A notebook that creates an example of an SBOL2 Generic Location #28
Conversation
… pysbol2. This addresses #26
|
I think this isn't very informative yet, because it isn't concrete enough to really show the value of the representation. That would be a little more complicated, but I think a lot more compelling. The total representation would be:
|
|
@jakebeal - I agree with your comment there and I like the idea. How about we have a simpler notebook that just shows Generic Location. But we can also add another notebook showing a Cre-Lox recombination? I've added another notebook (outside the CreatingSBOL2Objects folder). Happy to hear your thoughts. |
|
We can also add a note pointing users to the Cre-Lox example (or perhaps a ReadMe in the sbol2 folder) |
|
I think there's no point in using GenericLocation without this level of complexity. I would thus suggest that instead of making a low-content GenericLocation, that we have this notebook's documentation point to the notebooks for SequenceConstraint, SequenceAnnotation, etc. as prerequisites |
…e pointing users to the more complex CreLox notebook.
|
I've modified the Generic Location notebook to reflect your comments. I've also added a link to the Cre-Lox notebook while providing users with a simpler code snippet to understand how to create a Generic Location. |
| "\n", | ||
| "# Component for the second loxP site\n", | ||
| "loxP2 = sbol2.ComponentDefinition('loxP_site_2', sbol2.BIOPAX_DNA)\n", | ||
| "loxP2_seq = sbol2.Sequence('loxP_seq_2', 'ATAACTTCGTATAATGTATGCTATACGAAGTTAT', sbol2.SBOL_ENCODING_IUPAC)\n", |
There was a problem hiding this comment.
Since these two sites have the same sequence, we should use only one ComponentDefinition for loxP, and include two different instances via Component objects.
| "metadata": {}, | ||
| "outputs": [], | ||
| "source": [ | ||
| "import sbol2\n", |
There was a problem hiding this comment.
This is a giant block of code. I would suggest breaking it into chunks with key code comments moving to instead by notebook text.
| "doc.addComponentDefinition(loxP2)\n", | ||
| "\n", | ||
| "# Create a Component for the CDS (Coding Sequence)\n", | ||
| "# The CDS is unknown or \"not yet selected,\" so we can use a generic placeholder sequence\n", |
There was a problem hiding this comment.
We should not use any sequence at all. What you've got specified right here incorrectly constraints to an unknown of a specific length. Just omit the sequence.
| "# Create SequenceConstraints to describe the relationships\n", | ||
| "# Constraint to ensure that loxP1 and CDS are adjacent\n", | ||
| "constraint1 = recombination_system.sequenceConstraints.create('loxP1_to_CDS')\n", | ||
| "constraint1.subject = loxP1_comp.identity\n", |
There was a problem hiding this comment.
I don't believe you need to pull identity out on any of these. I believe the assignment routine will do that automatically for you.
Co-authored-by: Jacob Beal <[email protected]>
Co-authored-by: Jacob Beal <[email protected]>
Co-authored-by: Jacob Beal <[email protected]>
Co-authored-by: Jacob Beal <[email protected]>
Co-authored-by: Jacob Beal <[email protected]>
Co-authored-by: Jacob Beal <[email protected]>
This addresses #26