Merge pull request #24 from openscilab/doc

Document

AUTHORS.md

@@ -1,12 +1,16 @@
 # Core Developers
-
 ----------
 - Sepand Haghighi - Open Science Laboratory ([Github](https://github.com/sepandhaghighi)) **
 - AmirHosein Rostami  - Open Science Laboratory ([Github](https://github.com/AHReccese)) **
 - Sadra Sabouri - Open Science Laboratory ([Github](https://github.com/sadrasabouri))
+- Mojtaba Moghadam - University of Zanjan ([Github](https://github.com/mojtaba-moghadam))
 
 ** **Maintainer**
 
 # Other Contributors
 ----------
+- [@boreshnavard](https://github.com/boreshnavard) ++
+
+
+++ **Graphic designer**
 

CHANGELOG.md

@@ -5,9 +5,7 @@ The format is based on [Keep a Changelog](http://keepachangelog.com/en/1.0.0/)
 and this project adheres to [Semantic Versioning](http://semver.org/spec/v2.0.0.html).
 
 ## [Unreleased]
-### Added
-### Changed
-## [0.1] - 2024-06-05
+## [0.1] - 2024-11-xx
 ### Added
 - `MeltingTemperature` enum
 - Basic melting temperature calculation

README.md

@@ -1,56 +1,34 @@
 <div align="center">
-    <img src="https://github.com/openscilab/opr/raw/main/otherfiles/logo.png" width="280" height="400">
+    <img src="https://github.com/openscilab/opr/raw/main/otherfiles/logo.png" width="250">
+    <h1>OPR: Optimized Primer</h1>
     <br/>
-    <br/>
-    <a href="https://codecov.io/gh/openscilab/opr">
-        <img src="https://codecov.io/gh/openscilab/opr/branch/main/graph/badge.svg" alt="Codecov"/>
-    </a>
-    <a href="TODO">
-        <img src="TODO" alt="PyPI version" height="18">
-    </a>
-    <a href="https://www.python.org/">
-        <img src="https://img.shields.io/badge/built%20with-Python3-green.svg" alt="built with Python3">
-    </a>
-    <a href="TODO">
-        <img src="TODO" alt="Discord Channel">
-    </a>
+    <a href="https://codecov.io/gh/openscilab/opr"><img src="https://codecov.io/gh/openscilab/opr/branch/main/graph/badge.svg" alt="Codecov"></a>
+    <a href="https://badge.fury.io/py/opr"><img src="https://badge.fury.io/py/opr.svg" alt="PyPI version" height="18"></a>
+    <a href="https://www.python.org/"><img src="https://img.shields.io/badge/built%20with-Python3-green.svg" alt="built with Python3"></a>
+    <a href="https://discord.gg/8mBspwXqcA"><img src="https://img.shields.io/discord/1064533716615049236.svg" alt="Discord Channel" style="height: 24px;"></a>
 </div>
 
 ----------
 
-## Table of contents
-
-* [Overview](https://github.com/openscilab/opr#overview)
-* [Installation](https://github.com/openscilab/opr#installation)
-* [Usage](https://github.com/openscilab/opr#usage)
-* [Issues & Bug Reports](https://github.com/openscilab/opr#issues--bug-reports)
-* [Todo](https://github.com/openscilab/opr/blob/main/TODO.md)
-* [Contribution](https://github.com/openscilab/opr/blob/main/.github/CONTRIBUTING.md)
-* [Authors](https://github.com/openscilab/opr/blob/main/AUTHORS.md)
-* [License](https://github.com/openscilab/opr/blob/main/LICENSE)
-* [Show Your Support](https://github.com/openscilab/opr#show-your-support)
-* [Changelog](https://github.com/openscilab/opr/blob/main/CHANGELOG.md)
-* [Code of Conduct](https://github.com/openscilab/opr/blob/main/.github/CODE_OF_CONDUCT.md)
-
 
 ## Overview
 <p align="justify">
-OPR is an open source Python package that provides ... TODO
+<b>OPR</b> is an open-source Python package designed to simplify and streamline primer design and analysis for biologists and bioinformaticians. <b>OPR</b> enables users to design, validate, and optimize primers with ease, catering to a wide range of applications such as PCR, qPCR, and sequencing. With a focus on user-friendliness and efficiency, <b>OPR</b> aims to bridge the gap between biological research and computational tools, making primer-related workflows faster and more reliable.
 </p>
 <table>
     <tr>
         <td align="center">PyPI Counter</td>
         <td align="center">
-            <a href="TODO">
-                <img src="TODO">
+            <a href="https://pepy.tech/projects/opr">
+                <img src="https://static.pepy.tech/badge/opr">
             </a>
         </td>
     </tr>
     <tr>
         <td align="center">Github Stars</td>
         <td align="center">
             <a href="https://github.com/openscilab/opr">
-                <img src="TODO">
+                <img src="https://img.shields.io/github/stars/openscilab/opr.svg?style=social&label=Stars">
             </a>
         </td>
     </tr>
@@ -64,10 +42,10 @@ OPR is an open source Python package that provides ... TODO
     <tr>
         <td align="center">CI</td>
         <td align="center">
-            <img src="https://github.com/openscilab/opr/workflows/CI/badge.svg?branch=main">
+            <img src="https://github.com/openscilab/opr/actions/workflows/test.yml/badge.svg?branch=main">
         </td>
         <td align="center">
-            <img src="https://github.com/openscilab/opr/workflows/CI/badge.svg?branch=dev">
+            <img src="https://github.com/openscilab/opr/actions/workflows/test.yml/badge.svg?branch=dev">
             </td>
     </tr>
 </table>
@@ -76,7 +54,6 @@ OPR is an open source Python package that provides ... TODO
 ## Installation
 
