Primer3 JNI setup

Makefile

@@ -0,0 +1,22 @@
+include config
+
+UNAME := $(shell uname)
+ifeq ($(UNAME), Darwin)
+	libt=-dynamiclib
+else
+	libt=-shared
+endif
+copy: libPrimer3.so
+	-(cp libPrimer3.so dist/)
+libPrimer3.so: thal.o oligotm.o
+	gcc $(libt) -o $@ edu_msu_cme_rdp_primerdesign_utils_Primer3Wrapper.c thal.o oligotm.o -I$(java_jni_include) -I$(java_jni_include_os) -I. -lm
+		#gcc -shared -fPIC -o $@ edu_msu_cme_rdp_primerdesign_utils_Primer3Wrapper.c thal.o oligotm.o -I$(java_jni_include) -I$(java_jni_include_os) -I. -lm
+thal.o:
+	gcc -c -Wall -fPIC -o $@ thal.c
+
+oligotm.o:
+	gcc -c -Wall -fPIC -o $@ oligotm.c -lm
+
+clean:
+	rm *.o
+	rm *.so

Primer3Wrapper.java

@@ -0,0 +1,101 @@
+/*
+ * Copyright (C) 2015  RDPStaff gunturus at msu dot edu>
+ *
+ * This program is free software: you can redistribute it and/or modify
+ * it under the terms of the GNU General Public License as published by
+ * the Free Software Foundation, either version 3 of the License, or
+ * (at your option) any later version.
+ *
+ * This program is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with this program.  If not, see <http://www.gnu.org/licenses/>.
+ */
+
+package edu.msu.cme.rdp.primerdesign.utils;
+
+/**
+ *
+ * @author gunturus
+ */
+
+public class Primer3Wrapper {
+    private double _mv = 50.0;
+    private double _dv = 0.0;
+    private double _dntp = 0.0;
+    private double _dna = 50.0;
+    private double _temp_c = 37;
+    private int _max_loop = 30;
+    private int _tm_method = 0;
+    private int _salt_method = 0;
+
+    public Primer3Wrapper() {
+        System.load("/home/gunturus/PrimerDesign/jni/libPrimer3.so");
+        initThermoPath("/home/gunturus/PrimerDesign/jni/");
+    }
+
+    private static native void initThermoPath(String path);
+    private native double calcTm(String seq, double d, double mv, double dv, double n, int tm_method, int salt_method);
+    private native double calcThermo(String seq1, String seq2, int maxLoop, double mv, double dv, double dntp, double dna_conc, double temp, int temponly, int dimer, int aligntype);
+
+    public double calcTemp(String seq) {
+        return calcTm(seq, _dna, _mv, _dv, _dntp, _tm_method, _salt_method);
+    }
+
+    public double calcSpecial(String seq1, String seq2, String type) {
+        if (type.equals("HAIRPIN")) {
+            return calcThermo(seq1, seq2, _max_loop, _mv, _dv, _dntp, _dna, _temp_c, 1, 0, 4);
+        }
+        else {
+            return calcThermo(seq1, seq2, _max_loop, _mv, _dv, _dntp, _dna, _temp_c, 1, 0, 1);
+        }
+    }
+
+    public double calcHairpinTm(String seq) {
+        return calcSpecial(seq,seq,"HAIRPIN");
+    }
+
+    public double calcHomodimerTm(String seq) {
+        return calcSpecial(seq,seq,"ANY");
+    }
+
+    public double calcHetrodimerTm(String seq1, String seq2) {
+        return calcSpecial(seq1, seq2, "ANY");
+    }
+
+    public void setMv(int mv) {
+        _mv = mv;
+    }
+
+    public void setDv(double dv) {
+        _dv = dv;
+    }
+
+    public void setDntp(double dntp) {
+        _dntp = dntp;
+    }
+
+    public void setDna(double dna) {
+        _dna = dna;
+    }
+
+    public void setTemp(double temp) {
+        _temp_c = temp;
+    }
+
+    public void setMaxLoop(int maxloop) {
+        _max_loop = maxloop;
+    }
+
+    public static void main(String[] args) {
+
+        Primer3Wrapper primer3 = new Primer3Wrapper();
+
+        double ret = primer3.calcHomodimerTm("GACGTAGAACAAGATCCGGAT");
+        System.out.println(ret);
+
+    }
+}

