- Perform some initial data exploration! Record any bash commands you used inside a lab notebook (submit to this repo!).
Look at each of the file using zcat:
zcat /projects/bgmp/shared/2017_sequencing/1294_S1_L008_R1_001.fastq.gz | head -4
@K00337:83:HJKJNBBXX:8:1101:1265:1191 1:N:0:1
GNCTGGCATTCCCAGAGACATCAGTACCCAGTTGGTTCAGACAGTTCCTCTATTGGTTGACAAGGTCTTCATTTCTAGTGATATCAACACGGTGTCTACAA
+
A#A-<FJJJ<JJJJJJJJJJJJJJJJJFJJJJFFJJFJJJAJJJJ-AJJJJJJJFFJJJJJJFFA-7<AJJJFFAJJJJJF<F--JJJJJJF-A-F7JJJJ
zcat /projects/bgmp/shared/2017_sequencing/1294_S1_L008_R2_001.fastq.gz | head -4
@K00337:83:HJKJNBBXX:8:1101:1265:1191 2:N:0:1
NCTTCGAC
+
#AA<FJJJ
zcat /projects/bgmp/shared/2017_sequencing/1294_S1_L008_R3_001.fastq.gz | head -4
@K00337:83:HJKJNBBXX:8:1101:1265:1191 3:N:0:1
NTCGAAGA
+
#AAAAJJF
zcat /projects/bgmp/shared/2017_sequencing/1294_S1_L008_R4_001.fastq.gz | head -4
@K00337:83:HJKJNBBXX:8:1101:1265:1191 4:N:0:1
NTTTTGATTTACCTTTCAGCCAATGAGAAGGCCGTTCATGCAGACTTTTTTAATGATTTTGAAGACCTTTTTGATGATGATGATGTCCAGTGAGGCCTCCC
+
#AAFAFJJ-----F---7-<FA-F<AFFA-JJJ77<FJFJFJJJJJJJJJJAFJFFAJJJJJJJJFJF7-AFFJJ7F7JFJJFJ7FFF--A<A7<-A-7--
-
Initial Data Exploration Continued:
a. Determine which files contain the indexes, and which contain the paired end reads containing the biological data of interest. Create a table and label each file with either read1, read2, index1, or index2.
b. Determine the length of the reads in each file.
c. Determine the phred encoding for these data.
File name | label | Read length | Phred encoding |
---|---|---|---|
1294_S1_L008_R1_001.fastq.gz | read 1 | 101 | +33 |
1294_S1_L008_R2_001.fastq.gz | index 1 | 8 | +33 |
1294_S1_L008_R3_001.fastq.gz | index 2 | 8 | +33 |
1294_S1_L008_R4_001.fastq.gz | read 2 | 101 | +33 |
-
Generate a per base distribution of quality scores for read1, read2, index1, and index2. Average the quality scores at each position for all reads and generate a per nucleotide mean distribution as you did in part 1 of PS4 in Bi621. (NOTE! Do NOT use the 2D array strategy from PS9 - you WILL run out of memory!)
Write up a strategy (NOT A SCRIPT) for writing an algorithm to de-multiplex files and reporting index-hopping. That is, given four input FASTQ files (2 with biological reads, 2 with index reads) and the 24 known indexes above, demultiplex reads by index-pair, outputting:
- one R1 FASTQ file and one R2 FASTQ file per matching index-pair,
- another two FASTQ files for non-matching index-pairs (index-hopping), and
- two additional FASTQ files when one or both index reads are unknown or low quality (do not match the 24 known indexes [this includes indexes with 'N's in them] or do not meet a quality score cutoff)
Add the sequence of the index-pair to the header of BOTH reads in all of your FASTQ files for all categories (e.g. add “AAAAAAAA-CCCCCCCC” to the end of headers of every read pair that had an index1 of AAAAAAAA and an index2 of CCCCCCCC; this pair of reads would be in the unknown category as one or both of these indexes do not match the 24 known indexes).
Additionally, your algorithm should report:
- the number of read-pairs with properly matched indexes (per index-pair),
- the number of read pairs with index-hopping observed, and
- the number of read-pairs with unknown index(es).
You should strive to report values for each possible pair of indexes (both swapped and dual matched). You should not write any code for this portion of the assignment.
Looked over classmates puedocode:
- https://github.com/calzamora/Demultiplex/blob/master/Assignment-the-first/pseudo_code_pt2.txt
- https://github.com/lenarayneallen/Demultiplex/blob/master/psuedocode.txt
- https://github.com/troycho/Demultiplex/blob/master/pseudocode.md
Write your code to demultiplex the samples. Be sure to:
-
Incorporate feedback from peer code reviews
- one big if statement with elif statements instead of many nested if statements
-
Utilize appropriate functions
- import bioinfo, argparse, gzip
-
Sufficiently comment your code/use docstrings/use type annotations on functions
-
Use unit tests on functions/entire algorithm to ensure it works properly
-
Create a useful report for the end user of your code
-
Use
argparse
to "generalize" your code -
Be mindful of "simple" things you can do to optimize your code
-
Follow the specifications laid out in Assignment the First for the code. Unclear? Ask!
Final work will be submitted on GitHub in the Assignment-the-Third folder. Make sure your folder is well organized and final output is clearly labeled/summarized (a markdown file would be much appreciated!!). Use your code to demultiplex the samples and report:
- Percentage of reads from each sample
- Overall amount of index swapping
- Any figures/any other relevant data your code output
Total Number of Reads: 363246735
Amount of Unknown Reads: 31828861
Percentage of Unknown Reads: 8.762325420488638%
Amount of Matched Reads: 330738415
Percentage of Matched Reads: 91.05062293264659%
Amount of Hopped Reads: 679459
Percentage of Hopped Reads: 0.1870516468647681%
Total Number of Reads: 363246735
Amount of Unknown Reads: 57748853
Percentage of Unknown Reads: 15.897968910856141%
Amount of Matched Reads: 304980270
Percentage of Matched Reads: 83.95953510772782%
Amount of Hopped Reads: 517612
Percentage of Hopped Reads: 0.1424959814160477%