue,
       store,
diff --git a/yarn.lock b/yarn.lock
index 344338843..52f7926ea 100644
--- a/yarn.lock
+++ b/yarn.lock
@@ -1165,9 +1165,9 @@
   integrity sha512-LIZMuJk38pk9U9Ur4YzHjlIyMuxPlACdBIHH9/nGYVTsaGKOSnSuELiE8vS9wa+dJpIYspYUOqk+L1Q4pgHQHQ==
 
 "@vue/test-utils@^1.0.0-beta.20":
-  version "1.2.0"
-  resolved "https://registry.yarnpkg.com/@vue/test-utils/-/test-utils-1.2.0.tgz#3bc8c17ed549157275f0aec6b95da40887f7297f"
-  integrity sha512-poBTLqeJYNq1TXVhtVfnY8vELUVOFdJY8KZZoUuaAkIqPTWsxonU1M8nMWpZT+xEMrM+49+YcuEqtMHVD9Q9gw==
+  version "1.2.1"
+  resolved "https://registry.yarnpkg.com/@vue/test-utils/-/test-utils-1.2.1.tgz#4671fc8844e09ccddb6801ceedd7b7309ae11d06"
+  integrity sha512-WBRdWNJwWTodJlV9mjunTrhgfsTPI5tMuxsCxqSmQs+vyB3ccZIYixnBrkxpKRsXyah/RtEv6+kUPZhnLd9smA==
   dependencies:
     dom-event-types "^1.0.0"
     lodash "^4.17.15"
@@ -3083,9 +3083,9 @@ condense-newlines@^0.2.1:
     kind-of "^3.0.2"
 
 config-chain@^1.1.12:
-  version "1.1.12"
-  resolved "https://registry.yarnpkg.com/config-chain/-/config-chain-1.1.12.tgz#0fde8d091200eb5e808caf25fe618c02f48e4efa"
-  integrity sha512-a1eOIcu8+7lUInge4Rpf/n4Krkf3Dd9lqhljRzII1/Zno/kRtUWnznPO3jOKBmTEktkt3fkxisUcivoj0ebzoA==
+  version "1.1.13"
+  resolved "https://registry.yarnpkg.com/config-chain/-/config-chain-1.1.13.tgz#fad0795aa6a6cdaff9ed1b68e9dff94372c232f4"
+  integrity sha512-qj+f8APARXHrM0hraqXYb2/bOVSV4PvJQlNZ/DVj0QrmNM2q2euizkeuVckQ57J+W0mRH6Hvi+k50M4Jul2VRQ==
   dependencies:
     ini "^1.3.4"
     proto-list "~1.2.1"
@@ -5223,7 +5223,7 @@ glob-to-regexp@^0.3.0:
   resolved "https://registry.yarnpkg.com/glob-to-regexp/-/glob-to-regexp-0.3.0.tgz#8c5a1494d2066c570cc3bfe4496175acc4d502ab"
   integrity sha1-jFoUlNIGbFcMw7/kSWF1rMTVAqs=
 
-glob@^7.0.0, glob@^7.0.3, glob@^7.1.1, glob@^7.1.2, glob@^7.1.3, glob@^7.1.4, glob@~7.1.1:
+glob@^7.0.0, glob@^7.0.3, glob@^7.1.1, glob@^7.1.2, glob@^7.1.4, glob@~7.1.1:
   version "7.1.6"
   resolved "https://registry.yarnpkg.com/glob/-/glob-7.1.6.tgz#141f33b81a7c2492e125594307480c46679278a6"
   integrity sha512-LwaxwyZ72Lk7vZINtNNrywX0ZuLyStrdDtabefZKAY5ZGJhVtgdznluResxNmPitE0SAO+O26sWTHeKSI2wMBA==
@@ -5235,6 +5235,18 @@ glob@^7.0.0, glob@^7.0.3, glob@^7.1.1, glob@^7.1.2, glob@^7.1.3, glob@^7.1.4, gl
     once "^1.3.0"
     path-is-absolute "^1.0.0"
 
+glob@^7.1.3:
+  version "7.1.7"
+  resolved "https://registry.yarnpkg.com/glob/-/glob-7.1.7.tgz#3b193e9233f01d42d0b3f78294bbeeb418f94a90"
+  integrity sha512-OvD9ENzPLbegENnYP5UUfJIirTg4+XwMWGaQfQTY0JenxNvvIKP3U3/tAQSPIu/lHxXYSZmpXlUHeqAIdKzBLQ==
+  dependencies:
+    fs.realpath "^1.0.0"
+    inflight "^1.0.4"
+    inherits "2"
+    minimatch "^3.0.4"
+    once "^1.3.0"
+    path-is-absolute "^1.0.0"
+
 global-dirs@^0.1.0:
   version "0.1.1"
   resolved "https://registry.yarnpkg.com/global-dirs/-/global-dirs-0.1.1.tgz#b319c0dd4607f353f3be9cca4c72fc148c49f445"
@@ -5341,9 +5353,9 @@ graphql-tag@^2.4.2:
   integrity sha512-VmsD5pJqWJnQZMUeRwrDhfgoyqcfwEkvtpANqcoUG8/tOLkwNgU9mzub/Mc78OJMhHjx7gfAMTxzdG43VGg3bA==
 
 graphql@^15.4.0:
-  version "15.5.0"
-  resolved "https://registry.yarnpkg.com/graphql/-/graphql-15.5.0.tgz#39d19494dbe69d1ea719915b578bf920344a69d5"
-  integrity sha512-OmaM7y0kaK31NKG31q4YbD2beNYa6jBBKtMFT6gLYJljHLJr42IqJ8KX08u3Li/0ifzTU5HjmoOOrwa5BRLeDA==
+  version "15.5.1"
+  resolved "https://registry.yarnpkg.com/graphql/-/graphql-15.5.1.tgz#f2f84415d8985e7b84731e7f3536f8bb9d383aad"
+  integrity sha512-FeTRX67T3LoE3LWAxxOlW2K3Bz+rMYAC18rRguK4wgXaTZMiJwSUwDmPFo3UadAKbzirKIg5Qy+sNJXbpPRnQw==
 
