-
Notifications
You must be signed in to change notification settings - Fork 1
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Merge branch 'master' into issue-303
# Conflicts: # tiny/cwl/tools/tiny-count.cwl # tiny/rna/counter/counter.py
- Loading branch information
Showing
38 changed files
with
657 additions
and
364 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Binary file not shown.
Binary file not shown.
File renamed without changes.
File renamed without changes.
File renamed without changes.
File renamed without changes.
File renamed without changes.
File renamed without changes.
2 changes: 2 additions & 0 deletions
2
tests/testdata/counter/non-collapsed.sam → tests/testdata/counter/sam/non-collapsed.sam
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,2 +1,4 @@ | ||
@HD SO:unsorted | ||
@SQ SN:I LN:21 | ||
@PG ID:bowtie | ||
NON_COLLAPSED_QNAME 16 I 15064570 255 21M * 0 0 CAAGACAGAGCTTCACCGTTC IIIIIIIIIIIIIIIIIIIII XA:i:0 MD:Z:21 NM:i:0 XM:i:2 |
2 changes: 2 additions & 0 deletions
2
tests/testdata/counter/single.sam → tests/testdata/counter/sam/single.sam
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,2 +1,4 @@ | ||
@HD SO:unsorted | ||
@SQ SN:I LN:21 | ||
@PG ID:bowtie | ||
0_count=5 16 I 15064570 255 21M * 0 0 CAAGACAGAGCTTCACCGTTC IIIIIIIIIIIIIIIIIIIII XA:i:0 MD:Z:21 NM:i:0 XM:i:2 |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Oops, something went wrong.