config

@@ -0,0 +1,6 @@
+#What is your operating system (options: mac or linux)
+os=mac
+#location of the Java JNI include directory
+java_jni_include=/Library/Java/JavaVirtualMachines/jdk1.8.0_121.jdk/Contents/Home/include/
+#location of the Java JNI operating system specific directory. This will be in same directory as java_jni_include.
+java_jni_include_os=/Library/Java/JavaVirtualMachines/jdk1.8.0_121.jdk/Contents/Home/include/darwin

edu_msu_cme_rdp_primerdesign_utils_Primer3Wrapper.c

@@ -0,0 +1,72 @@
+#include "edu_msu_cme_rdp_primerdesign_utils_Primer3Wrapper.h"
+#include "oligotm.h"
+#include "thal.h"
+#include <unistd.h>
+#include <string.h>
+
+JNIEXPORT void JNICALL Java_edu_msu_cme_rdp_primerdesign_utils_Primer3Wrapper_initThermoPath(JNIEnv *env, jclass obj, jstring path) {
+  thal_results o;
+  char *configpath = (char *)(*env)->GetStringUTFChars(env, path, 0);
+  strcat(configpath,"/primer3_config/");
+
+  //printf("%s\n",configpath);
+  int i = get_thermodynamic_values("/home/gunturus/PrimerDesign/jni/primer3_config/",&o);
+  //printf("%s\n",o.msg);
+}
+
+JNIEXPORT jdouble JNICALL Java_edu_msu_cme_rdp_primerdesign_utils_Primer3Wrapper_calcTm(JNIEnv *env, jobject obj, jstring seq, jdouble d, jdouble mv, jdouble dv, jdouble dntp, jint tm_method, jint salt_method) {
+
+  const char *sequence = (*env)->GetStringUTFChars(env, seq, 0);
+  tm_method_type tm = tm_method;
+  salt_correction_type salt = salt_method;
+
+  double ret = oligotm(sequence, d, mv, dv, dntp, tm, salt);
+
+  (*env)->ReleaseStringUTFChars(env, seq, sequence);
+
+  return ret; 
+}
+
+JNIEXPORT jdouble JNICALL Java_edu_msu_cme_rdp_primerdesign_utils_Primer3Wrapper_calcThermo(JNIEnv *env, jobject obj, jstring seq1, jstring seq2, jint maxloop, jdouble mv, jdouble dv, jdouble dntp, jdouble dna_conc, jdouble temp, jint temponly, jint dimer, jint aligntype) {
+
+
+  const char *sequence1 = (*env)->GetStringUTFChars(env,seq1,0);
+  const char *sequence2 = (*env)->GetStringUTFChars(env,seq2,0);
+
+  thal_args a;
+
+  a.debug = 0;
+  a.type = (thal_alignment_type) aligntype;
+  a.maxLoop = maxloop;
+  a.mv = mv;
+  a.dv = dv;
+  a.dntp = dntp;
+  a.dna_conc = dna_conc;
+  a.temp = temp;
+  a.temponly = temponly;
+  a.dimer = dimer;
+
+  thal_results o;
+
+  thal(sequence1, sequence2, &a, &o);
+
+  (*env)->ReleaseStringUTFChars(env, seq1, sequence1);
+  (*env)->ReleaseStringUTFChars(env, seq2, sequence2);
+  /*
+  printf("%i\n",a.type);
+  printf("%i\n",a.maxLoop);
+  printf("%s\n",o.msg);
+  printf("%f\n",o.temp);
+  printf("%s\n",sequence1);
+  printf("%s\n",sequence2);
+  printf("%f\n",a.temp);
+  printf("%f\n",a.mv);
+  printf("%f\n",a.dv);
+  printf("%f\n",a.dntp);
+  printf("%f\n",a.dna_conc);
+  printf("%i\n",a.temponly);
+  printf("%i\n",a.dimer);
+  */
+
+  return o.temp;
+}