 growl@^1.10.0:
   version "1.10.5"
@@ -6850,7 +6862,17 @@ js-base64@^2.1.8:
   resolved "https://registry.yarnpkg.com/js-base64/-/js-base64-2.6.4.tgz#f4e686c5de1ea1f867dbcad3d46d969428df98c4"
   integrity sha512-pZe//GGmwJndub7ZghVHz7vjb2LgC1m8B07Au3eYqeqv9emhESByMXxaEgkUkEqJe87oBbSniGYoQNIBklc7IQ==
 
-js-beautify@^1.6.12, js-beautify@^1.6.14:
+js-beautify@^1.6.12:
+  version "1.14.0"
+  resolved "https://registry.yarnpkg.com/js-beautify/-/js-beautify-1.14.0.tgz#2ce790c555d53ce1e3d7363227acf5dc69024c2d"
+  integrity sha512-yuck9KirNSCAwyNJbqW+BxJqJ0NLJ4PwBUzQQACl5O3qHMBXVkXb/rD0ilh/Lat/tn88zSZ+CAHOlk0DsY7GuQ==
+  dependencies:
+    config-chain "^1.1.12"
+    editorconfig "^0.15.3"
+    glob "^7.1.3"
+    nopt "^5.0.0"
+
+js-beautify@^1.6.14:
   version "1.13.13"
   resolved "https://registry.yarnpkg.com/js-beautify/-/js-beautify-1.13.13.tgz#756907d1728f329f2b84c42efd56ad17514620bf"
   integrity sha512-oH+nc0U5mOAqX8M5JO1J0Pw/7Q35sAdOsM5W3i87pir9Ntx6P/5Gx1xLNoK+MGyvHk4rqqRCE4Oq58H6xl2W7A==
@@ -11388,9 +11410,9 @@ vue-loader@^15.7.0:
     vue-style-loader "^4.1.0"
 
 vue-router@^3.5.1:
-  version "3.5.1"
-  resolved "https://registry.yarnpkg.com/vue-router/-/vue-router-3.5.1.tgz#edf3cf4907952d1e0583e079237220c5ff6eb6c9"
-  integrity sha512-RRQNLT8Mzr8z7eL4p7BtKvRaTSGdCbTy2+Mm5HTJvLGYSSeG9gDzNasJPP/yOYKLy+/cLG/ftrqq5fvkFwBJEw==
+  version "3.5.2"
+  resolved "https://registry.yarnpkg.com/vue-router/-/vue-router-3.5.2.tgz#5f55e3f251970e36c3e8d88a7cd2d67a350ade5c"
+  integrity sha512-807gn82hTnjCYGrnF3eNmIw/dk7/GE4B5h69BlyCK9KHASwSloD1Sjcn06zg9fVG4fYH2DrsNBZkpLtb25WtaQ==
 
 vue-simple-spinner@^1.2.10:
   version "1.2.10"
@@ -11406,9 +11428,9 @@ vue-style-loader@^4.1.0:
     loader-utils "^1.0.2"
 
 vue-template-compiler@^2.6.12:
-  version "2.6.12"
-  resolved "https://registry.yarnpkg.com/vue-template-compiler/-/vue-template-compiler-2.6.12.tgz#947ed7196744c8a5285ebe1233fe960437fcc57e"
-  integrity sha512-OzzZ52zS41YUbkCBfdXShQTe69j1gQDZ9HIX8miuC9C3rBCk9wIRjLiZZLrmX9V+Ftq/YEyv1JaVr5Y/hNtByg==
+  version "2.6.14"
+  resolved "https://registry.yarnpkg.com/vue-template-compiler/-/vue-template-compiler-2.6.14.tgz#a2f0e7d985670d42c9c9ee0d044fed7690f4f763"
+  integrity sha512-ODQS1SyMbjKoO1JBJZojSw6FE4qnh9rIpUZn2EUT86FKizx9uH5z6uXiIrm4/Nb/gwxTi/o17ZDEGWAXHvtC7g==
   dependencies:
     de-indent "^1.0.2"
     he "^1.1.0"
@@ -11419,9 +11441,9 @@ vue-template-es2015-compiler@^1.6.0, vue-template-es2015-compiler@^1.9.0:
   integrity sha512-4gDntzrifFnCEvyoO8PqyJDmguXgVPxKiIxrBKjIowvL9l+N66196+72XVYR8BBf1Uv1Fgt3bGevJ+sEmxfZzw==
 
 vue@^2.6.12:
-  version "2.6.12"
-  resolved "https://registry.yarnpkg.com/vue/-/vue-2.6.12.tgz#f5ebd4fa6bd2869403e29a896aed4904456c9123"
-  integrity sha512-uhmLFETqPPNyuLLbsKz6ioJ4q7AZHzD8ZVFNATNyICSZouqP2Sz0rotWQC8UNBF6VGSCs5abnKJoStA6JbCbfg==
+  version "2.6.14"
+  resolved "https://registry.yarnpkg.com/vue/-/vue-2.6.14.tgz#e51aa5250250d569a3fbad3a8a5a687d6036e235"
+  integrity sha512-x2284lgYvjOMj3Za7kqzRcUSxBboHqtgRE2zlos1qWaOye5yUmHn42LB1250NJBLRwEcdrB0JRwyPTEPhfQjiQ==
 
 vuex@^3.6.2:
   version "3.6.2"