 ### PyPI
-
 - Check [Python Packaging User Guide](https://packaging.python.org/installing/)
 - Run `pip install opr==0.1`
 ### Source code
@@ -85,6 +62,46 @@ OPR is an open source Python package that provides ... TODO
 
 ## Usage
 
+### Load
+```pycon
+>>> from opr import Primer
+>>> primer1 = Primer(sequence="CTGGAGGACGGAAGAGGAAGTAA")
+>>> primer1.sequence
+'CTGGAGGACGGAAGAGGAAGTAA'
+```
+
+### Properties
+
+#### Molecular weight
+```pycon
+>>> primer1.molecular_weight
+7235.79
+```
+#### GC content
+```pycon
+>>> primer1.gc_content
+0.5217391304347826
+```
+#### Melting temperature
+```pycon
+>>> primer1.melting_temperature()
+57.056521739130446
+```
+### Operations
+
+#### Reverse
+```pycon
+>>> primer1_reversed = primer1.reverse()
+>>> primer1_reversed.sequence
+'AATGAAGGAGAAGGCAGGAGGTC'
+```
+#### Complement
+```pycon
+>>> primer1_complemented = primer1.complement()
+>>> primer1_complemented.sequence
+'GACCTCCTGCCTTCTCCTTCATT'
+```
+
 ## Issues & bug reports
 
 Just fill an issue and describe it. We'll check it ASAP! or send an email to [[email protected]](mailto:[email protected] "[email protected]"). 
@@ -93,12 +110,22 @@ Just fill an issue and describe it. We'll check it ASAP! or send an email to [op
 
 You can also join our discord server
 
-<a href="TODO">
-  <img src="TODO" alt="Discord Channel">
+<a href="https://discord.gg/8mBspwXqcA">
+  <img src="https://img.shields.io/discord/1064533716615049236.svg?style=for-the-badge" alt="Discord Channel">
 </a>
 
+## References
+					
+<blockquote>1- <a href="http://biotools.nubic.northwestern.edu/OligoCalc.html">Oligo Calc: Oligonucleotide Properties Calculator</a></blockquote>
+
+<blockquote>2- Marmur, Julius, and Paul Doty. "Determination of the base composition of deoxyribonucleic acid from its thermal denaturation temperature." <i>Journal of molecular biology</i> 5.1 (1962): 109-118.</blockquote>
+
+<blockquote>3- Wallace, R. Bruce, et al. "Hybridization of synthetic oligodeoxyribonucleotides to Φ X 174 DNA: the effect of single base pair mismatch." <i>Nucleic acids research</i> 6.11 (1979): 3543-3558.</blockquote>
+
+<blockquote>4- Panjkovich, Alejandro, and Francisco Melo. "Comparison of different melting temperature calculation methods for short DNA sequences." <i>Bioinformatics 21.6</i> (2005): 711-722.</blockquote>
+
 
-## Show Your Support
+## Show your support
 
 
 ### Star this repo

otherfiles/meta.yaml

@@ -24,7 +24,7 @@ about:
     license_family: MIT
     summary: Python library for machine learning input and output
     description: |
-        OPR is an open source Python package that provides... TODO
+        OPR is an open-source Python package designed to simplify and streamline primer design and analysis for biologists and bioinformaticians. OPR enables users to design, validate, and optimize primers with ease, catering to a wide range of applications such as PCR, qPCR, and sequencing. With a focus on user-friendliness and efficiency, OPR aims to bridge the gap between biological research and computational tools, making primer-related workflows faster and more reliable.
         
         Website: https://openscilab.com
 

setup.py

@@ -23,30 +23,29 @@ def read_description():
             description += c.read()
         return description
     except Exception:
-        return '''TODO'''
+        return '''OPR is an open-source Python package designed to simplify and streamline primer design and analysis for biologists and bioinformaticians. OPR enables users to design, validate, and optimize primers with ease, catering to a wide range of applications such as PCR, qPCR, and sequencing. With a focus on user-friendliness and efficiency, OPR aims to bridge the gap between biological research and computational tools, making primer-related workflows faster and more reliable.'''
 
 
 setup(
     name='opr',
     packages=[
         'opr', ],
     version='0.1',
-    description='TODO',
+    description='OPR: Optimized Primer',
     long_description=read_description(),
     long_description_content_type='text/markdown',
     author='OPR Development Team',
     author_email='[email protected]',
     url='https://github.com/openscilab/opr',
     download_url='https://github.com/openscilab/opr/tarball/v0.1',
-    keywords="python3 python machine_learning ML",
+    keywords="primer biology bioinformatics genome dna pcr",
     project_urls={
             'Source': 'https://github.com/openscilab/opr',
     },
     install_requires=get_requires(),
     python_requires='>=3.6',
     classifiers=[
         'Development Status :: 3 - Alpha',
-        'Intended Audience :: Developers',
         'Natural Language :: English',
         'License :: OSI Approved :: MIT License',
         'Operating System :: OS Independent',
@@ -63,13 +62,12 @@ def read_description():
         'Intended Audience :: End Users/Desktop',
         'Intended Audience :: Manufacturing',
         'Intended Audience :: Science/Research',
-        'Topic :: Scientific/Engineering :: Information Analysis',
         'Topic :: Education',
         'Topic :: Scientific/Engineering',
+        'Topic :: Scientific/Engineering :: Information Analysis',
         'Topic :: Scientific/Engineering :: Artificial Intelligence',
-        'Topic :: Scientific/Engineering :: Human Machine Interfaces',
         'Topic :: Scientific/Engineering :: Mathematics',
-        'Topic :: Scientific/Engineering :: Physics',
+        'Topic :: Scientific/Engineering :: Bio-Informatics',
     ],
     license='MIT',
 )